ID: 1056994770

View in Genome Browser
Species Human (GRCh38)
Location 9:91445603-91445625
Sequence CCTCAGAGAACTAGAGCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056994770_1056994779 1 Left 1056994770 9:91445603-91445625 CCAGGGGCTCTAGTTCTCTGAGG No data
Right 1056994779 9:91445627-91445649 GTGGGGTGCAGCATTGGCTTGGG No data
1056994770_1056994784 29 Left 1056994770 9:91445603-91445625 CCAGGGGCTCTAGTTCTCTGAGG No data
Right 1056994784 9:91445655-91445677 GGGGCGCAAGACTGCTCTGTAGG No data
1056994770_1056994777 -5 Left 1056994770 9:91445603-91445625 CCAGGGGCTCTAGTTCTCTGAGG No data
Right 1056994777 9:91445621-91445643 TGAGGGGTGGGGTGCAGCATTGG No data
1056994770_1056994780 7 Left 1056994770 9:91445603-91445625 CCAGGGGCTCTAGTTCTCTGAGG No data
Right 1056994780 9:91445633-91445655 TGCAGCATTGGCTTGGGCACTGG No data
1056994770_1056994782 9 Left 1056994770 9:91445603-91445625 CCAGGGGCTCTAGTTCTCTGAGG No data
Right 1056994782 9:91445635-91445657 CAGCATTGGCTTGGGCACTGGGG No data
1056994770_1056994778 0 Left 1056994770 9:91445603-91445625 CCAGGGGCTCTAGTTCTCTGAGG No data
Right 1056994778 9:91445626-91445648 GGTGGGGTGCAGCATTGGCTTGG No data
1056994770_1056994785 30 Left 1056994770 9:91445603-91445625 CCAGGGGCTCTAGTTCTCTGAGG No data
Right 1056994785 9:91445656-91445678 GGGCGCAAGACTGCTCTGTAGGG No data
1056994770_1056994781 8 Left 1056994770 9:91445603-91445625 CCAGGGGCTCTAGTTCTCTGAGG No data
Right 1056994781 9:91445634-91445656 GCAGCATTGGCTTGGGCACTGGG No data
1056994770_1056994783 10 Left 1056994770 9:91445603-91445625 CCAGGGGCTCTAGTTCTCTGAGG No data
Right 1056994783 9:91445636-91445658 AGCATTGGCTTGGGCACTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056994770 Original CRISPR CCTCAGAGAACTAGAGCCCC TGG (reversed) Intergenic