ID: 1057006720

View in Genome Browser
Species Human (GRCh38)
Location 9:91567271-91567293
Sequence CTCGGCCAGGTTTTTATTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057006710_1057006720 25 Left 1057006710 9:91567223-91567245 CCACCTTGGCCTCCCAAAGTGCT 0: 55360
1: 145174
2: 158991
3: 100124
4: 51656
Right 1057006720 9:91567271-91567293 CTCGGCCAGGTTTTTATTTATGG No data
1057006716_1057006720 12 Left 1057006716 9:91567236-91567258 CCAAAGTGCTGGAATTACAGGCA 0: 4304
1: 100967
2: 237366
3: 242802
4: 214495
Right 1057006720 9:91567271-91567293 CTCGGCCAGGTTTTTATTTATGG No data
1057006712_1057006720 22 Left 1057006712 9:91567226-91567248 CCTTGGCCTCCCAAAGTGCTGGA 0: 4169
1: 90549
2: 211997
3: 234153
4: 151009
Right 1057006720 9:91567271-91567293 CTCGGCCAGGTTTTTATTTATGG No data
1057006715_1057006720 13 Left 1057006715 9:91567235-91567257 CCCAAAGTGCTGGAATTACAGGC 0: 8353
1: 231656
2: 273926
3: 181702
4: 144141
Right 1057006720 9:91567271-91567293 CTCGGCCAGGTTTTTATTTATGG No data
1057006708_1057006720 29 Left 1057006708 9:91567219-91567241 CCTCCCACCTTGGCCTCCCAAAG 0: 21198
1: 71365
2: 150513
3: 157804
4: 132965
Right 1057006720 9:91567271-91567293 CTCGGCCAGGTTTTTATTTATGG No data
1057006709_1057006720 26 Left 1057006709 9:91567222-91567244 CCCACCTTGGCCTCCCAAAGTGC 0: 28733
1: 128252
2: 230554
3: 215949
4: 130370
Right 1057006720 9:91567271-91567293 CTCGGCCAGGTTTTTATTTATGG No data
1057006713_1057006720 16 Left 1057006713 9:91567232-91567254 CCTCCCAAAGTGCTGGAATTACA 0: 11596
1: 306145
2: 263594
3: 149163
4: 135954
Right 1057006720 9:91567271-91567293 CTCGGCCAGGTTTTTATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057006720 Original CRISPR CTCGGCCAGGTTTTTATTTA TGG Intronic
No off target data available for this crispr