ID: 1057014273

View in Genome Browser
Species Human (GRCh38)
Location 9:91637125-91637147
Sequence ATATACTGAAGGTAGAAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 710
Summary {0: 1, 1: 0, 2: 2, 3: 57, 4: 650}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057014273_1057014281 28 Left 1057014273 9:91637125-91637147 CCATCCTTCTACCTTCAGTATAT 0: 1
1: 0
2: 2
3: 57
4: 650
Right 1057014281 9:91637176-91637198 ATTTATGCTCTATCAATAGAAGG No data
1057014273_1057014280 -9 Left 1057014273 9:91637125-91637147 CCATCCTTCTACCTTCAGTATAT 0: 1
1: 0
2: 2
3: 57
4: 650
Right 1057014280 9:91637139-91637161 TCAGTATATGAGGCTGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057014273 Original CRISPR ATATACTGAAGGTAGAAGGA TGG (reversed) Intronic
900710987 1:4113781-4113803 ATTTACTGAAGGAAGGAGGATGG + Intergenic
901189409 1:7398465-7398487 ATAAACTGAAAGTAAAGGGATGG - Intronic
905101657 1:35528962-35528984 ATAGACTGAAAGTAAAGGGATGG - Intronic
905801567 1:40847432-40847454 CTAAACTGAAGGAAGAAGGCAGG + Intergenic
905964309 1:42078588-42078610 ATAGGCTGAAGGTAAAGGGATGG - Intergenic
906486229 1:46237488-46237510 ATAAATTGAAGGTAGATGGTTGG + Intergenic
907093060 1:51747335-51747357 ATATGTTGAAGGTAGAAAGTTGG + Intronic
907155964 1:52334134-52334156 ATATTCTGAAGATAGAAATATGG - Intronic
907984632 1:59518386-59518408 ATATACTAAATGTAGCATGATGG + Intronic
908012785 1:59798266-59798288 TTATACTCACGGCAGAAGGAAGG - Intergenic
908362955 1:63387945-63387967 ATAGACTGAAAATAAAAGGATGG - Intronic
908981986 1:69969410-69969432 ATAAACTTAAGGTAAAGGGATGG + Intronic
911543657 1:99189428-99189450 ATATAGTGTAGGAACAAGGATGG - Intergenic
911689339 1:100814287-100814309 ATAAACTTAAGGTAAAGGGATGG + Intergenic
911903206 1:103530815-103530837 ATATTTTGAAGGTAGAAGCAAGG + Intronic
912034755 1:105299041-105299063 ATAAGCTGAAAATAGAAGGATGG - Intergenic
912406292 1:109440940-109440962 ATATTTTGAAGGTAGGATGATGG - Intergenic
912700776 1:111876785-111876807 ATAGGCTTAAGGGAGAAGGAGGG + Intronic
912918666 1:113843491-113843513 AGAGACAGAAAGTAGAAGGATGG + Intronic
913041964 1:115035864-115035886 AGAAACGGCAGGTAGAAGGAGGG - Intergenic
913256930 1:116962284-116962306 AGATACTGAAGTTAGCAAGATGG - Intronic
913417979 1:118633599-118633621 ATATAGTTAAGGTAAAGGGATGG - Intergenic
913989698 1:143599539-143599561 AGATACTGAAACTAGAATGAAGG + Intergenic
914407651 1:147392311-147392333 ATACATTGAAAGTAAAAGGATGG - Intergenic
915697991 1:157763641-157763663 ATAGACTGAAAGTAAAAGGATGG + Intronic
916617939 1:166462951-166462973 ATACACTGAAAGTAAAGGGATGG - Intergenic
917364256 1:174211759-174211781 ATAGACTGAAAATAAAAGGATGG + Intronic
917563594 1:176186830-176186852 ATATTCTGAAGGTAGGACTATGG + Intronic
917775047 1:178324559-178324581 ATGTAATGAAGGTAGAAAGATGG + Intronic
917874731 1:179276164-179276186 ATAGACTGAAAGTAAAAGAATGG - Intergenic
919590563 1:199496457-199496479 ATAGACTGAAAGTAAAAGGGTGG + Intergenic
919899978 1:202037050-202037072 AGATACTGAAGGTACAAAGTGGG + Intergenic
920596440 1:207276571-207276593 ATAGACTGAAAATAAAAGGATGG - Intergenic
920697955 1:208195946-208195968 AAAGACTGAAGGTACAAGGGAGG + Intronic
920840988 1:209553611-209553633 GTATCCTGAAGGCAGCAGGAAGG - Intergenic
920873370 1:209812575-209812597 ATTTACTGAAGGGTGAATGAAGG - Intergenic
921295858 1:213702773-213702795 ATATACTGAAAATAAAGGGATGG - Intergenic
921460632 1:215421952-215421974 ATAAACTGAGGGCAGAGGGAGGG - Intergenic
924492047 1:244547921-244547943 ATAAACTGAAAGTAAAGGGATGG + Intronic
924890598 1:248274157-248274179 GTATACTGATGGAAAAAGGAAGG + Intergenic
1063253210 10:4296654-4296676 ATAAACTGCAGGTATATGGAAGG + Intergenic
1063904629 10:10768962-10768984 ATATTTGGCAGGTAGAAGGAAGG - Intergenic
1064168965 10:13012580-13012602 ATATACTGCTGGTGGGAGGAGGG + Intronic
1064636170 10:17369889-17369911 ATAGATTGAAAGTAAAAGGATGG - Intronic
1064681167 10:17812086-17812108 CTCTCCTGAAGGTGGAAGGAAGG - Intronic
1064887888 10:20132692-20132714 ATATGCTGAAAGTGAAAGGATGG - Intronic
1064930209 10:20617050-20617072 CTATCGTGAAGGTGGAAGGAAGG + Intergenic
1065691389 10:28337404-28337426 AAATCATGAAGGAAGAAGGAAGG + Intergenic
1067411965 10:46072788-46072810 ATAGACGGAAAGTAGAAGGGTGG + Intergenic
1068112640 10:52697819-52697841 ATATACTTCAGGAAGAGGGAAGG - Intergenic
1068258480 10:54544694-54544716 CAATACTGAAGGTGGAAGGCTGG - Intronic
1068340158 10:55690813-55690835 ATAAACTGAAAGTAAAGGGAAGG - Intergenic
1068731810 10:60366579-60366601 ATACATTGAAGGAAGAAAGAAGG + Intronic
1068815159 10:61301428-61301450 ATATACTGAAGGAAGATTAAGGG + Intergenic
1068844108 10:61651778-61651800 ATATACTGAAAATAAAGGGATGG - Intergenic
1069384964 10:67875843-67875865 ATATACTGCTGGTGGAAGGCAGG + Intergenic
1069865703 10:71501632-71501654 AGAGACTGAAGGCAGAAGGGTGG + Intronic
1070493134 10:76995993-76996015 ATGTACTGCAGGTAGATGAAAGG - Intronic
1070771248 10:79083607-79083629 ATAGACTGAAGGGACAAGGGTGG + Intronic
1070822125 10:79364168-79364190 ATAGACTGAAAGTAAAAGGATGG + Intergenic
1071808907 10:89156516-89156538 ATAGATTCAACGTAGAAGGAAGG + Intergenic
1072175842 10:92920945-92920967 AGAGACTGAAAGTAAAAGGATGG - Intronic
1072392545 10:95002081-95002103 ATAGACTGAAAATAGAAAGATGG + Intergenic
1072725932 10:97814013-97814035 TTCTTCTGCAGGTAGAAGGAAGG + Intergenic
1073049286 10:100657038-100657060 ACATTCTAGAGGTAGAAGGAGGG - Intergenic
1076813457 10:132901074-132901096 ACAGATTGAAGGTAAAAGGATGG - Intronic
1078742112 11:14076584-14076606 ATATACTCATGGTGGAAGGCTGG + Intronic
1078758849 11:14235573-14235595 GTATGCTGAGGGTAGAAGGATGG + Intronic
1079272036 11:18997298-18997320 ATAGACTGAAAATAAAAGGATGG - Intergenic
1080272089 11:30461173-30461195 ATAGACGGAAGGTAGAATGGTGG + Intronic
1080334240 11:31177654-31177676 ATAGACTGAAAGTGGAGGGATGG + Intronic
1081095269 11:38924967-38924989 AGATAGAGAAGGAAGAAGGAAGG - Intergenic
1081106412 11:39075415-39075437 ATACACTGAAAGTAAAAGGATGG + Intergenic
1085675174 11:78510259-78510281 ATAAACTGAAAGTGAAAGGATGG + Intronic
1085826578 11:79854056-79854078 AGATAGTGAAGTTAAAAGGATGG + Intergenic
1086264784 11:84984764-84984786 ATAAACTTAAGGTAAAGGGATGG + Intronic
1086297797 11:85390133-85390155 ATAAACTTAAGGTAAAGGGATGG + Intronic
1086490879 11:87356732-87356754 ATATAATGAATGTGGAAAGAAGG + Intergenic
1086544919 11:87956869-87956891 ATAAACTGAAGGTGGGGGGAGGG - Intergenic
1086672214 11:89561894-89561916 ATATACTGCAGTCAGAAGCAAGG + Intergenic
1086867621 11:91999058-91999080 ATATAGAGAAGGGAGGAGGAGGG + Intergenic
1086923102 11:92610575-92610597 AGATTTTGAAGGTAAAAGGAGGG - Intronic
1087168795 11:95029671-95029693 ATAAACTGAAAGTAGTTGGAAGG + Intergenic
1087227645 11:95620102-95620124 ATAGACTGAAAGTAAAGGGATGG + Intergenic
1087370921 11:97282489-97282511 ATAGACTGAAAATAAAAGGATGG + Intergenic
1087654444 11:100905466-100905488 ATATTTGGAAGGTAGCAGGAAGG - Intronic
1088413315 11:109560979-109561001 ATAAACTCAAGGTAAAAGGATGG - Intergenic
1088918718 11:114246180-114246202 ATACACTGAGGCTACAAGGATGG + Intronic
1089301802 11:117503426-117503448 ATATACACAATGTAGAAGAAGGG - Intronic
1089723918 11:120456241-120456263 AGAAATGGAAGGTAGAAGGAAGG + Intronic
1089945264 11:122464193-122464215 ATCCACTGAAAGTAAAAGGATGG + Intergenic
1090331565 11:125936387-125936409 AGAGACAGAAGGTAGAAGGGTGG - Intergenic
1090541921 11:127715887-127715909 AAATACGGAAGATAGAAGGCTGG + Intergenic
1090609078 11:128453987-128454009 ATTTACTGGAAGTAGACGGAAGG + Intergenic
1090684359 11:129099574-129099596 ATAGATTGAAAGTGGAAGGATGG + Intronic
1090756904 11:129800050-129800072 ATAAACTTAAGGTAAAGGGATGG + Intergenic
1090814253 11:130276998-130277020 ATAGATTGAAAGTAAAAGGATGG - Intronic
1091870373 12:3884979-3885001 AAATCCTGAATGTAGATGGAGGG - Intergenic
1093103984 12:15063890-15063912 ATAAACTGAAAGTAAATGGATGG - Intergenic
1093135973 12:15451113-15451135 ATAAACTTAAGGTAAAGGGATGG + Intronic
1093152013 12:15632999-15633021 AGATGCTGAGGGAAGAAGGAGGG + Intronic
1093315393 12:17643864-17643886 ATATAATGAAGGAGAAAGGAAGG + Intergenic
1093933198 12:24974764-24974786 TTGTACTGAAGGCAGCAGGAGGG + Intergenic
1094559484 12:31537764-31537786 ATAGACTGAAAATAAAAGGATGG + Intronic
1095683241 12:45003010-45003032 ATAGACTAAAAGGAGAAGGATGG - Intergenic
1095784680 12:46096436-46096458 ATAAACTCAAGGTAAAGGGATGG + Intergenic
1095786394 12:46113038-46113060 ATAGACTCAAGGTAAAGGGATGG + Intergenic
1096346545 12:50852319-50852341 ATATGCTCAAAGTAGAGGGATGG + Intronic
1097291320 12:57918099-57918121 AGATAGGGAAGGGAGAAGGAGGG + Intergenic
1097496500 12:60344788-60344810 ATAGATTGAAAGTAAAAGGATGG - Intergenic
1098131061 12:67350593-67350615 ATATCCTGATGGTTGGAGGATGG - Intergenic
1098582695 12:72119885-72119907 ATAAACTGAAAATAAAAGGATGG - Intronic
1098742188 12:74187118-74187140 ATACATTGAAAGTAAAAGGATGG + Intergenic
1098786259 12:74760239-74760261 ATAAACTTAAGGTAGAGGGGCGG - Intergenic
1098852439 12:75612886-75612908 ATAAACTTAAGGTAAATGGATGG + Intergenic
1098887216 12:75972535-75972557 AACTAATAAAGGTAGAAGGAAGG - Intergenic
1099522737 12:83683814-83683836 ATACACTGAAAATAAAAGGATGG + Intergenic
1100118960 12:91345580-91345602 ATATGCAGAAGGCAGTAGGAGGG - Intergenic
1100360537 12:93875260-93875282 ATAGACTGAAAATAAAAGGATGG - Intronic
1100420769 12:94430890-94430912 ATAGACTGAAAGTAAAGGGATGG + Intronic
1100459281 12:94782988-94783010 ATAGACAGAAAGTAGAATGATGG + Intergenic
1100471057 12:94893554-94893576 ATATACAGAATTTACAAGGAGGG - Intergenic
1100706498 12:97205630-97205652 ATAAACTTAAGGTAAAGGGATGG + Intergenic
1100923695 12:99519585-99519607 ATAGACTGAAAATAAAAGGATGG - Intronic
1101102104 12:101404517-101404539 ATTTACTGAAGGTAGCAAAAAGG + Intronic
1104524470 12:129505884-129505906 ATAAACTTAAGGTAGAGGGGTGG - Intronic
1104695788 12:130862610-130862632 ACATACAGACGGTCGAAGGAAGG - Intergenic
1105724878 13:23153378-23153400 ATATAATGCAAGTAGAGGGAAGG - Intergenic
1106060165 13:26282844-26282866 ATAAACTTAAGGTAAAAGGGTGG + Intronic
1106392049 13:29344510-29344532 ATAAACTTAAGGTAGAGGGGTGG - Intronic
1106424749 13:29615835-29615857 ATAAACTTAAGGTAGAGGGATGG + Intergenic
1106722922 13:32454692-32454714 ATAGATGGAAGTTAGAAGGAGGG + Intronic
1106741372 13:32646634-32646656 ACATGCTGAAAGTAAAAGGATGG - Intronic
1106865584 13:33960513-33960535 ATTCACTGACAGTAGAAGGAAGG - Intronic
1107160571 13:37222368-37222390 ATAGACTGAAAGTAAATGGATGG - Intergenic
1107528099 13:41253878-41253900 AAACACTGAAGGTAGGAGGACGG + Intronic
1108830953 13:54477558-54477580 TTTTACTGAAGGGAGAAAGATGG + Intergenic
1108831843 13:54488857-54488879 ATAAACTTAAGGTAAAGGGATGG + Intergenic
1108994423 13:56709570-56709592 ATATCCAGAAGGTAGAATGTAGG - Intergenic
1109078369 13:57866076-57866098 ATAGACTCCAGGTACAAGGATGG - Intergenic
1109218815 13:59619788-59619810 ATAGACTGAAAGTGAAAGGATGG + Intergenic
1110020641 13:70465626-70465648 ATATACTGAAGGAAAAATGAAGG + Intergenic
1110057744 13:70997870-70997892 GTATACTGAATGTAAAAAGATGG + Intergenic
1110601167 13:77375884-77375906 ATATGCTGAAAGGAGAAGCAAGG - Intergenic
1110720480 13:78755610-78755632 ATATACTGAAAGTAGTAGGAGGG - Intergenic
1111559282 13:89923918-89923940 ATACACTGAAGAGAGAAGGCAGG + Intergenic
1111930976 13:94512949-94512971 ATATACAGAAGGTAGAAAGAAGG + Intergenic
1112137210 13:96593883-96593905 ATAGACTAAAGGTGAAAGGATGG - Intronic
1112772843 13:102810300-102810322 ATAGGCTGAAAGTAAAAGGATGG - Intronic
1112790620 13:102999017-102999039 AAATACTAAAGTTAGATGGAAGG + Intergenic
1115405092 14:33006144-33006166 ATGTTCTGAAGGGAGAAGCAGGG - Intronic
1116045985 14:39742945-39742967 ATATACTGAAAATAAAGGGATGG - Intergenic
1116994817 14:51312025-51312047 ATAAACTGAAGGTGACAGGAAGG - Intergenic
1117271560 14:54148851-54148873 ATAAACTTAAGGTAAAAGGGTGG + Intergenic
1117291458 14:54337882-54337904 ATGAACTGAAGGAAGAAAGATGG + Intergenic
1117506655 14:56410930-56410952 AGTTACTGAAGGAAGAAGAATGG - Intergenic
1119007704 14:70946917-70946939 CTATAATCATGGTAGAAGGAAGG - Exonic
1119598534 14:75958508-75958530 ATATGCTGAACGCAGAAGAAAGG - Exonic
1120126024 14:80744608-80744630 TCACACTGAGGGTAGAAGGAGGG - Intronic
1120196306 14:81487242-81487264 ATATACTGAGGGAAGACCGAGGG - Intronic
1120269550 14:82294314-82294336 ATATACTGAATTTTTAAGGAAGG + Intergenic
1120297472 14:82662100-82662122 ATATATTGAAGGTACATGAATGG - Intergenic
1120474922 14:84974754-84974776 AGATACTTAATATAGAAGGATGG + Intergenic
1120555400 14:85924055-85924077 ATATAATGGTGGTATAAGGAAGG + Intergenic
1120572292 14:86135387-86135409 ATAGACTGAAAGTAAAAGGACGG + Intergenic
1120635546 14:86946326-86946348 AAATAAAGAAAGTAGAAGGAAGG - Intergenic
1120918518 14:89731588-89731610 AGAAACAGAAAGTAGAAGGATGG - Intergenic
1121780778 14:96620743-96620765 ATTTGCAGAAGGTTGAAGGAGGG - Intergenic
1123220052 14:106846769-106846791 ATAAACTCAAGGTAAAAGGTTGG - Intergenic
1123433146 15:20235262-20235284 ATACACTGAAGGTTGGAGTAGGG - Intergenic
1123505340 15:20937040-20937062 AGAGACAGAAAGTAGAAGGATGG + Intergenic
1123562578 15:21510751-21510773 AGAGACAGAAAGTAGAAGGATGG + Intergenic
1123598823 15:21948031-21948053 AGAGACAGAAAGTAGAAGGATGG + Intergenic
1123955696 15:25332081-25332103 ATAATCTGAAGATAGAAGGGAGG - Intergenic
1124245153 15:28063268-28063290 ATAGGCTGAAGGTAAAAGAATGG - Intronic
1125122055 15:36172861-36172883 ATATAAGAAAGGTAGAAGGCAGG - Intergenic
1125700852 15:41682210-41682232 AAATAATGTAGGTAGAAGGGGGG - Intronic
1125954530 15:43780599-43780621 AGATACAGAAGGCAGAAGGGTGG - Intronic
1125980193 15:43993938-43993960 ATAGATTGAAAGTAAAAGGACGG - Intronic
1126223263 15:46239974-46239996 ATAGAGTGAAGGAAGGAGGAAGG + Intergenic
1126282302 15:46968320-46968342 ATAAGCTGAAAGTAAAAGGATGG + Intergenic
1126997237 15:54458759-54458781 ATAAACTTAAGGTAAAGGGATGG - Intronic
1128291587 15:66482439-66482461 GTATGCTGCAGTTAGAAGGAGGG - Intronic
1128480990 15:68038044-68038066 ATAGACTGAAAGTAAAAAGATGG + Intergenic
1128845046 15:70885555-70885577 AAAGATTGAAAGTAGAAGGATGG + Intronic
1128905432 15:71463849-71463871 TGATCCTGATGGTAGAAGGATGG - Intronic
1129070810 15:72949184-72949206 ATAGACTGAAAGTAAATGGATGG + Intergenic
1129091374 15:73154710-73154732 ATAGACTGAAAGTAAAAGGGTGG - Intronic
1130365885 15:83238396-83238418 ATAGACTGAAAGTAAAGGGATGG + Intergenic
1130929102 15:88409124-88409146 ACAGATTGAAGGTAAAAGGATGG - Intergenic
1132180076 15:99745655-99745677 CTATACTGAAAAGAGAAGGAAGG + Intergenic
1132253912 15:100357390-100357412 ATAAACTTAAGGTAAAAGGGTGG + Intergenic
1202970929 15_KI270727v1_random:237882-237904 AGAGACAGAAAGTAGAAGGATGG + Intergenic
1133478616 16:6147817-6147839 ATAGACTGAAAGGAGAAAGAAGG - Intronic
1133491182 16:6270360-6270382 GTAGACTGAAAGTAAAAGGATGG + Intronic
1133972784 16:10579566-10579588 ATAGACAGAAAGTAGAATGATGG - Intronic
1134265356 16:12687934-12687956 AAAGAATGAAGGAAGAAGGAGGG + Intronic
1135419221 16:22293693-22293715 ATATGTTAAAGGTAGATGGATGG + Intergenic
1135656130 16:24251723-24251745 AGAAATTGGAGGTAGAAGGAGGG - Intergenic
1135945956 16:26865183-26865205 ATATGCTGAAAATAGAAGGTTGG + Intergenic
1136851480 16:33615861-33615883 ACATACTGAAGGTTGGAGTAGGG + Intergenic
1137291696 16:47055852-47055874 AGATACTGATGGCAGCAGGAAGG - Intergenic
1138638077 16:58359765-58359787 ATAGACTGAAAGTGAAAGGATGG - Intronic
1138933348 16:61688768-61688790 ATATGCTAAAGGCAGAAAGAGGG - Intronic
1140339287 16:74141228-74141250 ATAGACAGAAAGTAGAAGAATGG + Intergenic
1140465474 16:75178008-75178030 ATATACTGAAAGTGAAAGGATGG + Intergenic
1142302077 16:89264803-89264825 AAATACTGAAGCTAGAGAGAGGG - Intergenic
1203113083 16_KI270728v1_random:1464324-1464346 ACATACTGAAGGTTGGAGTAGGG + Intergenic
1143106326 17:4532271-4532293 ACAGACTGAAGGAAGAAGGAGGG - Intronic
1143427383 17:6850789-6850811 ATATCCTGAAGGCAGGAGCAAGG - Intergenic
1144382781 17:14719116-14719138 ATATAGTGAGGGAAGGAGGAAGG - Intergenic
1145980980 17:29011427-29011449 TTATGCTGAAGGAAGAAGAAAGG + Intronic
1150148282 17:62789255-62789277 GTATAGTGAAGGTAGGAAGAGGG - Intronic
1150753899 17:67893009-67893031 ATATACTTAAGGGAAAAAGAAGG - Intronic
1152187006 17:78863675-78863697 TCATACTGAAGGTCTAAGGAGGG - Intronic
1152899991 17:82935293-82935315 AGATACTGAAAGTAAAACGATGG - Intronic
1152913194 17:83017147-83017169 ATCTCGTGGAGGTAGAAGGATGG + Intronic
1153086119 18:1289724-1289746 ATAAGTTGAAGGTAAAAGGAAGG - Intergenic
1153425242 18:4955665-4955687 ATAAACTTAAGGTAAAGGGATGG + Intergenic
1153451161 18:5231031-5231053 ATAAACTTAAGATAAAAGGATGG - Intergenic
1153677831 18:7471114-7471136 ATACACTGAAGGCAAAAGGAGGG + Intergenic
1153828961 18:8902956-8902978 ATATACTTAAGGTAAAGGGGTGG + Intergenic
1154061700 18:11067520-11067542 AGAGACTGAAGGTGAAAGGATGG + Intronic
1154413840 18:14162189-14162211 ACAGACAGAAAGTAGAAGGATGG + Intergenic
1154962508 18:21324012-21324034 AGATTCTGAAGGGAGAAGGATGG + Intronic
1156094547 18:33513262-33513284 ATATACTGAAAATAAAAGGATGG + Intergenic
1156132529 18:33993933-33993955 ATATACTGAAAGTAAAAGAATGG + Intronic
1156156357 18:34307397-34307419 AGAGACAGAATGTAGAAGGATGG + Intergenic
1157025932 18:43843281-43843303 ATATACAGAAGATAGAAAAAGGG - Intergenic
1157995874 18:52555013-52555035 AAAGACTGAAGGTGGAAGGTGGG + Intronic
1158500360 18:57995477-57995499 ATATAGTGATGGTAGTGGGAAGG + Intergenic
1158503446 18:58024783-58024805 ATATCCTGAATGAAGAAGAAAGG + Intergenic
1158709091 18:59820964-59820986 ATATTTTGAAAGTAGGAGGATGG + Intergenic
1159091779 18:63857879-63857901 ATAGACTGAAAATAAAAGGATGG - Intergenic
1159520941 18:69522656-69522678 AAATCCAGAATGTAGAAGGATGG - Intronic
1160087302 18:75788510-75788532 ATACACGGTAGGTGGAAGGAAGG - Intergenic
1160316406 18:77851802-77851824 ACAGACGGAAGGCAGAAGGAAGG - Intergenic
1160471867 18:79142928-79142950 ATAAACTGAATGTAAAAGGAAGG + Intronic
1162000661 19:7742978-7743000 ATTTTGTGAAGGTCGAAGGATGG + Exonic
1162761901 19:12893465-12893487 ATATCCTGGTGGTAGTAGGAGGG - Exonic
1164013036 19:21224856-21224878 AGATACTGAAGGTGGCAAGATGG + Intronic
1164497420 19:28779647-28779669 ATAAACTGAAAGTAAAAGGATGG + Intergenic
1165384451 19:35502179-35502201 AAATCCTGCAGGGAGAAGGAGGG + Exonic
1165590074 19:36961382-36961404 ATAGACTGAAAGTAAAAGGATGG - Intronic
1168081168 19:54011723-54011745 AGAGACAGAAAGTAGAAGGATGG - Intronic
1168157667 19:54485307-54485329 AGATTCTGAAGGTAGAACAAGGG + Intergenic
925090837 2:1154779-1154801 ATGTGTTGGAGGTAGAAGGAAGG - Intronic
925790487 2:7480849-7480871 ATAGACTGAAAGTCGAGGGATGG + Intergenic
926850173 2:17187946-17187968 ATAAACTGAGGATGGAAGGATGG + Intergenic
927315759 2:21679784-21679806 ATAAATTGAAAGTAAAAGGATGG + Intergenic
927363296 2:22262963-22262985 ATAAACTTAAGGTAAAAGGGTGG - Intergenic
928389695 2:30899587-30899609 ACATAATGAAGGAAGAAAGAAGG - Intergenic
928399516 2:30967730-30967752 AGAGACTGAAGGCAGAAAGATGG - Intronic
928443032 2:31309396-31309418 ATAAACTTAAGATAAAAGGATGG - Intergenic
928685191 2:33742541-33742563 ATATACTTAAGGTAAAGGGGTGG - Intergenic
929098228 2:38284341-38284363 AGAAAGAGAAGGTAGAAGGAAGG + Intergenic
929336797 2:40758090-40758112 ATATAATGAAAGTCTAAGGAAGG - Intergenic
929446772 2:42008370-42008392 TTACACTGGAGGTTGAAGGATGG + Intergenic
929551986 2:42899984-42900006 AAATACTCAAGGGAGAAAGATGG - Intergenic
930160539 2:48151722-48151744 ATATATTTCAGGTAGAAGGAAGG - Intergenic
930191398 2:48463709-48463731 AGATACTGAAGATAGAAGCAGGG + Intronic
930423273 2:51179848-51179870 ATAAACTTAAGGTAAAAGGGTGG + Intergenic
930523679 2:52498907-52498929 ATATAAAGAAGGGAGTAGGAAGG + Intergenic
930565658 2:53016787-53016809 ATAGATTGAAAGTACAAGGAAGG + Intergenic
930846425 2:55909884-55909906 ATAGAGTCAAGGTAGAAGGAAGG - Intronic
931568773 2:63645863-63645885 ATAGACTGAATGTAAAGGGATGG - Intronic
931575785 2:63717084-63717106 ATATAGTGGAGACAGAAGGAGGG - Intronic
931864359 2:66393260-66393282 ATAGGCTCAAAGTAGAAGGATGG + Intergenic
931908260 2:66866611-66866633 TAATACTGAAGGTTGAATGAAGG - Intergenic
933086125 2:78056578-78056600 ATAAACTTAAGGTAAAAGGGTGG - Intergenic
933318712 2:80745672-80745694 ATATACTGAATGCAGAAAGTGGG + Intergenic
933473964 2:82765851-82765873 ATACACTGATGAGAGAAGGAGGG + Intergenic
933710712 2:85323811-85323833 CTATGCTGAAAGCAGAAGGAAGG + Intronic
934512832 2:94960980-94961002 ATATCCTGCAGAGAGAAGGAAGG - Intergenic
934756708 2:96829252-96829274 ATATAAAGAAGGGAAAAGGATGG - Intronic
935136646 2:100310017-100310039 ATATACTGTAGGTACAATTATGG - Intronic
935224222 2:101039028-101039050 AGATACAGGAAGTAGAAGGATGG + Intronic
935288577 2:101588987-101589009 ATAGACTGAAAGTGGAGGGATGG - Intergenic
935509067 2:103948797-103948819 ATATAGAGGAGATAGAAGGAAGG - Intergenic
936555106 2:113489642-113489664 ATAAACTTAAGGTAAAGGGATGG + Intronic
936775882 2:115972700-115972722 GTAGGCTGAATGTAGAAGGATGG - Intergenic
936899999 2:117472154-117472176 ATAAACTCAAGGTAAAGGGATGG - Intergenic
937124855 2:119467604-119467626 AATTCCTGAAGGTAGAAGGGAGG - Intronic
937663213 2:124454179-124454201 ATAAACTTAAGGTAAAGGGATGG + Intronic
938098591 2:128480315-128480337 ATAAACTGAAAGTAAAAGAATGG + Intergenic
938182868 2:129199378-129199400 ATGCAATGAAGATAGAAGGAAGG + Intergenic
938674743 2:133620400-133620422 ATACACTTAAGGTAAAGGGATGG + Intergenic
938822468 2:134973479-134973501 ATAGACTGAAAGTGAAAGGATGG - Intronic
939160153 2:138578394-138578416 GTAAACTGAAGGTAAAAGAATGG - Intergenic
939209771 2:139159020-139159042 ATATATTAAAGGTGTAAGGACGG + Intergenic
939312508 2:140501333-140501355 ATGTACTGAAGAGAGAATGAGGG + Intronic
939453602 2:142403426-142403448 ATAGACTGAAAGTAAAGGGATGG + Intergenic
940256199 2:151732513-151732535 ATATAATGAAGTTGGTAGGAAGG + Intronic
940425641 2:153528207-153528229 ATAAACTGAAAGTAAATGGATGG + Intergenic
940716585 2:157232139-157232161 AGATACTGAAAGTAGAATGGTGG - Intergenic
941060863 2:160845027-160845049 ATAAACTTAAGGTAAAGGGATGG + Intergenic
941164450 2:162070598-162070620 ATAGAGTGAAGGAAAAAGGAAGG - Intronic
941749864 2:169123206-169123228 ATAGACTGAAAGTAAAGGGATGG + Intergenic
942094241 2:172522798-172522820 ATATTCTAAGGGTTGAAGGATGG + Intergenic
942692208 2:178597873-178597895 AAATACTGATGGCATAAGGAAGG + Intronic
943315968 2:186387497-186387519 AGAGACTGAAAGTAGAATGATGG + Intergenic
943446976 2:187998332-187998354 ATAGACTCAAGGTAAAGGGATGG + Intergenic
943473745 2:188329093-188329115 AAATACTGATGATTGAAGGAGGG - Intronic
943866826 2:192935773-192935795 ATAAACTGAAAATAGAGGGATGG - Intergenic
943943702 2:194031104-194031126 ATAAACTTAAGGTAAAAGGGTGG + Intergenic
944592983 2:201235254-201235276 AAACACTGAAAGTATAAGGATGG - Intronic
945480462 2:210339089-210339111 ATAAACTGAAAGTAAAGGGATGG - Intergenic
945803138 2:214459272-214459294 ATACATTGAAAGTAAAAGGATGG - Intronic
947427913 2:230000507-230000529 ATTTACTGAAAGTAAATGGAAGG - Intronic
947526856 2:230882380-230882402 AAATACTGAGGGGAGAGGGATGG - Intergenic
947918395 2:233849304-233849326 AGAGACTGAAGACAGAAGGAAGG + Intronic
948475219 2:238213863-238213885 ATAGACTGAAAATAAAAGGATGG - Intergenic
948755878 2:240159353-240159375 ATATCCTGGAGGTAGAAGTGCGG - Intergenic
1169673270 20:8128268-8128290 ATATACTAAAGTTTGGAGGATGG - Intergenic
1169832874 20:9843513-9843535 AAAATCTGAAGGTAGAAAGAAGG + Intergenic
1170117214 20:12873221-12873243 ATTTGCTGATGGTAGCAGGAGGG - Intergenic
1170241520 20:14172198-14172220 ATAAACTTAAGGTAAAAGGGTGG - Intronic
1170663907 20:18368887-18368909 ATAAACTGAAGGTAAAGAGATGG - Intergenic
1170726721 20:18935319-18935341 ATAAACTTAAGGTAAAGGGATGG - Intergenic
1170741246 20:19058709-19058731 ATAAACTTAAGGTAAAAGGGTGG + Intergenic
1171016551 20:21547386-21547408 AAAAACAGAAGGTAGAATGATGG + Intergenic
1172383170 20:34513934-34513956 ATATACTGGAGCGAGGAGGATGG - Intergenic
1172851232 20:37967291-37967313 ATAAACTTAAGGTAAAGGGATGG - Intergenic
1175068232 20:56308803-56308825 ATATTTTGAAGGTAGAATCAAGG + Intergenic
1176859188 21:13996061-13996083 ACAGACAGAAAGTAGAAGGATGG - Intergenic
1177021400 21:15863725-15863747 ATATAGTGAAGGGATAAAGAAGG + Intronic
1177023984 21:15898646-15898668 ATATACTGAAAATAAAAGAATGG + Intergenic
1177415733 21:20791276-20791298 AAATACTCAAAGTAAAAGGAGGG - Intergenic
1177487879 21:21782858-21782880 ATATACTGAAAATAAAGGGATGG - Intergenic
1177697127 21:24587855-24587877 ATAAATTGAAAGTAGCAGGATGG - Intergenic
1178142673 21:29701663-29701685 ATAGACTGAAGGGAGGAGAAGGG + Intronic
1178598355 21:33974791-33974813 ATATAATGATGGAAGAAGGAAGG - Intergenic
1178971052 21:37177220-37177242 CTATTCTGAAGGCAGTAGGAAGG + Intronic
1179276088 21:39893003-39893025 AGACACGGAGGGTAGAAGGATGG + Intronic
1179360975 21:40708535-40708557 AGGTACTGAAGCTTGAAGGAGGG + Exonic
1180004784 21:45015358-45015380 GCATCCTGAAGGTAGCAGGAAGG + Intergenic
1182192687 22:28479259-28479281 ATACACAGCAGGTGGAAGGAGGG + Intronic
1182293831 22:29301518-29301540 AGATACTGAGGGGAGAAGCAGGG - Intergenic
1182320533 22:29476007-29476029 ATATAATAGAGGGAGAAGGAAGG + Intergenic
1183121977 22:35737091-35737113 AGGTACTGGAGGTAGAAGGCAGG + Intergenic
1184426029 22:44409823-44409845 ATGGACTCAAGGTAGAATGAGGG - Intergenic
949312105 3:2711506-2711528 CTTTTCTGAAGGAAGAAGGAGGG + Intronic
949521821 3:4863275-4863297 ATATATTAAAAGTAAAAGGACGG - Intronic
950824317 3:15800726-15800748 ATCTAGTGAAGGTAGAAGAATGG - Intronic
951259676 3:20492884-20492906 ATAAACTGAAAGTAAATGGATGG - Intergenic
951436732 3:22673848-22673870 ATAGACTGAAAATAAAAGGATGG - Intergenic
952083073 3:29783825-29783847 ATAAACTTAAGGTAAAGGGATGG + Intronic
952681386 3:36097512-36097534 ATACAGTGAAGGCAGGAGGAAGG - Intergenic
953104068 3:39858174-39858196 ATAGACTGAAAGTGAAAGGATGG + Intronic
953639344 3:44691226-44691248 ATAAACTTAAGGTAAAGGGATGG + Intergenic
953806206 3:46070630-46070652 ATATACTGAAAGTAAAGGGGTGG - Intergenic
955125981 3:56113201-56113223 ATTTACTGAATATAGAAAGATGG + Intronic
955342565 3:58136692-58136714 AGAAACTGAAGGAAAAAGGAGGG - Intronic
955662711 3:61318305-61318327 GTATACTGAAGGAAGAAACACGG + Intergenic
956362576 3:68464745-68464767 ATAAACTGAAGGTAGGAGGGTGG + Intronic
956400014 3:68868129-68868151 ATAGACTGAAAGTGAAAGGAAGG + Intronic
956987572 3:74720057-74720079 ATATGCTGAAAGTACATGGATGG - Intergenic
957418899 3:79942795-79942817 AAATACTGAAGGAGGTAGGAAGG - Intergenic
957971894 3:87392541-87392563 ATAAACTTAAGGTAAAGGGATGG + Intergenic
958639909 3:96792722-96792744 ATAGACTGAAAGTAGAGGAATGG - Intergenic
958787170 3:98610886-98610908 ATAAACTTAAGGTAAAGGGATGG - Intergenic
958790007 3:98641567-98641589 ATAAACTTAAGGTAAAGGGATGG - Intergenic
958827090 3:99043220-99043242 ATAGACTGAAAGTAAAGGGATGG + Intergenic
959464089 3:106664631-106664653 ATAGACTGAAGGTGAAGGGATGG + Intergenic
959532319 3:107447668-107447690 ATAACCAGAAGGTAGGAGGAAGG + Intergenic
959571968 3:107894520-107894542 ACATACTTCAGGTAGGAGGAAGG + Intergenic
959715538 3:109429331-109429353 ATAAACTTAAGGTAAAAGGGTGG - Intergenic
960511135 3:118550808-118550830 CAAGACTGAAGGTAGGAGGAAGG - Intergenic
960850672 3:122050123-122050145 ATAGGCTGAAAGTATAAGGATGG - Intergenic
961109963 3:124275629-124275651 AAATAGTGCAGGGAGAAGGAAGG - Intronic
961842459 3:129727210-129727232 ATATAGTGAAGCTATAAGGCAGG - Intronic
962235139 3:133700841-133700863 AGATGGTGAAGGAAGAAGGACGG - Intergenic
962862386 3:139416354-139416376 ATATACTGAAAATGAAAGGATGG - Intergenic
963171916 3:142260156-142260178 ATAGATTGAAAGTAAAAGGATGG + Intergenic
963701638 3:148633484-148633506 ATATACTGAAAATAAAGGGATGG + Intergenic
964252947 3:154741162-154741184 ATAAACTTAAGGTAAAAGGGTGG + Intergenic
964305226 3:155332497-155332519 ATATACTAAGGGCAGAGGGATGG + Intergenic
964519605 3:157550008-157550030 ATATACTGAAAGTGAAGGGATGG - Intronic
964521035 3:157567249-157567271 ATAGACTGAAAGTAAAAGGATGG - Intronic
964644040 3:158938753-158938775 ATAAACTTAAGGTAAAGGGATGG + Intergenic
964876292 3:161372086-161372108 ATAAACAGGAGGTAGAAGGTGGG + Exonic
965974372 3:174604424-174604446 ATAGACTGAAAATAGAGGGATGG - Intronic
966169052 3:177056907-177056929 ATATACTGAATTGAGGAGGAGGG - Intronic
966499562 3:180624275-180624297 ATATACTGAAAGTAAAGGGGTGG - Intronic
966553085 3:181227758-181227780 ATAAACTTAAGGTAAAAGGGTGG - Intergenic
966998155 3:185304976-185304998 ATAGACTGAAAGTGAAAGGATGG - Intronic
967508679 3:190284629-190284651 ACAGACTGAAGGTAAAGGGATGG - Intergenic
967541605 3:190674678-190674700 AGAAAGTGAAGCTAGAAGGAAGG + Intergenic
969927597 4:10599827-10599849 AGATACTGAAAGCAGAAGTAAGG - Intronic
970176930 4:13349026-13349048 AGATACAGAAGGCAGAAAGATGG + Intergenic
970185885 4:13453132-13453154 ATAGACTGAAAGTGAAAGGATGG - Intronic
970215627 4:13757012-13757034 ATAAACTGCAGGTAAAAGGGTGG - Intergenic
970664132 4:18318031-18318053 GTATACAGAAGGTAGAAAAAAGG + Intergenic
970747700 4:19319358-19319380 AGATACAGAAAGTAGAATGATGG + Intergenic
970905423 4:21210717-21210739 ATGGGCTGAAGGTGGAAGGAGGG - Intronic
971050216 4:22853667-22853689 ATAAACTTAAGGTAGAGGGGTGG - Intergenic
971061380 4:22975435-22975457 ATAGACTGAAAGTAAAAGAACGG - Intergenic
972097145 4:35362597-35362619 ATAAACTTAAGGTAAAAGGGTGG - Intergenic
972226289 4:37016730-37016752 AGAGACTGTATGTAGAAGGAAGG + Intergenic
972866715 4:43242112-43242134 TTCTACTAATGGTAGAAGGAAGG - Intergenic
973047962 4:45559033-45559055 ATATACTGAGAGTAGAAACAAGG - Intergenic
974119184 4:57618105-57618127 ATATCCTAAAGGTAAAAAGATGG - Intergenic
974353389 4:60779585-60779607 TTCTACTGAAGCTAGAAGGATGG - Intergenic
975325912 4:73058621-73058643 ACATACTGAAGGTAGAATGCTGG + Intronic
975391178 4:73819221-73819243 ATCAACTGAAGATAGAAGGAAGG + Intergenic
975587414 4:75964309-75964331 CTAAACTGAAGGTGGAAGGCTGG - Intronic
975623427 4:76317260-76317282 ATAAACTTAAGGTAAAGGGATGG + Intronic
975956200 4:79842234-79842256 ATATATTGAAAGTAAAAGGATGG - Intergenic
976607800 4:86998851-86998873 AGATACTGAAAGTAGAGGGATGG - Intronic
976931429 4:90570757-90570779 AAATACTGAAGGTATGAGCATGG + Intronic
976985971 4:91298453-91298475 AAATTTTGAAGGTAAAAGGAAGG - Intronic
977039119 4:91992820-91992842 ATAGATTGAAAGTAAAAGGAAGG + Intergenic
977199313 4:94097108-94097130 ATAGACTGAAAGTAAAGGGATGG - Intergenic
977203414 4:94143110-94143132 ATAGACTGAAGGTAATGGGATGG + Intergenic
977509830 4:97949279-97949301 ATAAACTCAAGGTAAAAGGGTGG - Intronic
977521932 4:98095448-98095470 AGAGACTGAAAGTAAAAGGATGG + Intronic
977910573 4:102530408-102530430 ATACAGTCATGGTAGAAGGAAGG - Intronic
978017602 4:103765703-103765725 ATATAGTGAAGATACAATGATGG + Intergenic
978235148 4:106448942-106448964 AGAAACTGAAGGTAAAAGAAAGG - Intergenic
978706366 4:111717470-111717492 AAATACTCAAGGTAGATGTAGGG + Intergenic
978925116 4:114233447-114233469 ATAAACTTAAGGTAAAGGGATGG + Intergenic
979914873 4:126418976-126418998 ATAGACTGAAGGTAAAGGGATGG - Intergenic
980085993 4:128390546-128390568 AAACACTGAAAGCAGAAGGAGGG - Intergenic
980972419 4:139579372-139579394 ATATAAGGAAAATAGAAGGAAGG - Intronic
980974865 4:139600838-139600860 AGAAACTGAAAGTAGAAGGGAGG - Intronic
981272779 4:142864069-142864091 AGAGACAGAAGGTAGAAGGGTGG - Intergenic
982149273 4:152434657-152434679 ATATACAGAAGGGAGAGGGAAGG + Intronic
982188021 4:152822189-152822211 ACAGACTCAAGGTAGAGGGATGG + Intronic
982696561 4:158608822-158608844 AAATACAGAAAGTAGAATGATGG - Intronic
982829945 4:160046451-160046473 ATAAACTTAAGGTAAAGGGATGG + Intergenic
984453373 4:179932562-179932584 AGAGAATGAAGGAAGAAGGAAGG + Intergenic
984474936 4:180224073-180224095 ATAAACTTAAGGTAAAGGGATGG - Intergenic
984530384 4:180909135-180909157 ATTTACTGAAGCTAGAAGCATGG - Intergenic
985332008 4:188848003-188848025 AGAAACAGAAGGTAGAATGATGG - Intergenic
985383211 4:189417611-189417633 ATATACTGAAGCCAGAATAAGGG + Intergenic
985690389 5:1306930-1306952 ATAGACTGAAAATAAAAGGAAGG - Intergenic
986078101 5:4358924-4358946 ATATAATGCATGTAGAAGGAAGG - Intergenic
986274801 5:6264362-6264384 AAATACTGAAAGTACAAAGAAGG + Intergenic
986507963 5:8472435-8472457 ATAAACTGTAGGCAGAAGTATGG + Intergenic
988026803 5:25704928-25704950 ATAGATTGAAAGTAAAAGGATGG - Intergenic
988319442 5:29673649-29673671 ATATACAGAAAATAAAAGGAGGG - Intergenic
988892526 5:35633490-35633512 ATTTATTGAAAGTAAAAGGATGG - Intronic
989004075 5:36790170-36790192 ATAGACAGAAAGTAGAATGATGG - Intergenic
989100900 5:37822140-37822162 TTATCCAGAAGGTGGAAGGAAGG + Intronic
989215220 5:38898457-38898479 ATAGACTGAAGATAAAGGGATGG - Intronic
989289583 5:39747752-39747774 AAATACTGATAATAGAAGGAGGG + Intergenic
990181480 5:53165199-53165221 CTATAGTGTAGGAAGAAGGAAGG - Intergenic
990430890 5:55734207-55734229 AAATACTGTAGGTTGAAGGCGGG - Intronic
990440192 5:55836760-55836782 TTAAATTGAAGGAAGAAGGAGGG + Intergenic
991024215 5:62012394-62012416 ACCTTCTGAAGGTACAAGGAAGG - Intergenic
991137844 5:63204234-63204256 ATAGAATGAAGTAAGAAGGAAGG - Intergenic
991140634 5:63237466-63237488 ATAGATTGAAAGTAAAAGGATGG - Intergenic
991205478 5:64044951-64044973 ATAGACTGAAAATAAAAGGATGG + Intergenic
992235443 5:74704223-74704245 ATATATTGAGGATAAAAGGAGGG - Intronic
992630913 5:78679358-78679380 ATATTCTCAAGAAAGAAGGAAGG + Intronic
992644116 5:78796487-78796509 ATATGATCAAGGCAGAAGGAGGG + Intronic
993130169 5:83886842-83886864 ACATAAAGAAGGGAGAAGGAAGG + Intergenic
993138839 5:84003952-84003974 ATAAACTCAAGGTAAAAGAATGG + Intronic
993539998 5:89137463-89137485 ATATACTGAAGTTAGAAAGTTGG + Intergenic
993734461 5:91459382-91459404 AGATACTGAGGATACAAGGAAGG - Intergenic
993816849 5:92559053-92559075 ATATACAGAAGGTGAAATGAGGG - Intergenic
994051114 5:95363862-95363884 ATAAACTTAAGGTAGAGGGGTGG - Intergenic
994253322 5:97563085-97563107 ATATGGAGAAGGAAGAAGGAAGG + Intergenic
994398898 5:99254696-99254718 ATAAACTTAAGGTAAAAGGGTGG - Intergenic
994633652 5:102317827-102317849 ATAGACTGAAAATAAAAGGATGG - Intergenic
994653933 5:102565326-102565348 AAAGACAGAAAGTAGAAGGATGG - Intergenic
995049885 5:107690570-107690592 ATAGACTGAAAATAAAAGGATGG + Intergenic
995370445 5:111412646-111412668 ATATAAGTAAGGTAGAAGGTGGG + Intronic
995694396 5:114863929-114863951 ATAAACTTAAGGTAAAGGGATGG - Intergenic
995777733 5:115743378-115743400 ATAGACTGAATATAAAAGGATGG - Intergenic
996353225 5:122568865-122568887 ATATACTCAAGATATAAAGAAGG + Intergenic
996459769 5:123727977-123727999 ATATACTGAAAGTAAAAGAATGG + Intergenic
996608816 5:125355655-125355677 ATAGACTTAAGGTAAAGGGATGG - Intergenic
997260467 5:132462051-132462073 AGAGACAGAAAGTAGAAGGATGG + Exonic
997511111 5:134455183-134455205 AGAGACAGAAAGTAGAAGGATGG + Intergenic
997748046 5:136317126-136317148 ATATAATTTAGGTAGAAGAAGGG + Intronic
998008405 5:138673244-138673266 ATAAACTCAAAGTAGAGGGAAGG - Intronic
998058482 5:139099742-139099764 GGATACAGCAGGTAGAAGGATGG + Intronic
998645996 5:144062741-144062763 ATATACTGAATGCAAAATGAGGG + Intergenic
999067263 5:148701873-148701895 ATATACTGGAGGAAGAAAGAGGG + Intergenic
999970319 5:156853929-156853951 ATAGACTGAAAGTAAAAGAATGG + Intergenic
1000108768 5:158086923-158086945 ATATATTGCAGAGAGAAGGAAGG - Intergenic
1000428875 5:161126500-161126522 AAATACTAAAGGGAGAAGGGTGG + Intergenic
1000807974 5:165820974-165820996 AGATACAGAAAGTAGAATGATGG - Intergenic
1001825769 5:174743589-174743611 ACAGACAGAAGGTAGAAGGATGG - Intergenic
1002550148 5:179982398-179982420 AAATACTGCAAGTAGAAAGATGG + Intronic
1003503391 6:6721002-6721024 AGAGACAGAAGGTAGAAGAATGG + Intergenic
1003739395 6:8918769-8918791 ATAAACTGAAGGCAGAATAAAGG + Intergenic
1004068152 6:12271039-12271061 ATAAACTGAAAGTGAAAGGATGG - Intergenic
1005764809 6:29000427-29000449 AAATACTTGGGGTAGAAGGAGGG + Intronic
1006062779 6:31437582-31437604 ATAAACTGAAGGTAAAGGGGTGG - Intergenic
1006477072 6:34262883-34262905 ATAAATTGAAAGTGGAAGGATGG + Intergenic
1006697499 6:35943654-35943676 ATATGCTGAAGGTGAAATGAGGG + Exonic
1006965429 6:37979080-37979102 TTAAACTCAAAGTAGAAGGAAGG - Intronic
1007377455 6:41466597-41466619 ATAGAAGGAAGGCAGAAGGAAGG + Intergenic
1007815356 6:44520507-44520529 ATAGACTGAAAGTAAAGGGATGG - Intergenic
1008116785 6:47560054-47560076 CTGTACTGGAGTTAGAAGGATGG - Intronic
1008351945 6:50501713-50501735 ATAGACTGAAAGTAAAGGGATGG + Intergenic
1008464702 6:51817469-51817491 ATATACTGAGGGGAGAGGGAAGG + Intronic
1008635070 6:53402652-53402674 TTCTACCAAAGGTAGAAGGAGGG - Intergenic
1008775216 6:55030229-55030251 ATAAACTTAAGGTAAAGGGATGG - Intergenic
1008882720 6:56397097-56397119 ATAAACTCAAGGTAAAGGGATGG + Intergenic
1009365258 6:62852918-62852940 ATATCCAGAAGGGAAAAGGATGG + Intergenic
1009840058 6:69059317-69059339 ATAGACTGAAAGTAAAAGTATGG - Intronic
1009847115 6:69147993-69148015 ATAGACTGAAAGTAAAGGGATGG - Intronic
1009946235 6:70345043-70345065 ATATGCTGAAAATAAAAGGATGG - Intergenic
1010728751 6:79365479-79365501 TTCTACCAAAGGTAGAAGGAGGG - Intergenic
1010801688 6:80184303-80184325 ATAAACTTAAGGTAAAGGGATGG - Intronic
1010839047 6:80625646-80625668 ATAGACTGAAAATAAAAGGATGG + Intergenic
1010862862 6:80935620-80935642 ATAAACTTAAGGTAAAAGGTTGG - Intergenic
1011328879 6:86182038-86182060 ATAAACTTAAAGTAGAGGGATGG - Intergenic
1011486704 6:87849910-87849932 ATCTACAGAAGGTAGCAGCAAGG - Intergenic
1011587109 6:88938391-88938413 ATAGACTGAAAGTAAAGGGATGG - Intronic
1011696176 6:89915406-89915428 ATAGACTGAAAGTAGAGGGATGG - Intergenic
1011763771 6:90596132-90596154 ATATTGTCAAGGTAGGAGGATGG + Intergenic
1011833913 6:91406323-91406345 ATAAACTTAAGGTAAAGGGATGG + Intergenic
1012266813 6:97155036-97155058 ATAGATTGAAAGTAAAAGGATGG - Intronic
1013046046 6:106486780-106486802 ATATACTGAAAATAAAAGGATGG - Intergenic
1013925336 6:115465364-115465386 ATAGACTGAAAATAAAAGGATGG - Intergenic
1013946245 6:115726431-115726453 ATAAACTTAAGGTAAAGGGATGG - Intergenic
1013972396 6:116037369-116037391 ATATAAAGAAAGTAGAATGAGGG + Intronic
1014199352 6:118591112-118591134 ATATACTGAAGGTAAAACTGAGG + Intronic
1014391193 6:120867290-120867312 ATCTAATGATGGAAGAAGGAAGG - Intergenic
1014583293 6:123164476-123164498 ATAGACTGAAAATAAAAGGATGG + Intergenic
1014934532 6:127372233-127372255 ATAGATTGAAAGTAAAAGGATGG - Intergenic
1016084246 6:139893554-139893576 ATGTTCTGAAGGGAGAAAGATGG + Intergenic
1016538134 6:145132435-145132457 ATAGACTGAAAATAAAAGGATGG - Intergenic
1016909932 6:149188645-149188667 ATAAACTTAAGGTAAAAGGGTGG - Intergenic
1017803239 6:157918461-157918483 ATATACTGAAAGTAAACGGATGG - Intronic
1017933930 6:158987324-158987346 ATAGACTGAAAGTAAAGGGATGG - Intronic
1018052045 6:160018140-160018162 ATACACTGAAGCTAAAGGGATGG + Intronic
1018095587 6:160384725-160384747 AAATTCTGAGGGTGGAAGGAAGG - Intronic
1018133289 6:160752815-160752837 ATATATGGATAGTAGAAGGATGG + Intronic
1018195197 6:161349656-161349678 GTTTACTGAAGGTAAAAGGCAGG + Exonic
1018367279 6:163134068-163134090 GTAAACTGAAGGTAGAATGTTGG - Intronic
1018636717 6:165867302-165867324 ATAGACTGAAAGTGGAGGGATGG + Intronic
1019076538 6:169393000-169393022 ATATAAGGATGGAAGAAGGAAGG - Intergenic
1019940998 7:4291014-4291036 ATAAAGTGAAGGAAGAAAGAAGG - Intergenic
1020458772 7:8404497-8404519 ATAGACAGAAAGTAGAAGGGTGG + Intergenic
1020574607 7:9910601-9910623 ATATACTGAAAATAAAGGGATGG - Intergenic
1020904579 7:14049232-14049254 GTATACTGAAGAAAAAAGGAGGG - Intergenic
1021304637 7:19016873-19016895 ATATACTCCAAGTAGAATGAAGG + Intergenic
1022122714 7:27324984-27325006 AGATACTGAAAGTAAAAGGATGG - Intergenic
1022661867 7:32375261-32375283 ATATACTGAACTCAGCAGGAAGG + Intergenic
1023696229 7:42850313-42850335 TTATCCTGTGGGTAGAAGGAAGG - Intergenic
1023909656 7:44544410-44544432 ATAGACAGTAGGTAGAACGATGG + Intergenic
1024282100 7:47727104-47727126 AGACTCTGAAGGTAGAAAGAAGG - Intronic
1024522775 7:50321147-50321169 GAAGACTGATGGTAGAAGGAAGG + Intronic
1024665424 7:51542232-51542254 ATAAACTGAAGGTAAAAGCATGG - Intergenic
1024893504 7:54229477-54229499 ATAAACTCAAGGTAAAAGGGTGG + Intergenic
1024900414 7:54312910-54312932 ATAAACTCAAGGTAAAAGGGTGG - Intergenic
1025140955 7:56463925-56463947 ATAGACTGAAAGTGGCAGGATGG - Intergenic
1025163575 7:56689329-56689351 ATAGACTGAAAGTGGCAGGATGG + Intergenic
1026098663 7:67367013-67367035 AGATGCAGAAGGTAGAAGGATGG + Intergenic
1026948075 7:74328678-74328700 CTGTACTCAAGGCAGAAGGATGG + Intronic
1027637741 7:80696292-80696314 ATAGCCTGAAAGTAAAAGGATGG + Intergenic
1028206946 7:88028865-88028887 ATAGACTGAAAATAAAAGGATGG - Intronic
1028686601 7:93596669-93596691 ATATACTGAAGATATAAAAATGG + Intronic
1030312824 7:108085170-108085192 ATATGCTGAAGGTAGAGTGTTGG + Intronic
1031247896 7:119340490-119340512 GTATAAGGAAGGTGGAAGGAAGG - Intergenic
1031492901 7:122411115-122411137 ATCTGCTGATGGTAGATGGATGG - Intronic
1031611760 7:123836441-123836463 ATAAACTTAAGGTAGAGGGGTGG - Intronic
1032901813 7:136318674-136318696 ATAGACTGAAAGTAAAGGGATGG - Intergenic
1032916010 7:136491024-136491046 ATATTCAGAAGGTAACAGGATGG - Intergenic
1032948388 7:136878381-136878403 AGGTACTGAAGGCAGGAGGAAGG + Intronic
1033415722 7:141159773-141159795 AGAGACAGAAGGTAGAAGGGTGG + Intronic
1033623089 7:143079853-143079875 ATAAACTTAAGGTAAAAGGATGG + Intergenic
1033801367 7:144906090-144906112 ATAGACAGAAGGTAGAATGGTGG - Intergenic
1033836051 7:145313530-145313552 ATTTACAGAAGGTAGAAAAAGGG - Intergenic
1033935740 7:146583443-146583465 AGAATCTGAAGGGAGAAGGAAGG + Intronic
1034652724 7:152704639-152704661 GTTTACTGAAACTAGAAGGAAGG - Intergenic
1034705304 7:153137707-153137729 ATAAACTTAAGGTAAAGGGATGG - Intergenic
1035490149 7:159268956-159268978 ATAGACTGAAAGTGCAAGGATGG - Intergenic
1036159393 8:6372418-6372440 CAGTACTGAAGGTAGAGGGAAGG + Intergenic
1036291191 8:7492240-7492262 AGAGACTGAAAGTAAAAGGATGG + Intergenic
1036330299 8:7819296-7819318 AGAGACTGAAAGTAAAAGGATGG - Intergenic
1036666786 8:10750227-10750249 AGAGACTGAATGTAAAAGGATGG - Intronic
1037131196 8:15409709-15409731 ATATACAGAAAATAGAAGTAAGG + Intergenic
1037310815 8:17553998-17554020 AGATAATCAAGGTAGAAGAAGGG - Intronic
1037623564 8:20588468-20588490 AGAGACAGAAGGTAGAAAGATGG - Intergenic
1037648765 8:20817690-20817712 ATATAGTGAAAGCAGAAGCAAGG + Intergenic
1038225369 8:25652082-25652104 ATAGACTGAAAGAAAAAGGATGG - Intergenic
1038911443 8:31969155-31969177 ATAAACTGAAAGTAGACAGATGG - Intronic
1039030296 8:33301465-33301487 ATAAACTTAAGGTAAAAGGGTGG + Intergenic
1039139167 8:34365299-34365321 ATAGATTGAAAGTAAAAGGATGG - Intergenic
1039312994 8:36339765-36339787 ATAAGTTGAAGGTAAAAGGATGG + Intergenic
1039763679 8:40606034-40606056 ATAAACTGAAGGTAAAGGGGTGG - Intronic
1040715868 8:50251505-50251527 ACAGACTGAAAGTAAAAGGATGG + Intronic
1041060496 8:54030287-54030309 ATATATTGAATGTAAAAGGATGG - Intergenic
1041429301 8:57760842-57760864 ATATGCTCAAAGTAAAAGGATGG + Intergenic
1042032005 8:64486543-64486565 AATTACTGAAGGTAGAGGGGAGG + Intergenic
1042321780 8:67483202-67483224 TTCTACTGAAGAAAGAAGGAGGG - Intronic
1042637253 8:70892115-70892137 ATAGACTGAAAGTAAAGGGATGG - Intergenic
1042662307 8:71168355-71168377 ATATACAGACTGAAGAAGGATGG - Intergenic
1042832320 8:73044730-73044752 ATAAACAGAAAGTAGAATGATGG - Intronic
1043305523 8:78789077-78789099 ATAGATTGAAAGTAAAAGGATGG - Intronic
1043340552 8:79232438-79232460 ATAGGCTGAAGGTAAAGGGATGG + Intergenic
1043551959 8:81384525-81384547 ATAGACTGAAAGTAAACGGATGG - Intergenic
1043988038 8:86716998-86717020 ATAAACTTAAGGTAAAGGGATGG + Intronic
1044228555 8:89747675-89747697 ATAGACTGAAAGTAAAGGGATGG + Intergenic
1044387775 8:91610258-91610280 CTCTGCTGAAAGTAGAAGGATGG + Intergenic
1044980283 8:97709220-97709242 TAATACTAATGGTAGAAGGAGGG + Intronic
1045262412 8:100588357-100588379 AAATACTGAAGGTAGATGATTGG - Intronic
1046065369 8:109190222-109190244 AAATAATCAAGGTAGAATGAAGG - Intergenic
1046622946 8:116547142-116547164 ATATTCTGAAGCTAGAGGTAAGG + Intergenic
1047148401 8:122232212-122232234 GTTTACTGAAACTAGAAGGAAGG - Intergenic
1047383997 8:124392402-124392424 ATAAACTCAAGGTAAAGGGATGG - Intergenic
1047592205 8:126338483-126338505 ATAAACTTAAGGTAAAGGGATGG + Intergenic
1047890250 8:129301080-129301102 ATAAACTTAAGGTAGAGGGGTGG - Intergenic
1048180883 8:132193263-132193285 GAATACTGAAGGTGGAAGCATGG - Intronic
1048748085 8:137637807-137637829 TTCCACTGTAGGTAGAAGGAGGG + Intergenic
1048748978 8:137649577-137649599 ATATAATGATGGAAGAAAGAAGG + Intergenic
1048983957 8:139720489-139720511 AAATTCTAAAGGTGGAAGGAAGG + Intergenic
1048997967 8:139805799-139805821 ATACACAGAACGAAGAAGGAGGG + Intronic
1049897898 9:127540-127562 ATAAACTTAAGGTAAAGGGATGG - Intronic
1051461051 9:17316295-17316317 ATATATTGAATGTAAAAGTATGG - Intronic
1051734146 9:20181003-20181025 ATGTGCTGAAGGTGGCAGGAGGG - Intergenic
1051840177 9:21387602-21387624 ATAGACTGAAGGTAAAGGGATGG - Intergenic
1052307430 9:27026115-27026137 ATAAACTTAAGGTAAAAGGGTGG + Intronic
1052550070 9:29937067-29937089 ATAAACTTAAGGTAAAAGGGTGG - Intergenic
1052716091 9:32119305-32119327 GAATTCTGAAGGTAGAAGAAAGG - Intergenic
1052862708 9:33446843-33446865 AGATTCTGACGGTAGAAGGGTGG - Intronic
1053346178 9:37380036-37380058 GTTTACTGAATGAAGAAGGAAGG + Intergenic
1053619907 9:39804238-39804260 ATAGACAGAAGGTAGAATGGTGG - Intergenic
1053740978 9:41137833-41137855 ATAAACTTAAGGTAAAGGGATGG - Intronic
1053894574 9:42730814-42730836 ATAGACAGAAGGTAGAATGGTGG + Intergenic
1054264250 9:62903206-62903228 ATAGACAGAAGGTAGAATGGTGG + Intergenic
1054443966 9:65293976-65293998 ATAAACTTAAGGTAAAGGGATGG - Intergenic
1054486307 9:65727530-65727552 ATAAACTTAAGGTAAAGGGATGG + Intronic
1054687371 9:68293464-68293486 ATAAACTTAAGGTAAAGGGATGG + Intronic
1055304312 9:74913039-74913061 ATAGACTGAAAGTGGAGGGATGG + Intergenic
1055683994 9:78750708-78750730 ATAGACTGAAAGTGAAAGGAAGG - Intergenic
1057014273 9:91637125-91637147 ATATACTGAAGGTAGAAGGATGG - Intronic
1057643080 9:96846472-96846494 ATAAACTCAAGGTAAAGGGAAGG + Intronic
1058196671 9:101985345-101985367 ACATAAAGAAGGTAGAAGGATGG + Intergenic
1058218185 9:102261054-102261076 ATTTATGGAAAGTAGAAGGAAGG - Intergenic
1058272359 9:102988153-102988175 ATATACTGAAAGTGAAAGAATGG + Intergenic
1058605724 9:106720507-106720529 AAATATTTAAGGTAGAAGGTAGG - Intergenic
1058784368 9:108372602-108372624 ATAAACTTAAGGTAAAGGGATGG - Intergenic
1059016319 9:110519887-110519909 ATATACAGAAGTTACAAGTAAGG + Intronic
1059728009 9:117028206-117028228 ATAAACAGAAGGTTCAAGGATGG + Intronic
1059938562 9:119335835-119335857 ACCTCCTGAAGGTAGAAGGCTGG - Intronic
1060431075 9:123551894-123551916 AGATCCAGAAGGAAGAAGGAAGG - Intronic
1062306991 9:135913203-135913225 ATACAATGAAGGTAGAGGGAAGG + Intergenic
1062558254 9:137127010-137127032 ATAGATTGAAAGTAAAAGGATGG - Intergenic
1186030901 X:5367994-5368016 ATAGACAGAAGGTAGAATGGGGG + Intergenic
1186206732 X:7208653-7208675 ATATAAGGAAGGAGGAAGGAAGG - Intergenic
1186308618 X:8292090-8292112 ATAAACTTAAGGTAAAAGGATGG + Intergenic
1186456227 X:9712166-9712188 AGATACTGAGGTTAGAAGGTGGG + Intronic
1186884545 X:13900063-13900085 ATAGAGTGAAGTTAGATGGAAGG + Intronic
1186985139 X:15004379-15004401 ACATACCTAATGTAGAAGGATGG + Intergenic
1187838626 X:23461388-23461410 ATAGACTGAAAGTAAAGGGATGG - Intergenic
1188059867 X:25588227-25588249 ATAAACTGAAAGTAAAGGGATGG - Intergenic
1188096223 X:26026505-26026527 ATAGAGAGAAGATAGAAGGAGGG - Intergenic
1188176712 X:26999866-26999888 AGATACTGAGGGGAGAATGAAGG - Intergenic
1188629626 X:32337926-32337948 ATAAAATGAAACTAGAAGGAAGG - Intronic
1188712533 X:33418176-33418198 ATAGACTGAAGGTAAAGGGGTGG + Intergenic
1189393175 X:40594973-40594995 ATACACATAAAGTAGAAGGAAGG + Intronic
1189452103 X:41145556-41145578 ATAAACAGAAGGTTGAAGAAAGG + Intronic
1189484783 X:41421841-41421863 GTATACTGGAGGGAGAATGATGG - Intergenic
1189564416 X:42226281-42226303 ATAGACTGAAAGTAAAGGGATGG - Intergenic
1190476291 X:50831109-50831131 ATATACTCAAAATAGCAGGAAGG - Intergenic
1190567344 X:51743917-51743939 ATACCCTCAAGGTAAAAGGATGG + Exonic
1190854066 X:54275822-54275844 ATAGGCTGAAAGTAAAAGGATGG + Intronic
1190868122 X:54401638-54401660 ATATATAGAGAGTAGAAGGATGG - Intergenic
1190925195 X:54897148-54897170 ATAGACTGAAAGTAAAGGGATGG + Intergenic
1191045515 X:56131764-56131786 ATAAACTTAAGGTAAAAGGGTGG + Intergenic
1191100470 X:56721210-56721232 ATAAACTTAAGGTAAAGGGATGG + Intergenic
1191772788 X:64780879-64780901 ATAAACTGAGAGTAGAGGGATGG - Intergenic
1191917425 X:66217815-66217837 ATAAACTTAAGGTAAAAGGGGGG + Intronic
1191972352 X:66831021-66831043 ATAGGCTGAAAGTAAAAGGATGG - Intergenic
1192009138 X:67249689-67249711 ATAAACTTAAGGTAAAAGGGTGG + Intergenic
1192540273 X:71963574-71963596 ATAGATTGAAAGTAAAAGGATGG + Intergenic
1192878331 X:75255640-75255662 ATAAAATGAAGGTAAAGGGATGG + Intergenic
1192904154 X:75532288-75532310 ATAGACTCAAGGTAAAAGGGTGG - Intergenic
1193062935 X:77225309-77225331 ATATACTTAAGGTAAAGGGGTGG + Intergenic
1193205529 X:78743019-78743041 ATGCATTGAAAGTAGAAGGATGG - Intergenic
1193339570 X:80332251-80332273 ATATTCTGAAAGTAGAGAGATGG - Intergenic
1193471148 X:81906199-81906221 ACAGACTGAAGGTAAAGGGATGG - Intergenic
1193664825 X:84302760-84302782 ATAGACTGAAAGTAAAGGGACGG + Intergenic
1193721780 X:84995421-84995443 ATAGACTGAAGGTAAAAGGGTGG + Intergenic
1193775764 X:85640124-85640146 ATAAACTTAAGGTAAAGGGATGG - Intergenic
1193793404 X:85843875-85843897 ATACACTGAAAGTAAAGGGATGG + Intergenic
1193800064 X:85924338-85924360 ATAGACTGGAGGCAGAAGGGAGG + Intronic
1193820881 X:86163222-86163244 AAACACAGAAAGTAGAAGGATGG - Intronic
1193913174 X:87329931-87329953 ATATTCTCAAAGTAAAAGGATGG + Intergenic
1193986597 X:88250090-88250112 ATATACTGAAAATAAATGGATGG - Intergenic
1194102558 X:89723888-89723910 ATACACTGAAGGTAGTTGCAAGG - Intergenic
1194106942 X:89781124-89781146 ATAGACTGAAAGTAAAGGGATGG + Intergenic
1194630467 X:96276427-96276449 ATAAACTTAAGGTAAAAGGGTGG + Intergenic
1194787386 X:98103753-98103775 ATAAACTGAAAATAAAAGGATGG - Intergenic
1194950556 X:100120961-100120983 ATATACTGAAGAATGAAGCATGG + Intergenic
1195500450 X:105592291-105592313 ATAGACTCAAAGTAAAAGGATGG - Intronic
1195601492 X:106753733-106753755 ATAGACTGAATATAAAAGGATGG + Intronic
1195776034 X:108406925-108406947 ATATAATGATTGTGGAAGGAAGG + Intronic
1195786501 X:108529685-108529707 ATAGACTGAAAGTAAAGGGATGG + Intronic
1195855430 X:109326870-109326892 ATAAACTTAAGGTTAAAGGATGG + Intergenic
1196519198 X:116653134-116653156 ATAAACTTAAGGTAGAAGAGTGG - Intergenic
1196550658 X:117020028-117020050 ACAGACTCAAGGTAAAAGGATGG + Intergenic
1197110324 X:122765406-122765428 ATAAACTGAAGGTAACAGGATGG + Intergenic
1197353769 X:125408991-125409013 ATAGTTTGAAGGTAAAAGGATGG - Intergenic
1197363771 X:125538291-125538313 ATAAACTAAAGGTAAAGGGATGG + Intergenic
1197471994 X:126875553-126875575 ATAAACTTAAGGTAAAGGGATGG - Intergenic
1197574265 X:128189852-128189874 ATAAACTTAAGGTAAAGGGATGG + Intergenic
1197637250 X:128928896-128928918 ATAGACATAAGGCAGAAGGAGGG - Intergenic
1197932280 X:131708379-131708401 ATAAACTGTAGGAAGAAGAAGGG - Intergenic
1199317546 X:146398651-146398673 ATAGACTGAAAGTAGAGAGACGG - Intergenic
1199928967 X:152498701-152498723 ATATTCTCATGGTAGAAGAAAGG - Intergenic
1200455144 Y:3381165-3381187 ATACACTGAAGGTAGTTGGAAGG - Intergenic
1200458905 Y:3428983-3429005 ATAGACTGAAAGTAAAGGGATGG + Intergenic