ID: 1057013380

View in Genome Browser
Species Human (GRCh38)
Location 9:91628459-91628481
Sequence ACATAACTACAGATGTATCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057013380_1057013385 28 Left 1057013380 9:91628459-91628481 CCCCGATACATCTGTAGTTATGT 0: 1
1: 0
2: 0
3: 9
4: 63
Right 1057013385 9:91628510-91628532 CACCTCCTTTGTGCTGCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057013380 Original CRISPR ACATAACTACAGATGTATCG GGG (reversed) Intronic
904100892 1:28026162-28026184 ACATAACTACAGAGGAATGGTGG + Intronic
905603753 1:39277521-39277543 AGATAACAACAGATGTATGAAGG - Intronic
906727024 1:48051593-48051615 ACATCATTACAGATGTCTCTTGG - Intergenic
924082786 1:240416605-240416627 ACATAAGTACAGATGGAATGAGG - Intronic
1068902582 10:62286346-62286368 ACAAACCTACAGATGTACCCCGG + Intergenic
1079400284 11:20101399-20101421 AAATTGCAACAGATGTATCGTGG - Intronic
1080371440 11:31649862-31649884 ACAGAAGTACAGATGTAAAGAGG - Intronic
1085776184 11:79368849-79368871 ACATAACAACAGCTGTCTCGCGG + Intronic
1087116084 11:94526277-94526299 ACATCACTTCACATGTATGGAGG + Intergenic
1094552803 12:31468917-31468939 ACAAAACTACAGATATAACAGGG + Intronic
1100723857 12:97387657-97387679 ACATAAATTCAGATGTAACACGG + Intergenic
1104737464 12:131145529-131145551 TCATACCTACAGATGTTTCTGGG - Intergenic
1106644755 13:31620475-31620497 ACATAACTATAGATATATATGGG + Intergenic
1110305258 13:73979686-73979708 ACATAAGTACAGATACAGCGAGG + Intronic
1116348081 14:43822326-43822348 ACATAACTATAGATGTAAATGGG - Intergenic
1118491116 14:66261291-66261313 GCATAAAAACAGATGTATAGAGG - Intergenic
1118979374 14:70703808-70703830 ACATAACTAAAGATATTTCTGGG - Intergenic
1130552897 15:84903237-84903259 ACTTAACTACAGTTTTATCCAGG - Intronic
1135386080 16:22041502-22041524 ACTTAACTACAGTTGTAACCTGG - Intronic
1203097639 16_KI270728v1_random:1274810-1274832 ACATAAGTACACATGTGCCGTGG + Intergenic
1149429688 17:56587883-56587905 GAATAACTACATATGTATTGGGG + Intergenic
1152683540 17:81682716-81682738 ACATAAACACAGACGTACCGGGG + Intronic
1155750584 18:29418067-29418089 TCATAAGTACAGATGTATAGGGG - Intergenic
1160429613 18:78802459-78802481 ACATAGCTACAGATGTGCCATGG + Intergenic
1164535068 19:29079626-29079648 GCACAGCTACAGATGTGTCGCGG + Intergenic
1166422457 19:42649587-42649609 ACATATCTACACATGTATTTTGG - Intronic
1168352798 19:55686228-55686250 ACATAACTGGAAATGTTTCGTGG - Intronic
925012082 2:493737-493759 ACATAAATAAACATGTATCATGG + Intergenic
927320026 2:21732805-21732827 ACATAAGTAAATATGTATCACGG - Intergenic
941033799 2:160543841-160543863 ATAAAACTACAGAAGTATCAGGG - Intergenic
943107880 2:183570093-183570115 ACCTAACTAGAGATGTCTCCAGG + Intergenic
946861024 2:224000580-224000602 ACATAGGTACACATGTGTCGTGG + Intronic
1169607260 20:7336205-7336227 ACATAATTACACATGCACCGGGG - Intergenic
1172394625 20:34592493-34592515 GCATAACTATAGATGTATCAGGG + Intronic
1175666334 20:60863394-60863416 ACATAACTGCAAATGTATAGAGG + Intergenic
1177874423 21:26613377-26613399 ACATAACTACTGATGTCTCCTGG + Intergenic
1182707064 22:32290143-32290165 ACATAAGTACACATGTGCCGTGG + Intergenic
952695072 3:36255529-36255551 ACATAAGTAAAGATGTGTCATGG - Intergenic
956354049 3:68371271-68371293 ACATAAATATACATGTGTCGTGG + Intronic
956625974 3:71267048-71267070 ACATTACTTCTGATGTATTGAGG - Intronic
959204896 3:103294010-103294032 CCATAACAACAGATGCATCAAGG + Intergenic
978186212 4:105859535-105859557 ACATATATACAAATGTATTGTGG - Intronic
978406869 4:108389321-108389343 ACATAAGTACACATGTGCCGTGG - Intergenic
984602470 4:181744281-181744303 ACATACCCACACATGTATCTTGG + Intergenic
988319570 5:29676164-29676186 ACATAACTACATGTGTGTCATGG + Intergenic
999478382 5:151922941-151922963 ATAGAACTACAAATGTATGGAGG - Intronic
999956463 5:156708587-156708609 ACATACAAACAGATGTATTGAGG + Intronic
1002801349 6:524292-524314 ACATAGATACAGATGTGCCGTGG - Intronic
1004436558 6:15600763-15600785 CCATCACTACAGATTTATCCAGG - Intronic
1004553182 6:16669733-16669755 ACATAAGTATACATGTATCACGG + Intronic
1005227710 6:23661651-23661673 ACAAAAGTACATATGTATTGTGG - Intergenic
1006677190 6:35772777-35772799 ACAAAACTACTACTGTATCGTGG + Intergenic
1012212042 6:96531262-96531284 ACAGAAATACAGATGTATAGAGG - Intronic
1013606656 6:111756159-111756181 ACATAACTACAGATTCAGCAAGG + Intronic
1015141747 6:129942006-129942028 ACATAGATAAAGATGTGTCGTGG - Intergenic
1015486972 6:133783008-133783030 AAATAACTACAAATGAAACGTGG - Intergenic
1019807633 7:3139958-3139980 GCAGAACTACAGCTGGATCGGGG - Intergenic
1020767052 7:12335799-12335821 AGATAAATACATATGTATCATGG - Intronic
1023084029 7:36552068-36552090 ACAAACCTACACATGTATCCTGG - Intronic
1027429694 7:78097759-78097781 ACATAAGTAAAGATGTGTCATGG - Intronic
1033857558 7:145583153-145583175 ACATACCTCCAGCTGCATCGAGG - Intergenic
1039684347 8:39781236-39781258 ACATATATACACATGTATTGGGG + Intronic
1041544449 8:59025995-59026017 ACAGGACTACAGCTTTATCGAGG + Intronic
1042192126 8:66197773-66197795 ACATAAATATGGATGTATGGAGG - Intergenic
1046528483 8:115413233-115413255 AAATCACTACAGAAGCATCGAGG + Exonic
1055584280 9:77741407-77741429 ATATAATGACAGATTTATCGGGG - Intronic
1057013380 9:91628459-91628481 ACATAACTACAGATGTATCGGGG - Intronic
1187662782 X:21568901-21568923 ACCTAACAACAGTTGTATAGTGG + Intronic
1196385812 X:115148659-115148681 ACACAATTACAGATGTATAAAGG + Intronic
1198894258 X:141433909-141433931 ACAAATCTACAGATGTAACTGGG - Intergenic
1200361935 X:155616338-155616360 GCAAATCTACAGATCTATCGTGG + Intronic
1202297241 Y:23372524-23372546 ACATAACTACATATTTATGGAGG + Intergenic
1202573566 Y:26298073-26298095 ACATAACTACATATTTATGGAGG - Intergenic