ID: 1057014272

View in Genome Browser
Species Human (GRCh38)
Location 9:91637124-91637146
Sequence TATACTGAAGGTAGAAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 269
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 243}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057014272_1057014281 29 Left 1057014272 9:91637124-91637146 CCCATCCTTCTACCTTCAGTATA 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1057014281 9:91637176-91637198 ATTTATGCTCTATCAATAGAAGG No data
1057014272_1057014280 -8 Left 1057014272 9:91637124-91637146 CCCATCCTTCTACCTTCAGTATA 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1057014280 9:91637139-91637161 TCAGTATATGAGGCTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057014272 Original CRISPR TATACTGAAGGTAGAAGGAT GGG (reversed) Intronic
901117360 1:6858091-6858113 GATACTGAAGAAAGAAAGATAGG + Intronic
905964308 1:42078587-42078609 TAGGCTGAAGGTAAAGGGATGGG - Intergenic
906143481 1:43546868-43546890 TATTCAGAAGGTAGAAGCAACGG - Intronic
906486230 1:46237489-46237511 TAAATTGAAGGTAGATGGTTGGG + Intergenic
908012784 1:59798265-59798287 TATACTCACGGCAGAAGGAAGGG - Intergenic
909119616 1:71585159-71585181 TATACAGAAGGTAAAAATATTGG + Intronic
910410420 1:86937708-86937730 TATATATAAGGTAGAAGGAAAGG - Intronic
912782424 1:112564210-112564232 TATACTGAAGGGAAAAGGAAAGG + Intronic
913256929 1:116962283-116962305 GATACTGAAGTTAGCAAGATGGG - Intronic
917775048 1:178324560-178324582 TGTAATGAAGGTAGAAAGATGGG + Intronic
918741516 1:188137511-188137533 TATATTTAAGGTATAAGAATTGG + Intergenic
919114236 1:193260534-193260556 TATTTTGAAAGTAGATGGATAGG + Intergenic
919340168 1:196295630-196295652 TATACTGTAGTTAAAAGGAGTGG - Intronic
919521998 1:198600271-198600293 TATAATGAAGGTAGAGGCATTGG - Intergenic
919619368 1:199847663-199847685 TTTACTGGAAGTAGAAGGCTGGG - Intergenic
920219443 1:204385870-204385892 TGTACTGAAGGAAGAAGGCAAGG - Intergenic
921295857 1:213702772-213702794 TATACTGAAAATAAAGGGATGGG - Intergenic
924117030 1:240757966-240757988 TCTACTAAAGGTACAAGGGTTGG - Intergenic
1064681166 10:17812085-17812107 TCTCCTGAAGGTGGAAGGAAGGG - Intronic
1065060198 10:21892664-21892686 TAGACTGAAAGTAAAAGGATTGG + Intronic
1066046345 10:31598838-31598860 GATACTGTAGGTAAAAGGCTTGG - Intergenic
1066435829 10:35396186-35396208 TATACTCATGGTGGTAGGATCGG + Intronic
1069198057 10:65579352-65579374 TATACTGAAGGTGCAAAAATAGG + Intergenic
1069865704 10:71501633-71501655 GAGACTGAAGGCAGAAGGGTGGG + Intronic
1071396400 10:85228151-85228173 TATCCTGAAGCTGGAAGGACTGG + Intergenic
1072175841 10:92920944-92920966 GAGACTGAAAGTAAAAGGATGGG - Intronic
1072725933 10:97814014-97814036 TCTTCTGCAGGTAGAAGGAAGGG + Intergenic
1074178043 10:111030536-111030558 TAGACTGAAAGTGAAAGGATGGG - Intergenic
1076813456 10:132901073-132901095 CAGATTGAAGGTAAAAGGATGGG - Intronic
1078114089 11:8427647-8427669 TATACAGAAGGGAGCAGGAGAGG - Intronic
1078742113 11:14076585-14076607 TATACTCATGGTGGAAGGCTGGG + Intronic
1079576231 11:22006262-22006284 AAAACTGAAGGTAGAGAGATTGG + Intergenic
1079917005 11:26381228-26381250 TAAACTGAAGTTAGAATAATGGG - Intronic
1081106413 11:39075416-39075438 TACACTGAAAGTAAAAGGATGGG + Intergenic
1082718215 11:56641078-56641100 TATAGTGAGGGGAGCAGGATTGG - Intergenic
1085703420 11:78764892-78764914 TAAACTGAATCTGGAAGGATGGG + Intronic
1086388012 11:86329420-86329442 TATCCTGAAGGATGAAGGAAAGG + Intronic
1088096448 11:106106153-106106175 TATACTGAAGGGGGAAAGACTGG - Intergenic
1088918719 11:114246181-114246203 TACACTGAGGCTACAAGGATGGG + Intronic
1089233987 11:117007075-117007097 TATATTGAAAATAAAAGGATCGG + Intronic
1090541922 11:127715888-127715910 AATACGGAAGATAGAAGGCTGGG + Intergenic
1091149357 11:133312884-133312906 TATACTGATGATTAAAGGATAGG + Intronic
1092307479 12:7316285-7316307 TATACTGAGGGTGGCATGATAGG - Intronic
1093933199 12:24974765-24974787 TGTACTGAAGGCAGCAGGAGGGG + Intergenic
1093971076 12:25376606-25376628 TAGACTGAAGGTCAAAAGATTGG - Intergenic
1094422792 12:30289685-30289707 TACAGTGAAGGGAGCAGGATAGG + Intergenic
1095784681 12:46096437-46096459 TAAACTCAAGGTAAAGGGATGGG + Intergenic
1098579408 12:72081151-72081173 GACAATGAAGGTAGAAGAATTGG + Intronic
1101532917 12:105590828-105590850 TGTAATAAAGTTAGAAGGATAGG - Intergenic
1107160570 13:37222367-37222389 TAGACTGAAAGTAAATGGATGGG - Intergenic
1107258292 13:38457528-38457550 TATACTGTAGATACAATGATAGG + Intergenic
1108525828 13:51285185-51285207 TCTACAGAAAGTAGAAAGATAGG - Intergenic
1108830954 13:54477559-54477581 TTTACTGAAGGGAGAAAGATGGG + Intergenic
1109078368 13:57866075-57866097 TAGACTCCAGGTACAAGGATGGG - Intergenic
1109586012 13:64405924-64405946 TATATTGAAGCTAGAAAGATTGG + Intergenic
1111349605 13:87009972-87009994 TGTACTGAAGGCAAAAAGATGGG - Intergenic
1111583952 13:90260924-90260946 TACACTTAAGGTACAAGCATTGG + Intergenic
1111930977 13:94512950-94512972 TATACAGAAGGTAGAAAGAAGGG + Intergenic
1115454171 14:33582063-33582085 TATCCTGAGGGTATAAGAATGGG - Intronic
1115595654 14:34906381-34906403 TATACATAAGGCAGAAGAATAGG + Intergenic
1116320156 14:43452362-43452384 TTCACCGAAGGTAGAAGGAAAGG - Intergenic
1116644878 14:47514564-47514586 TATACTGATGGTAGAATTACTGG - Intronic
1117291459 14:54337883-54337905 TGAACTGAAGGAAGAAAGATGGG + Intergenic
1117506654 14:56410929-56410951 GTTACTGAAGGAAGAAGAATGGG - Intergenic
1119007703 14:70946916-70946938 TATAATCATGGTAGAAGGAAGGG - Exonic
1119025863 14:71151664-71151686 TACAATGAAGGTACAAGCATCGG - Intergenic
1120198329 14:81511632-81511654 TAAACAGAAGATAGAAGAATAGG - Intronic
1120474923 14:84974755-84974777 GATACTTAATATAGAAGGATGGG + Intergenic
1120617590 14:86727091-86727113 GATATTGAAGGCAGGAGGATGGG - Intergenic
1126149283 15:45507912-45507934 CATACTTAGGGCAGAAGGATAGG + Intronic
1126282303 15:46968321-46968343 TAAGCTGAAAGTAAAAGGATGGG + Intergenic
1127559761 15:60124228-60124250 GATACAGAAGGTAGAAGAACAGG + Intergenic
1128291586 15:66482438-66482460 TATGCTGCAGTTAGAAGGAGGGG - Intronic
1129070811 15:72949185-72949207 TAGACTGAAAGTAAATGGATGGG + Intergenic
1130513526 15:84608174-84608196 GATACTGAAGGGAGAGGGAAAGG - Intronic
1132180077 15:99745656-99745678 TATACTGAAAAGAGAAGGAAGGG + Intergenic
1135945957 16:26865184-26865206 TATGCTGAAAATAGAAGGTTGGG + Intergenic
1138809239 16:60129393-60129415 TATACTGAGGGTAGAACTTTAGG - Intergenic
1140092141 16:71847078-71847100 TACACAAAAGGTGGAAGGATAGG - Intronic
1140325223 16:73994906-73994928 TAAACTGAGGGCGGAAGGATGGG - Intergenic
1143106325 17:4532270-4532292 CAGACTGAAGGAAGAAGGAGGGG - Intronic
1145324664 17:21794128-21794150 TATACTGAAGATAGAAATTTTGG - Intergenic
1145980981 17:29011428-29011450 TATGCTGAAGGAAGAAGAAAGGG + Intronic
1146530457 17:33603814-33603836 ATTACTGAAGGCAGAAGGAGTGG + Intronic
1146784625 17:35708017-35708039 GATACTAAATGTAGAAGGACTGG + Intronic
1148261787 17:46190752-46190774 TATGCTAAAGGTCGAAGGAACGG + Intronic
1153181756 18:2442970-2442992 TATACTGAAAGTATGAGGAAAGG + Intergenic
1153677832 18:7471115-7471137 TACACTGAAGGCAAAAGGAGGGG + Intergenic
1153828962 18:8902957-8902979 TATACTTAAGGTAAAGGGGTGGG + Intergenic
1154962509 18:21324013-21324035 GATTCTGAAGGGAGAAGGATGGG + Intronic
1156290046 18:35739859-35739881 TATATTGAAAGTAAAAGAATGGG - Intergenic
1157139880 18:45095057-45095079 TAGACTGCAGGTGAAAGGATTGG - Intergenic
1158369982 18:56789727-56789749 TGCACTGAAGGTATAAAGATAGG - Intronic
1158500718 18:57998231-57998253 GATGCTGAAGGTAGAGGAATAGG + Intergenic
1158561841 18:58521049-58521071 TTATCTGAAGGTACAAGGATAGG + Intronic
1158753898 18:60299525-60299547 TGTTGTGAAGATAGAAGGATGGG + Intergenic
1159730866 18:72025847-72025869 TATATTGAAGGTAAAAGGATAGG - Intergenic
1167650699 19:50727030-50727052 TCTCCTGAAGGGAGAAGGGTGGG - Intergenic
925453841 2:3996543-3996565 TATAATAAAAGTAGAATGATAGG - Intergenic
926610194 2:14939091-14939113 TAAACTGAAGGTAGAAGCCAAGG + Intergenic
926967055 2:18426330-18426352 TATACTGAATGCCAAAGGATAGG + Intergenic
927375370 2:22407084-22407106 TATCCTGAAGGAAGAAGAAATGG + Intergenic
928250966 2:29679215-29679237 TAGATTGAAAGTAAAAGGATTGG - Intronic
928399515 2:30967729-30967751 GAGACTGAAGGCAGAAAGATGGG - Intronic
929394635 2:41508634-41508656 TGTACTTCAGGGAGAAGGATAGG - Intergenic
929954911 2:46449893-46449915 GATACTGAATATAGAAGAATGGG + Intronic
932947928 2:76259047-76259069 TATACTAAAGGTAGATTAATAGG - Intergenic
933710713 2:85323812-85323834 TATGCTGAAAGCAGAAGGAAGGG + Intronic
934756707 2:96829251-96829273 TATAAAGAAGGGAAAAGGATGGG - Intronic
935136645 2:100310016-100310038 TATACTGTAGGTACAATTATGGG - Intronic
935143052 2:100371787-100371809 TATAATGAAGGTACCAGGAGAGG + Intergenic
935288576 2:101588986-101589008 TAGACTGAAAGTGGAGGGATGGG - Intergenic
935514870 2:104023481-104023503 CATATGGAATGTAGAAGGATAGG - Intergenic
937674117 2:124570648-124570670 TATACTGAAGATGGAAGGTGTGG + Intronic
939160152 2:138578393-138578415 TAAACTGAAGGTAAAAGAATGGG - Intergenic
939187080 2:138873029-138873051 TATACTTAAGGTTTAAGTATAGG - Intergenic
939509706 2:143090316-143090338 TATGCAGAAGGTATAAGGGTTGG + Intergenic
939648203 2:144728244-144728266 TATACTAACTGTTGAAGGATTGG + Intergenic
939866013 2:147473177-147473199 TATCATGAAGGGAGAATGATAGG + Intergenic
940450098 2:153826268-153826290 TATAATCAAGGCAGTAGGATTGG - Intergenic
940599126 2:155835218-155835240 GAGATTGAAGGAAGAAGGATTGG + Intergenic
940824178 2:158391717-158391739 TATACTGAAGGATGAGGCATGGG + Intronic
941060864 2:160845028-160845050 TAAACTTAAGGTAAAGGGATGGG + Intergenic
941541130 2:166786195-166786217 TTTTCTCAAGGTGGAAGGATAGG - Intergenic
942880637 2:180857211-180857233 TACAATGAAGGTACAAGCATTGG + Intergenic
944070261 2:195659561-195659583 AACACTGAGGGTAGAAGGGTTGG - Intronic
944338405 2:198565528-198565550 TATAATGAGGGTACAAGCATTGG - Intronic
944944139 2:204663537-204663559 CGTATTGAAGGTAGATGGATAGG + Intronic
1169056945 20:2630483-2630505 TAGATTGAAAGTAAAAGGATGGG - Intronic
1170122117 20:12922901-12922923 TATAATGAAGGTATAAGCATTGG - Intergenic
1170258769 20:14378438-14378460 TGAACTGAAGCAAGAAGGATGGG - Intronic
1170428284 20:16256898-16256920 TAGACTGAAGGAAGGAGGAAAGG + Intergenic
1172851231 20:37967290-37967312 TAAACTTAAGGTAAAGGGATGGG - Intergenic
1175275484 20:57766635-57766657 TAGACTGAAAGTAAATGGATAGG - Intergenic
1179300526 21:40105158-40105180 TATACTCAAGGTAGAAATCTTGG - Intronic
1180645707 22:17337157-17337179 TATTCTGAGGGAAGAAGGAGAGG - Intergenic
1181120664 22:20666562-20666584 TCTACAGAAGGTAAAAAGATTGG - Intergenic
1182489652 22:30662921-30662943 TATAGTGAAGGTGGAAGCAGAGG + Exonic
950292636 3:11798491-11798513 CATACTGATGGGTGAAGGATGGG + Intronic
952012984 3:28922943-28922965 TATACTGGATGTACAAGCATAGG - Intergenic
952847260 3:37698819-37698841 AATACTGAATATACAAGGATGGG - Intronic
955125982 3:56113202-56113224 TTTACTGAATATAGAAAGATGGG + Intronic
955662712 3:61318306-61318328 TATACTGAAGGAAGAAACACGGG + Intergenic
955680766 3:61499204-61499226 TAGATTGAAAGTAAAAGGATGGG - Intergenic
955758785 3:62255573-62255595 TATAGTGAAGATAGCAGGTTTGG + Intronic
956987571 3:74720056-74720078 TATGCTGAAAGTACATGGATGGG - Intergenic
957541180 3:81571095-81571117 TAAATTCAAGGTGGAAGGATAGG + Intronic
957812306 3:85240197-85240219 TATAATAAAAGTAGATGGATGGG + Intronic
959564446 3:107820175-107820197 TATACAGATGGTAAAAGCATTGG + Intergenic
959768090 3:110058122-110058144 TATCCTGGAGTTAGAGGGATTGG + Intergenic
960511134 3:118550807-118550829 AAGACTGAAGGTAGGAGGAAGGG - Intergenic
961232325 3:125327039-125327061 AAAACTGAAAGTAAAAGGATGGG + Intronic
961232447 3:125329062-125329084 TATACTGAATGGGGAAGGGTTGG + Intronic
961232513 3:125329968-125329990 TATACTGAATGGGGAAGGGTTGG + Intronic
961621805 3:128230253-128230275 TACTCTGAAGGTTGAAGGAGAGG - Intronic
961969036 3:130939856-130939878 AATAGTGGAGGTAGAAGGGTTGG - Intronic
962297924 3:134210442-134210464 CATACAGATGGTAGAATGATAGG - Intronic
963407871 3:144890826-144890848 TATACTCAAGGTTGAAGAAAAGG + Intergenic
963430436 3:145194822-145194844 TATAGTGAAGGAAGAGGGAATGG - Intergenic
963701639 3:148633485-148633507 TATACTGAAAATAAAGGGATGGG + Intergenic
964393552 3:156222158-156222180 TCTACTGAAGGTAGCAGAATTGG - Intronic
964521034 3:157567248-157567270 TAGACTGAAAGTAAAAGGATGGG - Intronic
964545344 3:157828171-157828193 TACAATGAAGGTACAAGCATTGG + Intergenic
967975141 3:195030291-195030313 GATACTGTGGGTCGAAGGATGGG + Intergenic
970664133 4:18318032-18318054 TATACAGAAGGTAGAAAAAAGGG + Intergenic
970887713 4:21005771-21005793 TATAGTGAAGGAGGAAGGACAGG + Intronic
971741262 4:30525045-30525067 TACAATGAAGGTACAAGCATTGG + Intergenic
972745700 4:41930482-41930504 TGAACTGAAGTTATAAGGATGGG + Intergenic
975587413 4:75964308-75964330 TAAACTGAAGGTGGAAGGCTGGG - Intronic
976607799 4:86998850-86998872 GATACTGAAAGTAGAGGGATGGG - Intronic
977203415 4:94143111-94143133 TAGACTGAAGGTAATGGGATGGG + Intergenic
978822512 4:112981690-112981712 TATACCTAAGGAAGAAGCATAGG + Intronic
987957523 5:24760564-24760586 TAGACTGAAAGTAAAGGGATAGG - Intergenic
991140633 5:63237465-63237487 TAGATTGAAAGTAAAAGGATGGG - Intergenic
991194890 5:63921150-63921172 TATACTGCAGGGAAGAGGATTGG - Intergenic
992244354 5:74803737-74803759 TATCCTGAAAGTAGAAGGACAGG - Intronic
992372476 5:76158329-76158351 TAGACTGAAAGTAAAAGGAAAGG + Intronic
992787978 5:80187987-80188009 AAAACTGAAGGCAGAAGGCTGGG + Intronic
992789058 5:80197627-80197649 TGTACTGAAGAAGGAAGGATGGG - Intronic
993300105 5:86198188-86198210 TATGCTGAAACTTGAAGGATAGG + Intergenic
993539999 5:89137464-89137486 TATACTGAAGTTAGAAAGTTGGG + Intergenic
994651025 5:102528685-102528707 TATACTGAGGGAAGAAGGGGAGG + Intergenic
995248268 5:109960344-109960366 TAGACTCAAGGTACCAGGATAGG + Intergenic
998593143 5:143499280-143499302 TGCACTGGAGGAAGAAGGATTGG - Intergenic
999466800 5:151814880-151814902 TATACAGCAGGTAGAAAGATAGG + Intergenic
1000428876 5:161126501-161126523 AATACTAAAGGGAGAAGGGTGGG + Intergenic
1000807973 5:165820973-165820995 GATACAGAAAGTAGAATGATGGG - Intergenic
1000900259 5:166904193-166904215 AATACTGAATGCAGAAGGTTTGG + Intergenic
1001334224 5:170784234-170784256 TATGCTGAAGTGATAAGGATAGG + Intronic
1002550149 5:179982399-179982421 AATACTGCAAGTAGAAAGATGGG + Intronic
1003950745 6:11113403-11113425 TACACAGAAGGTAGAAAGAATGG - Intronic
1004052622 6:12101883-12101905 TATATTGAAAGTGAAAGGATAGG + Intronic
1006477073 6:34262884-34262906 TAAATTGAAAGTGGAAGGATGGG + Intergenic
1006957895 6:37892535-37892557 TCTAGTGAAGGTAGAAGGACAGG - Intronic
1007856563 6:44864237-44864259 TATAATGAAGGTACAGGCATTGG + Intronic
1008186230 6:48394487-48394509 TATATTGAAGGGTGGAGGATGGG - Intergenic
1008351946 6:50501714-50501736 TAGACTGAAAGTAAAGGGATGGG + Intergenic
1008464703 6:51817470-51817492 TATACTGAGGGGAGAGGGAAGGG + Intronic
1008635069 6:53402651-53402673 TCTACCAAAGGTAGAAGGAGGGG - Intergenic
1009669562 6:66729684-66729706 TACAATGAAGGTACAAGCATTGG - Intergenic
1009822420 6:68820291-68820313 TGTAATGAAGGTAGAAAGAAAGG - Intronic
1010728750 6:79365478-79365500 TCTACCAAAGGTAGAAGGAGGGG - Intergenic
1012266812 6:97155035-97155057 TAGATTGAAAGTAAAAGGATGGG - Intronic
1015010832 6:128344978-128345000 TATCCTGAATGTAGGAGAATGGG + Intronic
1016620138 6:146099450-146099472 TCTACTGAGGGTAGAGGGAGAGG + Intronic
1017319277 6:153069888-153069910 TATATTAAAGGTAGAATAATGGG - Intronic
1017803238 6:157918460-157918482 TATACTGAAAGTAAACGGATGGG - Intronic
1018938727 6:168293596-168293618 CACACAGAAAGTAGAAGGATTGG + Intronic
1021109727 7:16679827-16679849 TGTAATTAAGGTAGAAGGTTTGG - Intronic
1021790812 7:24203695-24203717 TATACTGATGGTTGAATGAAAGG + Intergenic
1023641915 7:42267921-42267943 TGTACTGAAGGAAGCAGAATAGG - Intergenic
1024519846 7:50295579-50295601 TAAACTGAGGGTAGAACCATGGG - Intergenic
1024522776 7:50321148-50321170 AAGACTGATGGTAGAAGGAAGGG + Intronic
1024665423 7:51542231-51542253 TAAACTGAAGGTAAAAGCATGGG - Intergenic
1026098664 7:67367014-67367036 GATGCAGAAGGTAGAAGGATGGG + Intergenic
1027160115 7:75796266-75796288 TATTCAGAAGTTAGAAGGCTGGG + Intergenic
1027338385 7:77178999-77179021 TAAACAGAAGGGAGCAGGATTGG + Intronic
1028686602 7:93596670-93596692 TATACTGAAGATATAAAAATGGG + Intronic
1029777343 7:102691803-102691825 TAAACAGAAGGGAGTAGGATTGG - Intergenic
1030532006 7:110722807-110722829 AATACAGATGCTAGAAGGATGGG + Intronic
1030712448 7:112766237-112766259 TCTACTGAAGGTCAGAGGATAGG - Exonic
1030872117 7:114768647-114768669 TATAGTGAAGGTAGATGAAAAGG - Intergenic
1031247895 7:119340489-119340511 TATAAGGAAGGTGGAAGGAAGGG - Intergenic
1032542905 7:132718531-132718553 GAGACAGAAGGGAGAAGGATGGG - Intronic
1032604272 7:133331959-133331981 TATAACTTAGGTAGAAGGATGGG + Intronic
1032916009 7:136491023-136491045 TATTCAGAAGGTAACAGGATGGG - Intergenic
1033240318 7:139673655-139673677 ATCACTGTAGGTAGAAGGATAGG - Intronic
1033720968 7:144059295-144059317 TACAATGAAGGTACATGGATTGG + Intergenic
1034652723 7:152704638-152704660 TTTACTGAAACTAGAAGGAAGGG - Intergenic
1035490148 7:159268955-159268977 TAGACTGAAAGTGCAAGGATGGG - Intergenic
1036111248 8:5905282-5905304 TATTCTGAAGGGAGTAGGAGAGG + Intergenic
1036159394 8:6372419-6372441 AGTACTGAAGGTAGAGGGAAGGG + Intergenic
1037599641 8:20383242-20383264 TCTAGTGAAGGGAGGAGGATGGG - Intergenic
1043305522 8:78789076-78789098 TAGATTGAAAGTAAAAGGATGGG - Intronic
1043834621 8:85032733-85032755 TATAATGGAGGTACAGGGATTGG + Intergenic
1043934451 8:86127743-86127765 CATACAGAATGTACAAGGATAGG - Intronic
1044108271 8:88238707-88238729 TATAAAAAAGGCAGAAGGATAGG - Intronic
1044387776 8:91610259-91610281 TCTGCTGAAAGTAGAAGGATGGG + Intergenic
1044835734 8:96293632-96293654 TATACTGCAAATAGACGGATTGG + Intronic
1044980284 8:97709221-97709243 AATACTAATGGTAGAAGGAGGGG + Intronic
1047148400 8:122232211-122232233 TTTACTGAAACTAGAAGGAAGGG - Intergenic
1047839194 8:128731204-128731226 TAAACTTAAGCTAGAAGGAGAGG - Intergenic
1050812197 9:9762273-9762295 TTTACTGAAGGGACAAAGATGGG - Intronic
1051818185 9:21134036-21134058 GATCCTGAAAGTGGAAGGATAGG - Intergenic
1052508579 9:29384717-29384739 TAGACTGAACGTAAAAGGATAGG + Intergenic
1052862707 9:33446842-33446864 GATTCTGACGGTAGAAGGGTGGG - Intronic
1055001159 9:71450415-71450437 TAAAATAAAGGTAGAAGGCTTGG - Intergenic
1055304313 9:74913040-74913062 TAGACTGAAAGTGGAGGGATGGG + Intergenic
1055368880 9:75575508-75575530 TCTACTGAAGGGGGAAGAATGGG - Intergenic
1057014272 9:91637124-91637146 TATACTGAAGGTAGAAGGATGGG - Intronic
1057376793 9:94531946-94531968 TGTACAGAAGGTGTAAGGATGGG - Intergenic
1058189420 9:101894538-101894560 TATTCAGGAGGTAGAAGCATTGG - Intergenic
1059295966 9:113271063-113271085 TATTCTGAAGGTAGAATCAAAGG + Intronic
1060709180 9:125839566-125839588 TTTAATGTAGGTAGAAGGAGAGG + Intronic
1188757740 X:33985273-33985295 TAGACTGAAAGTAAAAGGGTTGG - Intergenic
1188955145 X:36425160-36425182 TATACAGAATGTACAAGGAAAGG + Intergenic
1188957215 X:36448077-36448099 TACAATGAAGGTACAAGCATTGG + Intergenic
1190567345 X:51743918-51743940 TACCCTCAAGGTAAAAGGATGGG + Exonic
1194106943 X:89781125-89781147 TAGACTGAAAGTAAAGGGATGGG + Intergenic
1196326955 X:114417029-114417051 TATACTTCAGGTAAAAGGAAAGG + Intergenic
1196550659 X:117020029-117020051 CAGACTCAAGGTAAAAGGATGGG + Intergenic
1197267280 X:124388296-124388318 TTTACTGCAGGCAGGAGGATGGG - Intronic
1198076385 X:133197394-133197416 AATACTGATGGGAGAAGGAAAGG + Intergenic
1199207674 X:145167494-145167516 TAGATTCAAGGTAGAATGATAGG + Intergenic
1199210035 X:145197231-145197253 TTTACTGAAGGTAAAAGACTTGG - Intergenic
1200455143 Y:3381164-3381186 TACACTGAAGGTAGTTGGAAGGG - Intergenic
1200458906 Y:3428984-3429006 TAGACTGAAAGTAAAGGGATGGG + Intergenic
1202332757 Y:23771487-23771509 TACACAGAATGTTGAAGGATTGG + Intergenic
1202538012 Y:25898576-25898598 TACACAGAATGTTGAAGGATTGG - Intergenic