ID: 1057014279

View in Genome Browser
Species Human (GRCh38)
Location 9:91637136-91637158
Sequence GCCCCAGCCTCATATACTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 296}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057014279_1057014283 27 Left 1057014279 9:91637136-91637158 CCTTCAGTATATGAGGCTGGGGC 0: 1
1: 0
2: 1
3: 9
4: 296
Right 1057014283 9:91637186-91637208 TATCAATAGAAGGCACTAAAGGG No data
1057014279_1057014281 17 Left 1057014279 9:91637136-91637158 CCTTCAGTATATGAGGCTGGGGC 0: 1
1: 0
2: 1
3: 9
4: 296
Right 1057014281 9:91637176-91637198 ATTTATGCTCTATCAATAGAAGG No data
1057014279_1057014282 26 Left 1057014279 9:91637136-91637158 CCTTCAGTATATGAGGCTGGGGC 0: 1
1: 0
2: 1
3: 9
4: 296
Right 1057014282 9:91637185-91637207 CTATCAATAGAAGGCACTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057014279 Original CRISPR GCCCCAGCCTCATATACTGA AGG (reversed) Intronic
901259166 1:7858831-7858853 GCCTCAGCCTCCTATAGTGATGG + Intergenic
901352493 1:8610016-8610038 GCCCCAGCCTCCCAAACTGCTGG + Intronic
902266506 1:15270790-15270812 GCCCCAGCCTCCTAAAGTGCTGG - Intronic
902274918 1:15332456-15332478 GCCTCAGCCTCTTATGTTGATGG - Intronic
903134120 1:21298087-21298109 GCCTCAGCCTCCTAAAGTGATGG + Intronic
904060628 1:27707468-27707490 GCCTCAGCCTCATAAAGTGCTGG + Intergenic
904101122 1:28028664-28028686 GCCCCAGCCTCCTTTAGTGCTGG + Intronic
904109729 1:28116403-28116425 GCCTCAGCCTCCTAAACTGCTGG + Intergenic
904690267 1:32288574-32288596 GCCCCGGCCTCCTAAACTGCTGG - Intergenic
905768260 1:40621238-40621260 GACCCAGCCTCATCTGCTGTTGG + Exonic
906895819 1:49770088-49770110 GCCCCAGCCTCCTAAAGTGCTGG - Intronic
907993761 1:59608581-59608603 GCCCCAGCCTCACAAAGTGCTGG - Intronic
910776643 1:90883206-90883228 GCCCCACCATTGTATACTGAGGG + Intergenic
916801165 1:168217771-168217793 GCCCCAGCCTCCTAAAGTGCTGG + Intergenic
917813647 1:178685550-178685572 GCCCCAGCCTCCCAAACTGCTGG + Intergenic
919656859 1:200205518-200205540 GACCCAACCTCATATACAAAAGG - Intergenic
920445046 1:206010123-206010145 GCCCCAGCCTAACATATTCAAGG + Exonic
920530888 1:206701582-206701604 GCCTCAGCCTCATGAACTGCTGG - Intronic
922109667 1:222544660-222544682 GGCCCAGCCTCATTTTCTTATGG + Intronic
924090878 1:240499542-240499564 GCCACAGCCTCAGCTACTAAAGG + Intronic
924170468 1:241334457-241334479 CCCCCAGCCTCAAATGCTCAGGG + Intronic
924535458 1:244931933-244931955 GCCCCAGCCTCCCAAACTGTTGG + Intergenic
924756051 1:246942118-246942140 TCCCCAGCCTTATTTACTAAAGG - Intergenic
1062973471 10:1665882-1665904 GCCGCACCCTCATTTACTGTGGG - Intronic
1063086286 10:2821042-2821064 GCCTCAGCTACATGTACTGAAGG + Intergenic
1064688376 10:17887915-17887937 GCCCCAGCCTCATAAATAGCTGG + Intronic
1065927309 10:30446283-30446305 GCCCCAGCCTCCTATAGTTCTGG - Intronic
1066049628 10:31621617-31621639 CCCCCTGACTCATCTACTGAAGG + Intergenic
1066461313 10:35614812-35614834 GCCTCAGCCTCCTATAGTGCTGG - Intergenic
1068884398 10:62083579-62083601 CCCCCAGCTTCATTTTCTGATGG - Intronic
1069807437 10:71134737-71134759 GCCCCAGCCCCACATGCAGAAGG + Intergenic
1069836369 10:71311016-71311038 TCCCCAGCCCCATATACATATGG - Intergenic
1071125809 10:82333488-82333510 GCCCCTGCCTCCTATACTGAGGG - Intronic
1071154934 10:82677288-82677310 GCCTCAGCCTCCTAAACTGTTGG + Intronic
1071909668 10:90217188-90217210 GCCCCAGATTCCTATAATGATGG + Intergenic
1071959546 10:90796757-90796779 GCCTCGGCCTCCCATACTGATGG - Intronic
1074397476 10:113109638-113109660 GCCCCAGCCTCCCAAACTGCTGG + Intronic
1076203110 10:128573477-128573499 GCTCCAGCCTCTTCTCCTGAGGG - Intergenic
1076346610 10:129783273-129783295 GCTACAGCCTTATATACTCATGG - Intergenic
1077735829 11:4789787-4789809 GCCCCAGCCTCCTAAAGTGCTGG + Intronic
1077809198 11:5620448-5620470 GCCTCAGCCTCCTATAGTGCTGG + Intronic
1078312116 11:10254654-10254676 GCCTCAGCCTCCTATAATGCTGG - Intronic
1081701159 11:45153633-45153655 GCCACAGCCTCAGACACTCATGG + Intronic
1081902599 11:46642033-46642055 GCCTCAGCCTCCTAAACTGTTGG + Intronic
1083092989 11:60220011-60220033 GCCCCTGACTCATAGAGTGAAGG + Intronic
1084181807 11:67450715-67450737 GCCCCAGCCTCAATGACTGTTGG + Intergenic
1085311509 11:75519718-75519740 CCACCAGCCACAGATACTGATGG + Intronic
1085535379 11:77214209-77214231 GCCCGATCCCCAGATACTGAAGG - Intronic
1085565926 11:77513417-77513439 GCCTCAGCCTCTTAAACTGCTGG - Intergenic
1087744070 11:101922410-101922432 GCCTCAGCCTCCTAAAGTGATGG + Intronic
1090071125 11:123545445-123545467 GCCCCAGGCAGATATTCTGATGG - Intronic
1090793823 11:130116719-130116741 GCCTCAGCCTCATAAAGTGCTGG + Intronic
1094607566 12:31961971-31961993 GCCCCAGCCTCTTAAAGTGCTGG - Intronic
1094609513 12:31979804-31979826 GCCTCAGCCTCACAGACTGCTGG + Intronic
1095810338 12:46367881-46367903 GCCCCAGCCTCCTAGAGTGCTGG - Intronic
1095980129 12:47968005-47968027 GCCCCAGGCACATATCCTCATGG - Intronic
1096337592 12:50768120-50768142 GCCTCAGCCTCCTAAACTGATGG + Intronic
1096680221 12:53251105-53251127 GCCTCAGCCTCCTAAACTGCTGG + Intergenic
1096825783 12:54276563-54276585 GCCCCAGCCACTTGTACAGATGG - Intronic
1097239182 12:57563252-57563274 GCCTCAGCCTCTTAAAATGATGG + Intronic
1097360693 12:58655592-58655614 GCCGCAGCCTCACATAGAGACGG - Intronic
1098529420 12:71523618-71523640 GCCATAACCTCATATACTAAAGG - Intronic
1099867055 12:88296060-88296082 GCCCCAGCCTCCCAAACTGCTGG - Intergenic
1100188083 12:92159298-92159320 TCCCCAGCCTGATGTACTTAAGG + Intergenic
1100408913 12:94295341-94295363 ACCACAGCCCCATATAGTGATGG - Intronic
1100426060 12:94487448-94487470 GCCTCAGCCTCACAAACTGCTGG + Intergenic
1100986608 12:100207909-100207931 GCCTCAGCCTCCCAAACTGATGG - Intronic
1101765784 12:107698110-107698132 GCCTCAGCCTCCTAAACTGCTGG - Intronic
1101798736 12:108002001-108002023 GCACCAGCCTAATATTTTGAAGG - Intergenic
1102512741 12:113426686-113426708 GCCCCAGCCTCCCAAACTGCTGG - Intronic
1104446079 12:128834783-128834805 GCCTCAGCCTCCCATACTGCTGG - Intergenic
1106219599 13:27734681-27734703 GCCCCAGCCTCCCAAACTGCTGG + Intergenic
1107033335 13:35875953-35875975 GCCACAGCATCAGATACTGGGGG - Intronic
1107328100 13:39266930-39266952 CCCCCAGATTCATATATTGAAGG - Intergenic
1107541440 13:41393104-41393126 GCCCCAGCCTCCTAAAGTGTTGG + Intergenic
1111534316 13:89582307-89582329 GCCTCAGCCTCCTAAAGTGATGG - Intergenic
1111785764 13:92784975-92784997 GCCCCAGGCTTTTTTACTGATGG - Intronic
1112547726 13:100388217-100388239 GCCTCAGCCTCTTAAACTGTTGG - Intronic
1113306659 13:109086713-109086735 GTCCCAGACACATATTCTGAGGG - Intronic
1113542427 13:111119282-111119304 GCCCCATCCTGAGATACTGGGGG + Intronic
1116922509 14:50594743-50594765 GCCTCAGCCTCCTAAACTGCTGG - Intronic
1118047029 14:61981387-61981409 TCCCCACCATAATATACTGAAGG - Intergenic
1118195060 14:63617597-63617619 GCCTCAGCCTCACAAACTGCTGG + Intronic
1118857140 14:69632374-69632396 TCCCCAGCTGCATTTACTGAGGG - Intronic
1119238696 14:73040970-73040992 GCCCCAGCCTCCTAAAGTGCTGG - Intergenic
1119623176 14:76148367-76148389 GCCCCAGCCTCCTAGAGTGCTGG - Intergenic
1120916696 14:89716797-89716819 GCCTCAGCCTCATAAAGTGCTGG + Intergenic
1121043472 14:90770405-90770427 GCCTCAGCCTCCTAAAGTGATGG - Intronic
1121327873 14:93032098-93032120 GCCCCAGCCTCCTAAAGTGCTGG - Intronic
1121637635 14:95464546-95464568 GCCCCAACTCCATATTCTGAAGG - Intronic
1122114933 14:99522900-99522922 GCCCCAGCCCCAAATTCTGGGGG - Intronic
1123495965 15:20827207-20827229 GCCACAGCCTCCTATAGTGCTGG - Intergenic
1123552453 15:21396299-21396321 GCCACAGCCTCCTATAGTGCTGG - Intergenic
1123588696 15:21833696-21833718 GCCACAGCCTCCTATAGTGCTGG - Intergenic
1124793646 15:32754168-32754190 GCCTCAGCCTCCTAAACTGCTGG - Intergenic
1125757124 15:42071595-42071617 GCCCCACCCTCAGGTACTGATGG + Intronic
1126764409 15:51998452-51998474 GCCTCAGCCTCATAAAGTGCTGG + Intronic
1127478866 15:59359781-59359803 GGCCCAGCCTCATCCACAGAAGG - Intronic
1128194593 15:65740709-65740731 GCCTCAGCCTCCTAAAGTGATGG - Intronic
1128411833 15:67407063-67407085 GCCACAACCCCATATAATGATGG - Intronic
1129052931 15:72797353-72797375 GCCCCATCCTCAAAGACTGCCGG - Intergenic
1130083900 15:80761406-80761428 GCCCCAGCCTCACATGCAGCTGG + Intergenic
1130288711 15:82577770-82577792 GCCCCAGCCTCACAAAGTGCTGG + Intronic
1130485204 15:84394917-84394939 GCCCCAGCCCCAGAGACTGGGGG + Intergenic
1131096401 15:89657056-89657078 GCCTCAGCCTCCTAGAGTGATGG - Intergenic
1131178476 15:90224708-90224730 ACCCCAGCCTCATATGCCCAGGG - Intronic
1202960799 15_KI270727v1_random:123530-123552 GCCACAGCCTCCTATAGTGCTGG - Intergenic
1132662971 16:1069757-1069779 GCCCCCGCCTCCCATCCTGAAGG + Intergenic
1133954146 16:10425317-10425339 GCCTCAGCCTCCTAAACTGCTGG + Intronic
1135053208 16:19209116-19209138 GCCTCAGCCTCTTAAAGTGATGG + Intronic
1135458605 16:22621088-22621110 GACCCAGCCTCATTAACTTAAGG + Intergenic
1135680011 16:24448319-24448341 GCCCCAGCCTCCTAAAGTGCTGG + Intergenic
1135857393 16:26024480-26024502 GCCTCAGCCTCCTAAAGTGATGG - Intronic
1136132538 16:28232793-28232815 GCCTCAGCCTCCTAAACTGCTGG + Intergenic
1136502403 16:30678886-30678908 GCCTCAGCCTCAGAAAGTGATGG - Intergenic
1137429605 16:48407994-48408016 GCCTCAGCCTCCTAAACTGCTGG - Intronic
1138500288 16:57437773-57437795 GCCCCAGCCTCTCAAACTGCCGG + Intronic
1139941187 16:70606835-70606857 GCCCCAGCCTCCTAAAGTGGTGG + Intronic
1140470614 16:75212192-75212214 CCCCCAGCCTCATTTGGTGAGGG - Intergenic
1141202010 16:81905396-81905418 GGCCCAGCTTCTTATGCTGAGGG - Exonic
1141340160 16:83195878-83195900 GCTCCAGCATCATTTGCTGAAGG - Intronic
1142855489 17:2727129-2727151 GCCTCAGCCTCATAAAGTGCTGG + Intergenic
1143079184 17:4368788-4368810 GCCTCAGCCTCCTAAAGTGATGG + Intergenic
1144202974 17:12957549-12957571 GCCCCACCTTCACATGCTGAGGG - Intronic
1144270696 17:13612753-13612775 GCCTCAGCTGCATATAGTGAGGG + Intergenic
1144327644 17:14197115-14197137 CCTGCAGCCTCATATATTGAAGG + Intronic
1144439996 17:15272699-15272721 GCCCCTCCCTCATGTACAGATGG - Intergenic
1146007549 17:29170217-29170239 GGCACAGCCTCATTTTCTGAAGG - Intronic
1146051459 17:29557114-29557136 GCCTCAGCCTCATAAAGTGATGG - Intergenic
1147146291 17:38486486-38486508 GCCCCAGCCTCACAAAATGCTGG + Intronic
1149705161 17:58688367-58688389 GCCTCAGCCTCCTAAAGTGATGG + Intronic
1149786765 17:59442252-59442274 GCCTCAGCCTCCTAAACTGCTGG - Intergenic
1150574580 17:66418684-66418706 GCCCCAGCCTCCTAAAGTGCGGG + Intronic
1151302924 17:73241678-73241700 GCCCCAGCCTCCCAAACTGCTGG - Intronic
1152608212 17:81303479-81303501 GCCCCAGCTCCACAGACTGACGG + Intergenic
1153852750 18:9111676-9111698 GCCTCAGCCTCCTAAAGTGATGG + Intronic
1153897051 18:9573710-9573732 GCCTCAGCCTCCTAAAGTGATGG + Intronic
1154453370 18:14499708-14499730 GCCACAGCCTCCTATAGTGCTGG - Intergenic
1155541560 18:26873653-26873675 GCCCCAGCCTCCCAAACTGCTGG + Intergenic
1155915312 18:31551623-31551645 GCCTCAGCCTCCTAAACTGCTGG + Intergenic
1156249781 18:35341767-35341789 GCCTCAGCCTCCTATAGTGCTGG - Intronic
1157015848 18:43711605-43711627 ACTCCAGCCTCATTGACTGAGGG + Intergenic
1158124506 18:54086647-54086669 GCACCAACCTAATATACTCATGG + Intergenic
1158524443 18:58199529-58199551 GCCCCAGCCTCCTAAAGTGCCGG - Intronic
1160201841 18:76802257-76802279 GCCCCAGCCTCCTACCCTGGGGG - Intronic
1162016103 19:7847336-7847358 GCCTCAGCCTCCTAAACTGCTGG - Intronic
1162098145 19:8322987-8323009 GCCCCAGCCTCACTTAGTGGAGG + Exonic
1162164426 19:8742844-8742866 GCCTCACCCTCTTCTACTGAAGG + Intergenic
1162165498 19:8750312-8750334 GCCTCACCCTCTTCTACTGAAGG + Intergenic
1162166563 19:8757768-8757790 GCCTCACCCTCTTCTACTGAAGG + Intergenic
1162167629 19:8765224-8765246 GCCTCACCCTCTTCTACTGAAGG + Intergenic
1162168568 19:8771522-8771544 GCCTCACCCTCTTCTACTGAAGG + Intergenic
1162170314 19:8784286-8784308 GCCTCACCCTCTTTTACTGAAGG + Intergenic
1163470456 19:17493873-17493895 GCCCCAGCCTCCCAAACTGCTGG + Intronic
1163584269 19:18155581-18155603 GCCCCAGCCTCACCTGCTGATGG + Exonic
1166113568 19:40638918-40638940 GCCCCAGCCTCACAAAGTGCTGG - Intergenic
1166230036 19:41421336-41421358 CCCCCACCCTCATATACTCCAGG - Intronic
1166432740 19:42740870-42740892 GCTCCAGCCTCCTGCACTGAAGG - Intronic
1166435848 19:42766098-42766120 GCTCCAGCCTCCTGCACTGAAGG - Intronic
1166448711 19:42880086-42880108 GCTCCAGCCTCCTGCACTGAAGG - Intronic
1166453119 19:42918274-42918296 GCTCCAGCCTCCTGCACTGAAGG - Intronic
1166465393 19:43026860-43026882 GCTCCAGCCTCCTGCACTGAAGG - Intronic
1166471526 19:43083065-43083087 GCTCCAGCCTCCTGCACTGAAGG - Intronic
1167953096 19:53043635-53043657 GCCTCAGCCTCCTAAAGTGATGG - Intergenic
927365254 2:22287387-22287409 CCCCCAAATTCATATACTGAAGG - Intergenic
927899429 2:26808638-26808660 GCCTCAGCCTCCTAAACAGATGG + Intergenic
929219425 2:39448354-39448376 GCCCCAGAGTCATATCCTGCTGG + Intergenic
929790486 2:45018864-45018886 GCCCCAGCCTCATTGACTCTGGG + Intergenic
929909604 2:46078277-46078299 GCCTCAGCCTCTTATAGTGCTGG - Intronic
930394288 2:50800797-50800819 GCCCCAGCCTCACAAAGTGCTGG + Intronic
930999842 2:57766311-57766333 GACCCAGCCACATGTACTAAAGG - Intergenic
931414229 2:62065567-62065589 GCCTCAGCCTCCCAAACTGATGG + Intronic
931649015 2:64452287-64452309 GCCTCAGCCTCCTATATTGCTGG + Intergenic
933213913 2:79604391-79604413 GCCCCAGCCTACTAGACTGAGGG + Intronic
937081879 2:119146155-119146177 GCCTCAGTCTCCTCTACTGAGGG + Intergenic
938866474 2:135426578-135426600 GCCCCAGCCTCCCAAACTGCTGG - Intronic
940944444 2:159599685-159599707 GCCTCAGCCTCACAAACTGCTGG - Intronic
941579332 2:167274920-167274942 GCTCCAGCCTCAAATTCTAAGGG + Intergenic
942162666 2:173208148-173208170 GCCTCAGCCTCCTAAAGTGATGG - Intronic
942267814 2:174246048-174246070 GCCTCAGCCTCTTATAGTGCTGG - Intronic
943838647 2:192549538-192549560 GCCCCAGCCTCCTAAAGTGCTGG + Intergenic
944771820 2:202922364-202922386 GCCCCAGCCTCCCAAAGTGATGG + Intronic
944910567 2:204306572-204306594 GCCCCAGCCTCCCAAACTGCTGG + Intergenic
945163690 2:206920009-206920031 GCCTCAGCCTCCTAAACTGCTGG + Intergenic
946639160 2:221764683-221764705 GCCCCAGCCTCCCACACTGCTGG + Intergenic
947187303 2:227466843-227466865 CCCCCAGCCCCATACACTGCAGG - Intergenic
948621812 2:239240056-239240078 GCCCCAGCCTTTCATAATGAGGG - Intronic
1171374410 20:24682416-24682438 GCCCCAGACTCATGCCCTGAGGG - Intergenic
1172286358 20:33743280-33743302 GCCTCAGCCTCACAAACTGCTGG + Intronic
1172341262 20:34159570-34159592 GCCCCAGCCTCCCAAGCTGAAGG - Intergenic
1174751068 20:53111962-53111984 GCCCCATCCTGAGATGCTGAGGG + Intronic
1176820817 21:13653579-13653601 GCCACAGCCTCCTATAGTGCTGG + Intergenic
1178276958 21:31247643-31247665 GCCTCAGCCTCCTATAGTGCTGG + Intronic
1180122416 21:45762731-45762753 GCCCCAGCCTCCCAAACTGCCGG + Intronic
1182602274 22:31475500-31475522 GCCTCAGCCTCCTATAGTGCTGG - Intronic
1182633732 22:31707898-31707920 GCCCCAGCCTCCTAAAGTGCTGG - Intronic
1182752698 22:32654455-32654477 GCCCCAGCCTTATCTTCTGCTGG + Intronic
1183450397 22:37891229-37891251 GCCTCAGCCTCCCATAGTGATGG + Intergenic
1184076260 22:42180651-42180673 GCCCCCGACACAGATACTGATGG + Intronic
1184169173 22:42748977-42748999 GCCCCAGCCTAATCCTCTGAGGG + Intergenic
1184173271 22:42772007-42772029 GCCCCAGCCTCCTAAAGTGCTGG + Intergenic
1184685096 22:46093033-46093055 GCCCCAGCTTCACATCCTAAAGG - Intronic
949696831 3:6706945-6706967 GCCACAATCTCACATACTGAGGG + Intergenic
950035993 3:9886102-9886124 GCCTCAGCCTCACAGACTGCTGG - Intergenic
950489351 3:13294133-13294155 GCCCATGGCTCATATACAGAAGG + Intergenic
951786920 3:26431429-26431451 GGCCAAGCATCATATACTGAAGG + Intergenic
953052471 3:39358120-39358142 GCCTCAGCCTCCTAAACTGCTGG - Intergenic
953213241 3:40894780-40894802 GCCCCAGCCTCCTATTCAGGGGG + Intergenic
953364120 3:42327244-42327266 GCCTCAGCCTCACAAACTGTTGG + Intergenic
954565909 3:51599865-51599887 GCCTCAGCCTCCTAAAGTGATGG + Intronic
957582964 3:82099907-82099929 GCCTCAGCCTCCCAAACTGATGG - Intergenic
959544283 3:107575919-107575941 GCCTCAGCCTCATAAAATGCTGG - Intronic
961345151 3:126259492-126259514 GTCCCAGCATCATCTGCTGAGGG + Intergenic
962579291 3:136783304-136783326 GCCTCAGCCTCCTATAGTGCTGG - Intergenic
963178370 3:142325896-142325918 GTCCCAGGATCATTTACTGAAGG + Intronic
963928697 3:150979121-150979143 GCCCCACCCTCTTATCCTGGAGG + Intergenic
966385751 3:179395799-179395821 GCCCCAGCCTCCTAAAGTGCTGG - Intergenic
969761579 4:9188383-9188405 GCCCCAGCCCCACATACAGTGGG - Intergenic
971398098 4:26249408-26249430 GCCTCAGCCTCATAAAGTGCTGG - Intronic
973763492 4:54142072-54142094 GCCTCAGCCTCACAAACTGCTGG - Intronic
973867755 4:55130908-55130930 GCCTCAGCCTCCTAAACTGCTGG - Intergenic
977870210 4:102081827-102081849 GCCTCAGCCTCATAAAGTGCTGG - Intergenic
978542776 4:109836803-109836825 GCCCCAGCCTCACAAAGTGCTGG - Intronic
978588122 4:110294581-110294603 GCCTCAGCCTCCTAAACTGGTGG - Intergenic
979076981 4:116283683-116283705 GCCTCAGCCTCCTATAGTGCTGG + Intergenic
979185845 4:117791826-117791848 GCCTCAGCCTCCTAAACTGTTGG - Intergenic
979337585 4:119481091-119481113 GCCCCATACCCATCTACTGAGGG - Intergenic
988513740 5:31887730-31887752 GACACAGGCTCAAATACTGAGGG + Intronic
989018020 5:36963550-36963572 GCCCCAGCCTCCTACAGTGCTGG - Intronic
989230402 5:39079558-39079580 GCCCCAGCCTCCCGTACTGCTGG - Intergenic
990637536 5:57746291-57746313 GCCCCAGTCTTGTATATTGAGGG + Intergenic
992698289 5:79313176-79313198 GCCTCAGCCTCATAAAGTGCTGG - Intronic
998112827 5:139515316-139515338 GCCTCAGCCTCCTATAGTGCTGG - Intergenic
998789846 5:145754203-145754225 AGCCCAGCCTTATATACAGAAGG - Intronic
998833582 5:146183638-146183660 GCCCCAGCCTCCCAAAGTGATGG + Intergenic
1000011939 5:157241185-157241207 GCCTCAGCCTCCCATACTGCTGG + Intronic
1000189170 5:158892237-158892259 GCCTCAGCCTCCTAAAGTGATGG - Intronic
1002077475 5:176717544-176717566 GGCTCAGCCTCATAAAGTGAGGG - Intergenic
1002376864 5:178795190-178795212 GCCTCAGCCTCACAAACTGCTGG + Intergenic
1005182761 6:23125284-23125306 GCCTCAGCCTCCTAGACTGCTGG - Intergenic
1007003950 6:38342284-38342306 GCCCCAGCCTCCCAAACTGCTGG - Intronic
1009244173 6:61214534-61214556 GCCCCAGCCTCCCAAACTGTTGG - Intergenic
1009945687 6:70339847-70339869 ATCCCAGCATCATATATTGATGG + Intergenic
1010239710 6:73603667-73603689 GCCCCAGCCTCCCATAGTGCTGG + Intronic
1013767847 6:113595082-113595104 GCCCCAGCCTCCCAAACTGCTGG - Intergenic
1014209923 6:118697704-118697726 GCTCAAGTTTCATATACTGATGG - Intronic
1014551525 6:122794346-122794368 GCCCCAGCCTCCTAAAGTGCTGG - Intronic
1016207504 6:141487397-141487419 CCCCCAGATTCATATATTGAAGG + Intergenic
1016263563 6:142204971-142204993 GCCTCAGCCTCCCATACTGCTGG + Intronic
1017462889 6:154667925-154667947 GCCCCAGCCTCCCATAGTGCTGG - Intergenic
1019671851 7:2284177-2284199 GCCTCAGCCTCCTATAGTGCTGG + Intronic
1020045419 7:5036801-5036823 TCCCCAGCCTCACAGACTGTTGG + Intronic
1020200551 7:6076526-6076548 GCCCCAGCCTCCTAAAGTGCTGG + Intergenic
1020333043 7:7039696-7039718 GCCTCAGCCTCCTATAGTGTTGG + Intergenic
1023863468 7:44228317-44228339 TCCTCAGCCTCCTAGACTGAGGG + Intronic
1024617225 7:51126211-51126233 GCCTCAGCCTCCCATACTGCTGG - Intronic
1025919059 7:65893290-65893312 GCCTCAGCCTCCCAAACTGATGG - Intronic
1026058220 7:67003791-67003813 GCCTCAGCCTCCTAAACTGCTGG - Intronic
1026173052 7:67971546-67971568 GCCTCAGCCTCCTAAAGTGATGG - Intergenic
1026719871 7:72821221-72821243 GCCTCAGCCTCCTAAACTGCTGG + Intronic
1026848747 7:73712028-73712050 GCCCTACCCTCATAGACGGAGGG - Intronic
1027142708 7:75670406-75670428 GCCTCAGCCTCATAAAGTGCTGG + Intronic
1027875202 7:83759985-83760007 GCCCCAGCCTCCTAAAGTGGTGG + Intergenic
1029269879 7:99370864-99370886 GCCTCAGCCTCCTAAACTGCTGG + Intronic
1030025295 7:105318004-105318026 GCCTCAGCCTCATAAAGTGCTGG + Intronic
1030560585 7:111079776-111079798 TCCCCAAATTCATATACTGATGG + Intronic
1038067791 8:23981704-23981726 GGCGCAGCCTCAAACACTGATGG - Intergenic
1039011232 8:33095699-33095721 TCACCAGGCTCATATAATGAAGG + Intergenic
1040627117 8:49161605-49161627 GCCCAAGCCTGATTTACAGATGG - Intergenic
1041641061 8:60202298-60202320 GCCTCAGCCTCACAAACTGCTGG + Intronic
1043274859 8:78380280-78380302 GCCCCAGCCTCCTAAAGTGTTGG - Intergenic
1043855223 8:85257469-85257491 GCCTCAGCCTCACAAACTGCTGG - Intronic
1045042869 8:98243531-98243553 GACCGAGTCTCATAAACTGAAGG - Intronic
1049057661 8:140251618-140251640 TCCCCAGCTGCATCTACTGAAGG + Intronic
1049720086 8:144111664-144111686 GCCCCAGCCTCAACTGCTGAAGG - Exonic
1049793875 8:144487277-144487299 GCCCCAGCACCATTTATTGAAGG + Intronic
1050510822 9:6393419-6393441 GCCCCAGCCTCCCAAACTGCTGG - Intergenic
1052352116 9:27468616-27468638 TCCCAACCCTCATAAACTGATGG - Intronic
1053013635 9:34649415-34649437 GCCCCAGCCTCTGATCCTGTGGG - Exonic
1053457826 9:38244732-38244754 GCCTCAGCCTCCTAGAGTGATGG - Intergenic
1056973793 9:91232133-91232155 GCCCCAGCCTCCTAAAGTGCTGG - Intronic
1057014279 9:91637136-91637158 GCCCCAGCCTCATATACTGAAGG - Intronic
1057462590 9:95276852-95276874 GCTGCAGCCTCATGTACTGTGGG - Intronic
1058812887 9:108658399-108658421 GCCTCAGCCTCCTAAACTGCTGG + Intergenic
1059066326 9:111089105-111089127 GCCTCAGCCTCCTAAACTGCTGG + Intergenic
1060224293 9:121781937-121781959 GCCCCAGCCTCCTTTACTCAGGG + Intronic
1060401617 9:123353064-123353086 GCCCCAGACTCAGACACAGAGGG + Intergenic
1060622866 9:125083266-125083288 GCCCCAGCCTCCTAAAGTGCTGG - Intronic
1203526540 Un_GL000213v1:95974-95996 GCCACAGCCTCCTATAGTGCTGG - Intergenic
1186135843 X:6519580-6519602 GCACCAACCTAATATAGTGATGG - Intergenic
1187018467 X:15354218-15354240 GCCTCAGCCTCCCATACTGCTGG + Intronic
1187159028 X:16747325-16747347 GGCACAGCCTCAAATTCTGAGGG - Intronic
1187438416 X:19294196-19294218 GGCCCAGCTTCATTTCCTGAGGG + Intergenic
1189726890 X:43976115-43976137 GCCCCAGGCTCATAAAATGGTGG - Intergenic
1189816418 X:44828932-44828954 GCCTCAGCCTCCTAGACTGCTGG + Intergenic
1190720262 X:53142143-53142165 GCCCAAGCCACATGTACTAAAGG + Intergenic
1190831587 X:54063675-54063697 GCCTCAGCCTCATAAAATGCTGG - Intergenic
1191716875 X:64199919-64199941 GCCCCAGCCCCAAATACACAGGG + Intronic
1195083722 X:101394518-101394540 GCCTCAGCCTCACAAACTGTTGG + Intronic
1195382741 X:104286250-104286272 ACCTCAGCCTCGTATACTGCTGG - Intergenic
1196844441 X:119887412-119887434 GCCCCAGCCTCCCAAACTGCTGG - Intergenic
1201889586 Y:18927288-18927310 GCCTCAGCCTCTTAAACTGTTGG + Intergenic
1201893998 Y:18974222-18974244 GCCTCAGCCTCACAAACTGCTGG + Intergenic
1201898969 Y:19026607-19026629 GCCTCAGCCTCCTAAACTGTTGG + Intergenic
1202372911 Y:24210373-24210395 GCCCCAGCCCCAGAGACTGGGGG - Intergenic
1202497871 Y:25459747-25459769 GCCCCAGCCCCAGAGACTGGGGG + Intergenic
1202582803 Y:26399948-26399970 GCCTCAGCCTCCTAAACTGTTGG - Intergenic