ID: 1056998108

View in Genome Browser
Species Human (GRCh38)
Location 9:91483068-91483090
Sequence ACTGTTGAGCAGACTGTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1056998108_1056998113 9 Left 1056998108 9:91483068-91483090 CCCTCAACAGTCTGCTCAACAGT No data
Right 1056998113 9:91483100-91483122 TTGAGTTCTCTCCCTGGTGGTGG No data
1056998108_1056998110 3 Left 1056998108 9:91483068-91483090 CCCTCAACAGTCTGCTCAACAGT No data
Right 1056998110 9:91483094-91483116 CACCTGTTGAGTTCTCTCCCTGG No data
1056998108_1056998114 10 Left 1056998108 9:91483068-91483090 CCCTCAACAGTCTGCTCAACAGT No data
Right 1056998114 9:91483101-91483123 TGAGTTCTCTCCCTGGTGGTGGG No data
1056998108_1056998115 19 Left 1056998108 9:91483068-91483090 CCCTCAACAGTCTGCTCAACAGT No data
Right 1056998115 9:91483110-91483132 TCCCTGGTGGTGGGTTCCAAAGG No data
1056998108_1056998112 6 Left 1056998108 9:91483068-91483090 CCCTCAACAGTCTGCTCAACAGT No data
Right 1056998112 9:91483097-91483119 CTGTTGAGTTCTCTCCCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1056998108 Original CRISPR ACTGTTGAGCAGACTGTTGA GGG (reversed) Intergenic
No off target data available for this crispr