ID: 1057014274

View in Genome Browser
Species Human (GRCh38)
Location 9:91637129-91637151
Sequence CCTCATATACTGAAGGTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 153}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057014274_1057014281 24 Left 1057014274 9:91637129-91637151 CCTTCTACCTTCAGTATATGAGG 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1057014281 9:91637176-91637198 ATTTATGCTCTATCAATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057014274 Original CRISPR CCTCATATACTGAAGGTAGA AGG (reversed) Intronic
900106220 1:982238-982260 CCTCATGTACTGTAGCTGGAGGG - Intergenic
901126167 1:6930310-6930332 CGTCATATGCTGAAGGATGAAGG + Intronic
906862489 1:49376506-49376528 CCCCAAATACTGAAGGGATAAGG - Intronic
913378563 1:118184366-118184388 CCTCATTTACTGAAGCTGGGTGG + Intronic
915021549 1:152784735-152784757 CTTCATCTACTGAAAGTAGAGGG + Intronic
915922903 1:159990510-159990532 CCTCATATGGGGAAGGGAGAGGG - Intergenic
916738597 1:167629602-167629624 ACTCGTATACAGAAGATAGATGG + Intergenic
919376496 1:196800902-196800924 CCTCAAATACTGGGGATAGAAGG - Intergenic
919582963 1:199400350-199400372 ACTCATTCTCTGAAGGTAGATGG - Intergenic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
922273611 1:224056659-224056681 ACTCATATACAGATGGTGGAAGG - Intergenic
924949477 1:248868894-248868916 ACACATATACTGAAAGTAAAGGG + Intergenic
1063409696 10:5827885-5827907 CCTGAAAGACAGAAGGTAGACGG + Intronic
1066056521 10:31686074-31686096 CTTGATCCACTGAAGGTAGAGGG + Intergenic
1067780461 10:49199778-49199800 CCTCATATACTGCTGGTAGGAGG + Intergenic
1073353305 10:102835006-102835028 CCTGACAAACTGAAGGGAGAGGG + Exonic
1078742111 11:14076580-14076602 CATCATATACTCATGGTGGAAGG + Intronic
1081495512 11:43606094-43606116 CCTAAAATATTCAAGGTAGAAGG + Intronic
1082216631 11:49578367-49578389 CCTGATCTTCTGAAGCTAGAAGG - Intergenic
1085754744 11:79193110-79193132 CCTCAAATACTGAAAGAAAATGG - Intronic
1087371033 11:97284119-97284141 CCTCAGAAACTGGATGTAGAAGG + Intergenic
1087866013 11:103228049-103228071 TCTCATAAACTTAAGGTAAAGGG - Intronic
1088393262 11:109339483-109339505 CCTCACATAATGAAGAAAGATGG - Intergenic
1089416425 11:118296010-118296032 CCTCATCTCCTGCAGCTAGAGGG + Intergenic
1090331567 11:125936391-125936413 CCACAGAGACAGAAGGTAGAAGG - Intergenic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091293521 11:134456133-134456155 CCTCCTAAAATGCAGGTAGATGG - Intergenic
1093369884 12:18354228-18354250 CCTCAAGTCCTGTAGGTAGAAGG + Intronic
1094526084 12:31232152-31232174 CCCCATACACTGAAGGCAGCAGG + Intergenic
1096956642 12:55532913-55532935 TCACATAAACTGAAGGTAAAGGG + Intergenic
1098500797 12:71189332-71189354 TCACATAAACTGAAGGTAAAGGG + Intronic
1098786261 12:74760243-74760265 TCACATAAACTTAAGGTAGAGGG - Intergenic
1099256963 12:80326098-80326120 CCTCAAGTACTGCAGGTATAAGG - Intronic
1104524472 12:129505888-129505910 TCACATAAACTTAAGGTAGAGGG - Intronic
1106392051 13:29344514-29344536 TCACATAAACTTAAGGTAGAGGG - Intronic
1106732662 13:32557546-32557568 TCTCATATATTGCTGGTAGAAGG - Intergenic
1109824414 13:67698738-67698760 TCTCATAAACTTAAGGTAAAGGG + Intergenic
1110720482 13:78755614-78755636 CCACATATACTGAAAGTAGTAGG - Intergenic
1111291516 13:86177206-86177228 TCACAGATACTGAAGGAAGACGG - Intergenic
1115713219 14:36073182-36073204 ACTCCTATGCAGAAGGTAGAAGG - Intergenic
1117897423 14:60502175-60502197 ACTCAATTTCTGAAGGTAGATGG - Intronic
1118453001 14:65920973-65920995 CCGCATAGACACAAGGTAGATGG + Intergenic
1118668776 14:68100178-68100200 CCTCAACTATAGAAGGTAGAAGG + Intronic
1119119495 14:72061058-72061080 CCTCCTCCTCTGAAGGTAGATGG + Intronic
1124101406 15:26697554-26697576 CCTCAGATAATGCAGGAAGAGGG + Intronic
1131828512 15:96339461-96339483 TCTCACAGACTGAAGGTAAAGGG - Exonic
1134572825 16:15306254-15306276 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1134937875 16:18262124-18262146 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1139336441 16:66235032-66235054 CCTCACATGGTGAAGGGAGAAGG - Intergenic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1142786872 17:2231364-2231386 CCTGAATTACAGAAGGTAGAGGG - Intronic
1143100992 17:4504652-4504674 CCTGAAATCTTGAAGGTAGAAGG + Intronic
1143225072 17:5294604-5294626 CCTCAGATACTGAGGGAAAACGG + Intronic
1146828458 17:36045655-36045677 TTTCAGCTACTGAAGGTAGAGGG - Intergenic
1148572263 17:48679479-48679501 CATCTTATAATGAAGGTAGGAGG - Intergenic
1150730150 17:67685782-67685804 TTTCACATACTGAAGGTGGATGG + Intronic
1153828959 18:8902952-8902974 ACACATATACTTAAGGTAAAGGG + Intergenic
1158124510 18:54086654-54086676 CCTAATATACTCATGGTGGAAGG + Intergenic
1159426916 18:68301127-68301149 CATGATATACTGAACCTAGAGGG - Intergenic
1159730867 18:72025852-72025874 ACTTATATATTGAAGGTAAAAGG - Intergenic
1164594376 19:29524390-29524412 CCTCAGCTTCTGAAGGGAGAGGG - Intergenic
1166264590 19:41671137-41671159 CATCAAATCCTGAAAGTAGAGGG + Intronic
925795499 2:7537845-7537867 CCACATAAACTTAAGGTAAAGGG - Intergenic
928685193 2:33742545-33742567 TCACATATACTTAAGGTAAAGGG - Intergenic
935007311 2:99091578-99091600 CCACATAAACTTAAGGTAAAGGG + Intronic
935929854 2:108112838-108112860 CCTCAAAGATTGAAGGTAGATGG - Intergenic
940387719 2:153093021-153093043 CCTCAAAAACTGAGGATAGAAGG - Intergenic
940734318 2:157431966-157431988 CCCCATATCTTAAAGGTAGAAGG + Intronic
1169851184 20:10053231-10053253 CCTCCTATACTGAAGACTGAAGG + Exonic
1170117216 20:12873225-12873247 CCTCATTTGCTGATGGTAGCAGG - Intergenic
1171378455 20:24713018-24713040 TCTCATAAACTTAAGGTAAAGGG - Intergenic
1172025272 20:31944124-31944146 CCTCATGCTCTGAAGGCAGAAGG - Exonic
1175356265 20:58371121-58371143 CCTCAGATACTGCTGTTAGAGGG + Intergenic
1176424879 21:6542230-6542252 CCTCCTTTACTCAAGGTGGACGG - Intergenic
1179279900 21:39925298-39925320 CCTCACAGACTGAAGTTAAATGG + Intronic
1179700368 21:43150539-43150561 CCTCCTTTACTCAAGGTGGACGG - Intergenic
949169125 3:977645-977667 CCTCCAATACTGAATGTAAAAGG - Intergenic
949303273 3:2609305-2609327 CCTCACATGGTGAAGGCAGAAGG - Intronic
950489356 3:13294140-13294162 GCTCATATACAGAAGGTGGAGGG + Intergenic
951404816 3:22282960-22282982 ACTCATAAACTTAAGGTAAAGGG + Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
956611486 3:71128010-71128032 CCTTATATAGTCAAGGAAGAGGG + Intronic
958949529 3:100401309-100401331 CCTTCTTTCCTGAAGGTAGAGGG - Exonic
959466662 3:106695825-106695847 CCTCATAATCTGAAGCTACAAGG + Intergenic
960882364 3:122357956-122357978 CCTCAACTAATGAAGGAAGATGG - Intergenic
962615257 3:137120144-137120166 ACTAATAGACTGAAGGTAAAGGG - Intergenic
964305225 3:155332493-155332515 CATCATATACTAAGGGCAGAGGG + Intergenic
964635437 3:158853200-158853222 CCTCATATACTGCAGGCAGCCGG - Intergenic
965311905 3:167138977-167138999 ACTCATATGCCCAAGGTAGAAGG + Intergenic
965345346 3:167541825-167541847 ACTCATAAACTTAAGGTAAAGGG + Intronic
965526674 3:169727321-169727343 CCTCAAAAACTGAGGATAGAAGG - Intergenic
966101204 3:176270467-176270489 CTTCATCTACTCAAGGTGGAAGG - Intergenic
967656083 3:192051484-192051506 CCTCATATACTGAGGATAAAAGG + Intergenic
970334005 4:15014110-15014132 CCTCTTGCAATGAAGGTAGAGGG + Intronic
970519659 4:16869813-16869835 CCTCAAATACTTAAGATGGAAGG - Intronic
971050218 4:22853671-22853693 TCACATAAACTTAAGGTAGAGGG - Intergenic
971155625 4:24078621-24078643 GCTCATAAATTGAAGGTAGAAGG - Intergenic
971797469 4:31246553-31246575 ACACATAGACTGAAGGTAAAGGG + Intergenic
976607801 4:86998855-86998877 CTTGAGATACTGAAAGTAGAGGG - Intronic
976888051 4:90009657-90009679 CCACATAAACTTAAGGTAAAGGG + Intergenic
977715962 4:100184444-100184466 CCTCAAATACCACAGGTAGAGGG + Intergenic
979914874 4:126418980-126419002 ACTTATAGACTGAAGGTAAAGGG - Intergenic
980310838 4:131127091-131127113 CCTCTTATATGGATGGTAGAAGG + Intergenic
982829944 4:160046447-160046469 TCTCATAAACTTAAGGTAAAGGG + Intergenic
982861634 4:160458587-160458609 CCCCATACACTGAAGCAAGAGGG + Intergenic
983556446 4:169063336-169063358 CCTCATATGCTGGAGTTTGATGG - Intergenic
987612155 5:20219798-20219820 CCTCAAAAACTGAATATAGAAGG + Intronic
987774691 5:22349076-22349098 CCTCATATGGTGAAGGGACAAGG - Intronic
988781692 5:34528358-34528380 CCTCATATTCTGCTGGTGGATGG - Intergenic
990863776 5:60357849-60357871 CCTCAAATACTGAACTTAGGTGG + Intronic
991009115 5:61863907-61863929 CATCATATATTGAAGATTGAAGG - Intergenic
994051116 5:95363866-95363888 TCACATAAACTTAAGGTAGAGGG - Intergenic
994385652 5:99128353-99128375 CCTCATACAATCAAGGCAGACGG - Intergenic
994516306 5:100776656-100776678 CCTCACATAGTGAAGAGAGAGGG - Intergenic
995704209 5:114969415-114969437 CCACATATATTGTAGGTAAAGGG - Intergenic
996304549 5:122032176-122032198 TCACATATACTGAAGGGAGGAGG - Intronic
996835203 5:127783999-127784021 TCTCATAAACTTAAGGTAAAGGG - Intergenic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
998986915 5:147769049-147769071 CCTCAAATACAGAAGTTAAAGGG + Intronic
999535026 5:152506648-152506670 CCTCATCTCCTGCAGCTAGAGGG - Intergenic
1004888735 6:20076706-20076728 CCACATAAACTTAAGGTAAAGGG + Intergenic
1006062781 6:31437586-31437608 TCACATAAACTGAAGGTAAAGGG - Intergenic
1007825505 6:44597173-44597195 CCTCATACACTGCTGGTAGGGGG - Intergenic
1010456885 6:76066338-76066360 ACTCATAGACTGAAGCTAAAGGG + Intronic
1011696177 6:89915410-89915432 ACACATAGACTGAAAGTAGAGGG - Intergenic
1015104156 6:129516910-129516932 CTTTTTATGCTGAAGGTAGAGGG + Intergenic
1015187586 6:130435879-130435901 CTTCATACACTGAAGGGATATGG + Intronic
1017803240 6:157918465-157918487 ACACATATACTGAAAGTAAACGG - Intronic
1022277183 7:28866799-28866821 ACTCATCTAATGAAGGAAGAAGG + Intergenic
1024008065 7:45241827-45241849 ACTCAGAGACTGAAGGGAGACGG - Intergenic
1026345008 7:69466152-69466174 ACTCATATGGTGAAGGCAGATGG - Intergenic
1036783669 8:11670639-11670661 CCTCATACACACAAGGTGGATGG + Intergenic
1037799932 8:22027201-22027223 CCTCATGCACTGAGGGTGGAGGG + Intronic
1038071602 8:24020770-24020792 CCTTATAAACTGAAGTTTGAAGG + Intergenic
1039763681 8:40606038-40606060 TCACATAAACTGAAGGTAAAGGG - Intronic
1042032001 8:64486539-64486561 ACCCAATTACTGAAGGTAGAGGG + Intergenic
1042897037 8:73681751-73681773 TCACATAAACTGAAGGTAAAGGG + Intronic
1043150632 8:76711024-76711046 CCTTTTATATTTAAGGTAGAAGG + Intronic
1044748376 8:95393359-95393381 CTGCATATTCTGAAGGTATAAGG - Intergenic
1046448837 8:114360320-114360342 CCACATAAACTTAAGGTAAAGGG + Intergenic
1047890252 8:129301084-129301106 TCACATAAACTTAAGGTAGAGGG - Intergenic
1057014274 9:91637129-91637151 CCTCATATACTGAAGGTAGAAGG - Intronic
1058109575 9:101017708-101017730 CCTCACATGGTGAAGGCAGAAGG + Intergenic
1060081454 9:120650656-120650678 CCTCATATATTGAAAGTCTATGG - Intronic
1060933126 9:127501192-127501214 CCTCAAATTCTGCAGGTACAGGG + Intronic
1188391785 X:29630157-29630179 CCTCACATGGTGAAGGGAGAAGG + Intronic
1188712531 X:33418172-33418194 ACTTATAGACTGAAGGTAAAGGG + Intergenic
1188844668 X:35058476-35058498 CCTGAGATATTTAAGGTAGATGG - Intergenic
1188882701 X:35509645-35509667 TCTCATCTACTGAAGGTGAAAGG + Intergenic
1190605988 X:52143401-52143423 CTGCTTCTACTGAAGGTAGAAGG + Intergenic
1191784348 X:64901660-64901682 ACTCATAAACTTAAGGTAAAGGG - Intergenic
1192833591 X:74776171-74776193 CTTCATTTACTTAAGGTACATGG - Intronic
1193062933 X:77225305-77225327 GCACATATACTTAAGGTAAAGGG + Intergenic
1193471149 X:81906203-81906225 TCTCACAGACTGAAGGTAAAGGG - Intergenic
1193721778 X:84995417-84995439 ACACATAGACTGAAGGTAAAAGG + Intergenic
1193723412 X:85014188-85014210 TCACATATACTTAAGGTAAAGGG - Intronic
1194739983 X:97560940-97560962 CTTCATATCATGAATGTAGATGG + Intronic
1196154992 X:112418927-112418949 CCTCATATATTGAAGGACAATGG + Intergenic
1197435290 X:126420584-126420606 CTTCAAAAACTGAAGATAGAAGG - Intergenic
1197448901 X:126586551-126586573 GCTCATATACGCAAGGCAGATGG + Intergenic
1198012313 X:132570364-132570386 TATCATATACTGAAGAAAGATGG - Intergenic
1198702235 X:139409693-139409715 CCTTAAAAACTGAGGGTAGAAGG - Intergenic