ID: 1057009897

View in Genome Browser
Species Human (GRCh38)
Location 9:91591514-91591536
Sequence GACCCAGGTGGTGCTCACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 208}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057009897_1057009907 25 Left 1057009897 9:91591514-91591536 CCCCTGTGAGCACCACCTGGGTC 0: 1
1: 0
2: 3
3: 17
4: 208
Right 1057009907 9:91591562-91591584 CTCACTCAGCCTGCTCTTGAGGG No data
1057009897_1057009906 24 Left 1057009897 9:91591514-91591536 CCCCTGTGAGCACCACCTGGGTC 0: 1
1: 0
2: 3
3: 17
4: 208
Right 1057009906 9:91591561-91591583 TCTCACTCAGCCTGCTCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057009897 Original CRISPR GACCCAGGTGGTGCTCACAG GGG (reversed) Intronic
900400222 1:2469992-2470014 CACCCAGGTGCTGCTCTCTGGGG - Intronic
900507964 1:3039084-3039106 GCTCCAGGTGGTGCCGACAGGGG + Intergenic
903008441 1:20313890-20313912 GACCAAGGAGGTGTTCACGGAGG + Intronic
904993583 1:34613688-34613710 GACTCAGGTCCTGCTCACAGTGG - Intergenic
906153655 1:43601872-43601894 CACCCAGTTGGTGCTCAGTGAGG + Intronic
908094030 1:60718430-60718452 AATCCAGGTGGTGATCACATGGG + Intergenic
909623777 1:77693270-77693292 GACCCTGATGGAGCTAACAGAGG - Intergenic
910732063 1:90408547-90408569 GTCCCACTTGGTGCCCACAGCGG - Intergenic
913722156 1:121607702-121607724 GACACAGGTAGTTCTCACATTGG - Intergenic
913741941 1:121855282-121855304 GACACAGGTAGTTCTCACATTGG - Intergenic
920682652 1:208084553-208084575 TCCCCAGCTGGTGCCCACAGAGG - Exonic
921743284 1:218710289-218710311 GACCCAGGTTGAGCCCACACTGG - Intergenic
922857323 1:228786058-228786080 GAACCAGGAGGAGTTCACAGAGG + Intergenic
923052901 1:230401289-230401311 GACACAGGTGGCGCTCATGGCGG + Intronic
1063134876 10:3207841-3207863 GACCCTGGTGCTGCTCGCAAAGG - Intergenic
1065367153 10:24947950-24947972 TTCCCAGGTTCTGCTCACAGAGG + Intronic
1065980194 10:30887306-30887328 GACCCAGGTGCTTCTCCCTGTGG + Intronic
1066048809 10:31617438-31617460 GATCCAGGTGGAGGGCACAGGGG - Intergenic
1070694819 10:78554390-78554412 GACCCAAGTGCTGATGACAGAGG + Intergenic
1070739552 10:78893749-78893771 CAGCCAGGTGTTGCTAACAGTGG - Intergenic
1073470294 10:103717935-103717957 GAGGCAGGTCATGCTCACAGTGG + Intronic
1074106226 10:110391739-110391761 AACCCAGGTGGACCTCACCGCGG - Intergenic
1075572017 10:123552995-123553017 GAGCCAGGTGTTGGCCACAGAGG - Intergenic
1075663962 10:124217755-124217777 GACCTGGGTGGTTCTCTCAGAGG - Intergenic
1075809593 10:125215416-125215438 GTCCAAGGTGGTGTTCACAGAGG - Intergenic
1076239421 10:128892694-128892716 TCCCCAGGCGGTCCTCACAGGGG - Intergenic
1076724482 10:132407104-132407126 GCCCCACGTGGTGATTACAGGGG - Intronic
1076884382 10:133255132-133255154 GACCCAGGTGGTGGAGAAAGGGG - Intergenic
1077183704 11:1227394-1227416 CACCCAGGTGGCACTCACTGTGG - Exonic
1077290112 11:1785197-1785219 GCCCCAGATGCTGCTCCCAGAGG + Intergenic
1077427528 11:2490438-2490460 TAGCCAGGTAGTGCTTACAGCGG + Intronic
1077468716 11:2746858-2746880 GTCCCCAGTGGGGCTCACAGGGG - Intronic
1077479774 11:2808104-2808126 TGCCCAAGTGGTGCCCACAGTGG - Intronic
1077507755 11:2940034-2940056 TACCCAGGTGGGCCTCACAAGGG + Intergenic
1078091420 11:8266859-8266881 CACACAGGTGATGCTCAGAGAGG + Intronic
1078107127 11:8365514-8365536 GACCCAGGTTGGGCTTCCAGGGG + Intergenic
1079362721 11:19782677-19782699 GACCCAGGTGCTGTTCCCAAGGG + Intronic
1079610883 11:22431364-22431386 GAGCCAGATTGTGCTCAAAGTGG - Intergenic
1081406720 11:42707133-42707155 GGACCAGGAGGTGCTCAGAGAGG - Intergenic
1083175041 11:60944304-60944326 GGCGAAGGTGGTGCTAACAGCGG - Intronic
1084650901 11:70488646-70488668 GACCCAGAAGGGGCTCACTGAGG - Intronic
1087834889 11:102863566-102863588 GACCCAGCTAGGGCACACAGGGG + Intronic
1089659524 11:119976998-119977020 CGCCCTCGTGGTGCTCACAGAGG + Intergenic
1089928770 11:122287528-122287550 GACCCAGGTGCTGCTGAGGGGGG + Intergenic
1091399481 12:173576-173598 GCCCCAGGTGGTGCTGCCCGAGG + Intronic
1091855436 12:3735720-3735742 TACACTGGTGGTTCTCACAGTGG + Intronic
1101917803 12:108909636-108909658 GACCTTGGTGGTGTTCACAATGG - Intergenic
1102473449 12:113173569-113173591 GACCCAGGCGGGGGTCACACAGG + Intronic
1103903956 12:124317960-124317982 GACCCCGGTGATGCCCTCAGAGG + Intergenic
1104830888 12:131750520-131750542 GACCCAGGAGATTCTCACAGAGG - Intronic
1105072387 12:133242627-133242649 GACCTGGGTGATGCTCCCAGAGG - Intergenic
1108278841 13:48840530-48840552 GACCCTGATGGAGCTCACAGAGG - Intergenic
1115178289 14:30591226-30591248 GACCTAGGTGGTGCTCAAAGGGG + Intronic
1117508357 14:56424629-56424651 CACCCAGGTGGTGCTCGCAGGGG - Intergenic
1117764720 14:59069772-59069794 GAGCCTGGTGGTGCTCACAGAGG - Intergenic
1117947461 14:61043878-61043900 GACCAAGGTTCTACTCACAGGGG - Intronic
1119085886 14:71738552-71738574 GACCCAGATGGTGCTGGCTGAGG - Intronic
1120864610 14:89285061-89285083 AATCCAGGTGGTTCTCACAATGG - Intronic
1121005648 14:90489158-90489180 GAACCAGGTGGGGCTCAGTGGGG + Intergenic
1122723041 14:103732681-103732703 GACCCAGCTGAAGCTGACAGTGG + Exonic
1124441610 15:29689665-29689687 GCCCCAGGTGGAGCTGGCAGGGG - Intergenic
1124497065 15:30193106-30193128 GCCCCTCCTGGTGCTCACAGTGG - Intergenic
1124652263 15:31482798-31482820 GAGGCAGGTAGAGCTCACAGAGG + Exonic
1125762704 15:42108017-42108039 GATCAAGGTGGTGGTTACAGGGG + Intergenic
1125933553 15:43616494-43616516 GGCCTAAGTGGTTCTCACAGAGG + Exonic
1125946651 15:43715956-43715978 GGCCTAAGTGGTTCTCACAGAGG + Intergenic
1128079011 15:64845273-64845295 GCCTCAGGAGCTGCTCACAGTGG + Intronic
1128134082 15:65249819-65249841 GACCCAGGAGGTGAGCCCAGAGG - Intronic
1129191361 15:73939434-73939456 GACAGAGGTGGAGCTCAGAGAGG + Intronic
1129642277 15:77393043-77393065 AACTCAGCTGGTGCCCACAGAGG + Intronic
1131968517 15:97870151-97870173 GACCCATGTGGCACTCAGAGTGG - Intergenic
1132661030 16:1061615-1061637 GCCCCAGGTGGTCCTCATGGAGG + Intergenic
1135684753 16:24489890-24489912 GGACCAGGTGGAGCTCACATAGG - Intergenic
1136112855 16:28075704-28075726 GACCCAGGCCCTGCTCACCGTGG - Intergenic
1136615526 16:31396030-31396052 GACCTAGGTGGGGCTCACCCAGG - Intronic
1138226293 16:55298225-55298247 CACCCAGTTGGAGCTCACAGTGG - Intergenic
1138653190 16:58473491-58473513 GAGCCAGGTGGAGCTCCCCGTGG - Intronic
1140558889 16:75954416-75954438 GATCCACGCGGTGCACACAGAGG + Intergenic
1141091479 16:81133302-81133324 GACCCACGTTGTCCTCACATTGG - Intergenic
1142009552 16:87706870-87706892 GAGCGGGGAGGTGCTCACAGGGG + Intronic
1142177711 16:88652554-88652576 GACCCAGGAGGTGGGCGCAGGGG + Exonic
1143030498 17:3964545-3964567 GACCCAGGCGGTGCGCCCCGGGG - Intergenic
1143462797 17:7114698-7114720 GGGGCAGGTGGAGCTCACAGGGG + Intronic
1143554105 17:7650329-7650351 GAGCCAGGTGGTGTGGACAGGGG + Intronic
1144807868 17:17979475-17979497 GGCCGAGGTGGTGGCCACAGGGG + Intronic
1147319313 17:39636497-39636519 GTCCCCGGTGGGGCACACAGCGG + Exonic
1147605066 17:41769746-41769768 GACCCAGGTGGGGCTGTCTGTGG - Intronic
1150282899 17:63939842-63939864 AGCCCTGGTGGTGCTCACGGAGG + Exonic
1151979865 17:77502378-77502400 GAGCCAGGGGGTGCCCAGAGAGG - Intergenic
1153074752 18:1149163-1149185 TAGCCAGGTGGTGATTACAGGGG + Intergenic
1154367160 18:13721717-13721739 AACCCAGGTTCTCCTCACAGTGG - Intronic
1155299074 18:24412261-24412283 GACAGTGGTGGTGCTCACAATGG - Intergenic
1156488445 18:37481593-37481615 GCCCCAGGTGGTTCTCAGAGTGG + Intronic
1157966188 18:52211020-52211042 GATCCAGGTGGTGGGCAGAGAGG + Intergenic
1161631763 19:5360498-5360520 GACACAGGTGGGGGACACAGAGG - Intergenic
1163249586 19:16118541-16118563 GACCCAGATGGTGCCCACTGTGG - Intronic
1164703415 19:30302482-30302504 GACCCGGGTGGTCCTCAGACAGG + Intronic
1164963907 19:32462588-32462610 CTCCCAGGTGTGGCTCACAGTGG - Intronic
926111942 2:10189174-10189196 GGCCGAGGAGGTGCTCACAAGGG + Intronic
926140191 2:10363922-10363944 GACTCAGCTGGTGCTCAGGGAGG + Intronic
926737209 2:16082709-16082731 GCCCCGGGTGATCCTCACAGTGG + Intergenic
928170686 2:29001141-29001163 GACCCAGCTGGGGCTCAAGGTGG + Intronic
929171705 2:38938656-38938678 GATCTGGGTGGTGATCACAGGGG - Intronic
929772093 2:44900832-44900854 GACTCAGGGGTGGCTCACAGAGG + Intergenic
932711612 2:74069513-74069535 GATCCAGGTGGTGGTCACACAGG - Intronic
937156695 2:119724908-119724930 GGCCCTGGTGGGGCCCACAGTGG + Intergenic
937825435 2:126364024-126364046 GAACAAGTTGCTGCTCACAGGGG + Intergenic
938587641 2:132707285-132707307 AACTCAGCTGGTGCCCACAGAGG + Intronic
940006894 2:149016408-149016430 GACCCAGGTGGTGGCAGCAGGGG + Intronic
941055663 2:160785137-160785159 GATCCAGGTCTGGCTCACAGTGG + Intergenic
942494553 2:176526085-176526107 GACCCAGCTGCTGCTCTCAAAGG - Intergenic
944235505 2:197438136-197438158 GACCCAGGTTTGGCTCACGGTGG - Intergenic
947320471 2:228911984-228912006 CACCAAGGATGTGCTCACAGAGG + Intronic
1172781613 20:37439911-37439933 GGGGCAGGTGGTGGTCACAGAGG - Intergenic
1175232318 20:57481664-57481686 GAGCCGGGTGGTGCACACTGTGG - Intergenic
1179823424 21:43950703-43950725 GCCCCAGGTAGTGCTGTCAGCGG + Intronic
1179999798 21:44990327-44990349 GAGCCAGGTGCTGCACAGAGAGG - Intergenic
1180987169 22:19911844-19911866 AACCCAGGTGTTGCTCCCTGGGG - Intronic
1181717027 22:24738410-24738432 TAGCCTGGTGGTGGTCACAGTGG + Intronic
1181876848 22:25946175-25946197 GACGCAGAAGGTGCTCACAGCGG + Exonic
1182459841 22:30475805-30475827 GACCCCAGTGGCGCTCTCAGTGG + Intergenic
1183978894 22:41528303-41528325 GACCCAGGTGGCACCTACAGGGG - Exonic
1184450542 22:44579936-44579958 TACCCTGGTGGTTCTCAAAGTGG - Intergenic
1184950031 22:47834480-47834502 GACCCGGGGGGTGGTCCCAGTGG + Intergenic
950334229 3:12180868-12180890 GACACAGGATGAGCTCACAGGGG - Intronic
952796422 3:37243227-37243249 GGCCTACGTGGAGCTCACAGAGG - Intronic
954425563 3:50441104-50441126 TACCCAGGTGGTGGGGACAGGGG + Intronic
956689803 3:71865022-71865044 GCCCCAGGTGGTGAACACAGCGG + Intergenic
962649179 3:137471388-137471410 TACCCAAGTGGTTCTCAAAGTGG - Intergenic
964659501 3:159104727-159104749 TACTTAGGTGGTGCTCACAAGGG - Intronic
964686672 3:159403565-159403587 AACTCAGCTGGTGCCCACAGAGG + Intronic
965693871 3:171386270-171386292 GACCCAGCTGGTACTCTCAGAGG - Intronic
967275705 3:187772474-187772496 GATCCAGGTGGTGATCAAAGAGG + Intergenic
968084181 3:195867278-195867300 GGCCCTAGTGGTGCTGACAGGGG - Intronic
968107239 3:196009671-196009693 GACCCTGGCGGTGCACACACTGG + Intergenic
968551136 4:1223850-1223872 GGCCCAGGTTGAGCTCAGAGCGG - Intronic
968643279 4:1725762-1725784 GGCCCAGGTGGTGGTCACTGTGG + Intronic
968808814 4:2791060-2791082 GCCCCATGCGGTGCTAACAGTGG + Intergenic
969681781 4:8647116-8647138 GACCCTGGTGGCGCCAACAGAGG + Intergenic
970443429 4:16104731-16104753 GAGCCAGGTGGTGAGGACAGAGG + Intergenic
971358388 4:25914477-25914499 GCACCACGTGGAGCTCACAGAGG - Intronic
971617708 4:28813518-28813540 AACCCAGATGGTTCTTACAGAGG - Intergenic
975836400 4:78426689-78426711 AAGGCAAGTGGTGCTCACAGGGG + Intronic
978074607 4:104513129-104513151 GCCCCAGGTGTGGCTCACGGTGG + Intergenic
978400271 4:108323661-108323683 GACCCAGGCCTGGCTCACAGTGG + Intergenic
982544042 4:156710743-156710765 GGCTCAGGTCCTGCTCACAGTGG - Intergenic
985758809 5:1734375-1734397 GGCCCAGGAGGTGCTGCCAGAGG + Intergenic
986634256 5:9804311-9804333 GACCCATCTGGTGCTGTCAGTGG - Intergenic
987340319 5:16934265-16934287 GACCCCTGTGGTGCTCAGACAGG + Intronic
988066626 5:26233316-26233338 GACCCTGGCGGTGCACACACAGG + Intergenic
988082630 5:26433115-26433137 AACTCAGTTGGTACTCACAGAGG + Intergenic
989637805 5:43555966-43555988 GAACTAGGTGGAGCTCTCAGGGG + Exonic
990827919 5:59922702-59922724 TAGCCAGGTGGTACTCACTGTGG + Intronic
992771978 5:80057324-80057346 GACCATGGTAGTGATCACAGTGG + Intronic
993903002 5:93596955-93596977 GACCCAGGCCGGGCTGACAGTGG + Intergenic
994338136 5:98593507-98593529 GGTCTTGGTGGTGCTCACAGTGG + Intergenic
997211695 5:132080705-132080727 CACCCAGGTGGTGCACCCAAGGG - Intergenic
999804632 5:155070344-155070366 GATCCAGGTGGTGGCAACAGGGG - Intergenic
1000919244 5:167119023-167119045 GACCCAGGTGGTTCTTAGAATGG - Intergenic
1001010296 5:168091676-168091698 GACCCAGGTTGTGGAAACAGTGG + Intronic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1001450265 5:171819126-171819148 GGCCCAGGTCTGGCTCACAGTGG + Intergenic
1001732330 5:173969495-173969517 GACCCAGGAAGTCCTCTCAGAGG - Intergenic
1002571168 5:180140097-180140119 GACCCAGGTGCTGGGCACATGGG + Intronic
1002786363 6:403273-403295 GACACAGGAGATGCTGACAGGGG - Intronic
1003361106 6:5425935-5425957 GAGGCAGGTGGGGCTCAAAGAGG + Intronic
1003414792 6:5898137-5898159 GGCCCAGGTCCTGCTCATAGTGG - Intergenic
1004563845 6:16777235-16777257 AACCTGGGTGGTGGTCACAGAGG + Intergenic
1004657255 6:17675211-17675233 AACCCAGTTAGTACTCACAGGGG + Exonic
1006602179 6:35233390-35233412 GGCCCAGGTGCTGGGCACAGAGG + Intronic
1006787694 6:36679335-36679357 CAGCCAGGTGGTGGACACAGTGG - Intronic
1006977355 6:38115565-38115587 GACCAAGGTGGGGGTGACAGAGG + Intronic
1007414219 6:41682777-41682799 GACCCAGACGGGGCTCAGAGGGG + Intergenic
1008043976 6:46833099-46833121 TGCCCATGTGGTGCTCAAAGAGG + Exonic
1011072648 6:83402499-83402521 GAGGCATGTGGTGCTCAAAGTGG - Intronic
1011322755 6:86115422-86115444 TAGCCAGGTGGTGGTTACAGTGG - Intergenic
1017950382 6:159130756-159130778 GTCCCAGGTGGTGCTGACCTGGG - Intergenic
1018240874 6:161773146-161773168 GATCCAGGTGGTGGTTACAGAGG + Intronic
1024508661 7:50185194-50185216 GGCCCAGGTGGAGCACAAAGAGG - Intergenic
1026512184 7:71036758-71036780 GACCTCGGTGGTGGTCACACAGG - Intergenic
1027230184 7:76267848-76267870 GGCCCAGGTGGTGCCCAGTGGGG - Intronic
1031308237 7:120161244-120161266 GACTCAGATGGTGTTCACTGCGG - Intergenic
1031848475 7:126834086-126834108 GAACCAGGAGGTGCCAACAGAGG + Intronic
1034702653 7:153109753-153109775 TACCCAGGTGGCGTGCACAGAGG - Intergenic
1035366712 7:158353150-158353172 GAGGCAGGGGGTGCTCCCAGTGG - Intronic
1035643627 8:1201603-1201625 GACACAGGTGCAGCTCACACAGG + Intergenic
1036606036 8:10306561-10306583 GACCTTGCTGGTGCTGACAGTGG + Intronic
1036962841 8:13264614-13264636 GACCCAGGAGGGGCACACACGGG + Intronic
1037823683 8:22148083-22148105 GGCATACGTGGTGCTCACAGAGG + Exonic
1038002098 8:23400681-23400703 TACTCAGGTGATGCTCAGAGAGG + Intronic
1038269564 8:26064288-26064310 GTCCTAGGTGTGGCTCACAGTGG - Intergenic
1038866240 8:31441421-31441443 GACACAGGTGGTATTCAGAGTGG - Intergenic
1039345057 8:36694111-36694133 GTCCCAGCTGGTGTTCAAAGTGG + Intergenic
1040537021 8:48319344-48319366 GCCCCAGGTGGTGGCCGCAGAGG + Intergenic
1041579815 8:59446353-59446375 GAGGCAGGTGGTGGTTACAGTGG - Intergenic
1043226926 8:77745279-77745301 GACTCAGCTGGCACTCACAGAGG + Intergenic
1045062798 8:98423699-98423721 GACCCAACTGTTCCTCACAGTGG + Intronic
1045222657 8:100213584-100213606 TTCCCAGGTGCTGCTCACTGAGG - Intronic
1049381596 8:142319133-142319155 GAGCAAGGTGGTCCTCGCAGTGG - Intronic
1051115235 9:13686797-13686819 GATCTAGGTGGTGCTTACACAGG + Intergenic
1053416173 9:37948161-37948183 GAGCTAGGTCATGCTCACAGTGG + Intronic
1057009897 9:91591514-91591536 GACCCAGGTGGTGCTCACAGGGG - Intronic
1057313824 9:93956829-93956851 GCCCCACATGGAGCTCACAGAGG - Intergenic
1057410577 9:94813661-94813683 GTCCCAGCAGGTGCTGACAGTGG + Intronic
1059285847 9:113170917-113170939 GCTCCTAGTGGTGCTCACAGTGG - Intronic
1059737893 9:117120590-117120612 AACCTAGGTGTAGCTCACAGTGG + Intronic
1060224688 9:121783730-121783752 GACCCAGGCGCTGCATACAGGGG + Exonic
1060539770 9:124421444-124421466 GTCCCAGGCCTTGCTCACAGTGG - Intergenic
1061367086 9:130177712-130177734 GAGCAAGCTGGTGCTCAGAGAGG - Intronic
1061524350 9:131146244-131146266 GAACTAGGTGGTGCTGAGAGAGG - Exonic
1061903311 9:133683995-133684017 TACCCAGATGGAGCTCAGAGAGG - Intronic
1062275341 9:135727748-135727770 GACAGAGGTGGGGCCCACAGGGG + Intronic
1062451653 9:136618269-136618291 CCCCCAGGTGGTTCTCACACAGG - Intergenic
1189208419 X:39262002-39262024 GATCCAGGGGTTCCTCACAGGGG + Intergenic
1190015222 X:46820526-46820548 TAACCAGGTGGTGGTTACAGAGG + Intergenic
1190062590 X:47220661-47220683 GACTCAGTTTGTGCTGACAGAGG + Intronic
1190113583 X:47610999-47611021 GGCCCAGGTCCTGCTTACAGTGG + Intronic
1191188429 X:57638848-57638870 TAACCAGGTAGTGGTCACAGTGG + Intergenic
1192221757 X:69202141-69202163 GACCTAGGTGGTGGTTACAGAGG - Intergenic
1192552115 X:72062774-72062796 GCCCCAGCTGCTGCCCACAGGGG - Intergenic
1192890821 X:75389130-75389152 AACTCAGCTGGTGCCCACAGAGG + Intronic
1193052499 X:77116006-77116028 AACTCAGCTGATGCTCACAGAGG - Intergenic
1193742246 X:85231711-85231733 AACTCAGCTGGTGCCCACAGAGG + Intergenic
1194500794 X:94678848-94678870 TAGCCAGGTGGTGGTTACAGTGG - Intergenic
1196512183 X:116524530-116524552 AACTCAGATGGTGCCCACAGAGG - Intergenic
1200008917 X:153107152-153107174 GACCCAGGAGGTGCCCACAAGGG + Intergenic
1200030683 X:153292770-153292792 GACCCAGGAGGTGCCCACAAGGG - Intergenic
1200576077 Y:4891112-4891134 TAGCCAGGTAGTGCTAACAGTGG - Intergenic
1200951394 Y:8902854-8902876 GAGCCAGGTGGTAGGCACAGGGG - Intergenic