ID: 1056992624

View in Genome Browser
Species Human (GRCh38)
Location 9:91424712-91424734
Sequence GCGGGTGCGGCGTTCCTCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056992615_1056992624 -9 Left 1056992615 9:91424698-91424720 CCCACCCCCGCCACGCGGGTGCG No data
Right 1056992624 9:91424712-91424734 GCGGGTGCGGCGTTCCTCGGAGG No data
1056992612_1056992624 -2 Left 1056992612 9:91424691-91424713 CCATCTACCCACCCCCGCCACGC No data
Right 1056992624 9:91424712-91424734 GCGGGTGCGGCGTTCCTCGGAGG No data
1056992616_1056992624 -10 Left 1056992616 9:91424699-91424721 CCACCCCCGCCACGCGGGTGCGG No data
Right 1056992624 9:91424712-91424734 GCGGGTGCGGCGTTCCTCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056992624 Original CRISPR GCGGGTGCGGCGTTCCTCGG AGG Intergenic
No off target data available for this crispr