ID: 1056994784

View in Genome Browser
Species Human (GRCh38)
Location 9:91445655-91445677
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056994770_1056994784 29 Left 1056994770 9:91445603-91445625 CCAGGGGCTCTAGTTCTCTGAGG No data
Right 1056994784 9:91445655-91445677 GGGGCGCAAGACTGCTCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056994784 Original CRISPR GGGGCGCAAGACTGCTCTGT AGG Intergenic