ID: 1057008849

View in Genome Browser
Species Human (GRCh38)
Location 9:91583974-91583996
Sequence CACCCACTCCCCTCCCTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057008843_1057008849 6 Left 1057008843 9:91583945-91583967 CCCCTGACCTGGCTTGTCTAACT 0: 1
1: 0
2: 1
3: 11
4: 133
Right 1057008849 9:91583974-91583996 CACCCACTCCCCTCCCTGACAGG No data
1057008842_1057008849 11 Left 1057008842 9:91583940-91583962 CCTCTCCCCTGACCTGGCTTGTC 0: 1
1: 0
2: 3
3: 36
4: 360
Right 1057008849 9:91583974-91583996 CACCCACTCCCCTCCCTGACAGG No data
1057008844_1057008849 5 Left 1057008844 9:91583946-91583968 CCCTGACCTGGCTTGTCTAACTG 0: 1
1: 0
2: 1
3: 8
4: 98
Right 1057008849 9:91583974-91583996 CACCCACTCCCCTCCCTGACAGG No data
1057008841_1057008849 12 Left 1057008841 9:91583939-91583961 CCCTCTCCCCTGACCTGGCTTGT 0: 1
1: 0
2: 2
3: 40
4: 396
Right 1057008849 9:91583974-91583996 CACCCACTCCCCTCCCTGACAGG No data
1057008846_1057008849 -1 Left 1057008846 9:91583952-91583974 CCTGGCTTGTCTAACTGTTGCCC 0: 1
1: 0
2: 1
3: 11
4: 163
Right 1057008849 9:91583974-91583996 CACCCACTCCCCTCCCTGACAGG No data
1057008845_1057008849 4 Left 1057008845 9:91583947-91583969 CCTGACCTGGCTTGTCTAACTGT 0: 1
1: 0
2: 0
3: 15
4: 134
Right 1057008849 9:91583974-91583996 CACCCACTCCCCTCCCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057008849 Original CRISPR CACCCACTCCCCTCCCTGAC AGG Intronic
No off target data available for this crispr