ID: 1057014281

View in Genome Browser
Species Human (GRCh38)
Location 9:91637176-91637198
Sequence ATTTATGCTCTATCAATAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057014273_1057014281 28 Left 1057014273 9:91637125-91637147 CCATCCTTCTACCTTCAGTATAT 0: 1
1: 0
2: 2
3: 57
4: 650
Right 1057014281 9:91637176-91637198 ATTTATGCTCTATCAATAGAAGG No data
1057014272_1057014281 29 Left 1057014272 9:91637124-91637146 CCCATCCTTCTACCTTCAGTATA 0: 1
1: 0
2: 1
3: 24
4: 243
Right 1057014281 9:91637176-91637198 ATTTATGCTCTATCAATAGAAGG No data
1057014279_1057014281 17 Left 1057014279 9:91637136-91637158 CCTTCAGTATATGAGGCTGGGGC 0: 1
1: 0
2: 1
3: 9
4: 296
Right 1057014281 9:91637176-91637198 ATTTATGCTCTATCAATAGAAGG No data
1057014274_1057014281 24 Left 1057014274 9:91637129-91637151 CCTTCTACCTTCAGTATATGAGG 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1057014281 9:91637176-91637198 ATTTATGCTCTATCAATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057014281 Original CRISPR ATTTATGCTCTATCAATAGA AGG Intronic
No off target data available for this crispr