ID: 1057016549

View in Genome Browser
Species Human (GRCh38)
Location 9:91657531-91657553
Sequence CAGGACCAAACAGCCTGAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 126}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057016549_1057016563 30 Left 1057016549 9:91657531-91657553 CCAACTCAGGCTGTTTGGTCCTG 0: 1
1: 0
2: 1
3: 11
4: 126
Right 1057016563 9:91657584-91657606 CCAGGGTCACTTCACCCCTGTGG No data
1057016549_1057016557 13 Left 1057016549 9:91657531-91657553 CCAACTCAGGCTGTTTGGTCCTG 0: 1
1: 0
2: 1
3: 11
4: 126
Right 1057016557 9:91657567-91657589 TACCCCACTGTTGGTACCCAGGG No data
1057016549_1057016554 4 Left 1057016549 9:91657531-91657553 CCAACTCAGGCTGTTTGGTCCTG 0: 1
1: 0
2: 1
3: 11
4: 126
Right 1057016554 9:91657558-91657580 TCGGGAACCTACCCCACTGTTGG No data
1057016549_1057016556 12 Left 1057016549 9:91657531-91657553 CCAACTCAGGCTGTTTGGTCCTG 0: 1
1: 0
2: 1
3: 11
4: 126
Right 1057016556 9:91657566-91657588 CTACCCCACTGTTGGTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057016549 Original CRISPR CAGGACCAAACAGCCTGAGT TGG (reversed) Intronic
900461110 1:2802485-2802507 CAGGAGCAGAAAGACTGAGTGGG + Intergenic
900970251 1:5988721-5988743 CATGACCAGGCAGCCTGAGAGGG + Intronic
907088345 1:51700313-51700335 CAGGACATTAGAGCCTGAGTAGG - Intronic
907275045 1:53312267-53312289 CAGGGCCAAACATTCTGAGTAGG - Intronic
915728185 1:158033579-158033601 AAGGATCAAACAACCTGATTGGG - Intronic
916013422 1:160727002-160727024 CAGTACAACACTGCCTGAGTAGG + Intergenic
918818474 1:189222936-189222958 TAGGGCCAATCAGACTGAGTTGG + Intergenic
919878147 1:201885580-201885602 CACGGCCAAACAGCATGGGTGGG + Intergenic
922704595 1:227782466-227782488 CAGGACCTCACAGTGTGAGTGGG + Intergenic
923920552 1:238559704-238559726 CAGTCCCATACAGCCTGAGAAGG - Intergenic
924353920 1:243149497-243149519 CAGATCCAAACAGCAAGAGTAGG - Intronic
924756145 1:246942987-246943009 CAGGCCAAAACATCCAGAGTGGG + Intergenic
1064436204 10:15313240-15313262 CAGGACCCAGCAGCCTCAGGAGG + Intronic
1067409598 10:46052925-46052947 CAGGATCCAACATGCTGAGTGGG + Intergenic
1069781890 10:70962070-70962092 CAGGACCACAGATCCTGAGCAGG + Intergenic
1070557372 10:77539040-77539062 CCGGACCAACCAGCCTGTATTGG - Intronic
1070573788 10:77661646-77661668 AAGGTCCAAACAGCCTGAGAGGG + Intergenic
1071318641 10:84429089-84429111 CAGGACCACACAGATTGAATTGG + Intronic
1073470747 10:103720728-103720750 AAGGTCCAAACAGCCGGAGAGGG + Intronic
1074459980 10:113627977-113627999 CAGGGCCAAGAAGGCTGAGTCGG - Intronic
1076071719 10:127495817-127495839 CAGGAACAAAGATCCTGAGACGG - Intergenic
1076079875 10:127569791-127569813 GAAGACCAAACAGCATGTGTTGG + Intergenic
1076628407 10:131836343-131836365 GAGGAGGAAACAGCCTGAATGGG - Intergenic
1083758026 11:64801838-64801860 GAGGAAGAAGCAGCCTGAGTGGG - Intronic
1084272757 11:68038039-68038061 TACAACCAGACAGCCTGAGTGGG - Intergenic
1084301978 11:68258095-68258117 CAGGAACAGAAAGCCTGAGGGGG + Intergenic
1089880371 11:121767730-121767752 CAAGACTAATCAGCCTGACTTGG + Intergenic
1090200584 11:124852547-124852569 GAGGACCATGCAGTCTGAGTGGG + Intergenic
1090820837 11:130340131-130340153 AAAGAATAAACAGCCTGAGTGGG - Intergenic
1090843562 11:130513175-130513197 CACGACCAGACATCCTGAGCCGG - Intergenic
1090971968 11:131651963-131651985 CAGGCCCAAACAGCCTGAGGTGG + Intronic
1092149100 12:6234997-6235019 CAGGGAGAAACAGCCCGAGTGGG + Intronic
1092274856 12:7052224-7052246 CAGGAACAAACTGCCTGAACAGG - Intronic
1098504774 12:71236922-71236944 CTGAACCAGACAGCCTGAGTTGG - Intronic
1100673026 12:96836526-96836548 CAGCACCAAAGAGGCTGAGGTGG + Intronic
1106080244 13:26494455-26494477 GAGGGCCAAACATGCTGAGTTGG - Intergenic
1107662546 13:42653992-42654014 CAGTAACAGACATCCTGAGTTGG - Intergenic
1108593897 13:51934382-51934404 CAGGACCAAAAAACCTCACTGGG - Exonic
1113437181 13:110302238-110302260 CAGGACCAAAATGGCAGAGTCGG + Intronic
1119386626 14:74261411-74261433 CAGGAAGGAACAGGCTGAGTTGG - Exonic
1120299011 14:82681643-82681665 CAGGAGAAAACATCATGAGTAGG - Intergenic
1122196517 14:100091480-100091502 AAGGACCAAAAAGGCAGAGTTGG + Intronic
1122721183 14:103723538-103723560 CAGGACCTGCCTGCCTGAGTTGG + Intronic
1125192000 15:37004387-37004409 AAGCACAAAACAGCCTGAGCAGG + Intronic
1128236223 15:66069202-66069224 CAGGACCAAACAGACTTGGACGG - Intronic
1131608429 15:93934717-93934739 CAGCACCAAACACCCTGAAGTGG - Intergenic
1133550540 16:6850372-6850394 CAGGACCAACCTACCTAAGTAGG - Intronic
1133966723 16:10537068-10537090 TAGGGCCAAGCAGCCTAAGTTGG + Intronic
1134194027 16:12144691-12144713 CAGCACAAAACAGACTGAGACGG + Intronic
1135270575 16:21066249-21066271 TAGGATCAAACATCCTAAGTGGG + Intronic
1136535895 16:30899334-30899356 CAGGAACAAAGAGCCAGCGTGGG + Intronic
1137398300 16:48132776-48132798 TAGGACCTAAGAGCCTGAGATGG + Intronic
1137636038 16:49987139-49987161 TATGCCCAAAGAGCCTGAGTTGG - Intergenic
1141380436 16:83571648-83571670 CAGGAGCAAACTGCCTGTGCTGG - Intronic
1141715776 16:85726007-85726029 CAGGACCAAGCACACTGAGCTGG - Intronic
1148191437 17:45681363-45681385 CAGGACCAAAGAGCCTGTGGAGG - Intergenic
1148722292 17:49763038-49763060 CCGGACAAAACAGCCTTGGTGGG + Intronic
1152151359 17:78603401-78603423 CAGGAACCAGCACCCTGAGTGGG + Intergenic
1152440276 17:80304307-80304329 CAGGATCAAACAGCCCAAGTGGG - Intronic
1153695084 18:7632060-7632082 CAGAACTAAATAGCCTAAGTAGG + Intronic
1162116158 19:8430743-8430765 CAGGCACAACCAGCCTGAGATGG - Exonic
1162183919 19:8889716-8889738 CAGGACTAAACATGGTGAGTGGG + Intronic
1162870140 19:13580300-13580322 CAGGACCCTACATCCAGAGTTGG + Intronic
1167616824 19:50539225-50539247 CAGGCCCAGACAGCCAAAGTGGG - Intronic
1168298883 19:55391993-55392015 CAGCGCCAAACAGCCTGGGCTGG - Intronic
926837148 2:17035774-17035796 CAGGAGCAAAAATCCTGAGGTGG + Intergenic
927488938 2:23507726-23507748 CAGGAACAAACAGGCTGCTTTGG - Intronic
935171187 2:100612548-100612570 CAGGACCCTACAGCCTCAATGGG - Intergenic
937207349 2:120245373-120245395 CAGGATCTCACAGCCTGAGAGGG - Intronic
942625929 2:177900845-177900867 GAGGACCAAATATCCTGGGTAGG + Intronic
947156171 2:227164544-227164566 CACAACCAAAAAGCCTGGGTGGG + Exonic
1168862207 20:1053688-1053710 CAGGAGGAAACAGGCTGAGGAGG - Intergenic
1168981172 20:2005053-2005075 CAAGAGCAAACACCCTGAGGTGG - Intergenic
1170319744 20:15082133-15082155 AAGGACCACCCAGCCAGAGTGGG + Intronic
1173221215 20:41134577-41134599 CAGGATCAGACAGCCAGAGAGGG + Intergenic
1173246689 20:41342058-41342080 CAGGACCAGCCTGCATGAGTGGG + Intronic
1175770560 20:61620969-61620991 CGAGAGCAAACAGCCTGACTTGG - Intronic
1177612734 21:23473713-23473735 CAGGAGCCAACAGCCAGAGTTGG - Intergenic
1179435520 21:41359679-41359701 AAGGACCAAACAGCCAGTCTGGG + Intergenic
1179977944 21:44881300-44881322 CAGGACCAGACAGCCACAGTGGG + Intergenic
1180936085 22:19626107-19626129 CTGGACCCTACAGCCTGCGTGGG + Intergenic
1182534364 22:30989455-30989477 TAGGACCTAACAGCCTAAGAAGG + Intergenic
1183619839 22:38965962-38965984 CAGGACCAAGCAGATTGACTGGG + Intronic
1183948943 22:41342097-41342119 CAGGACCACACAGCTAGTGTAGG - Intronic
1184543021 22:45142411-45142433 CAGGACCCACCTGCCTGGGTGGG + Intergenic
949374185 3:3368652-3368674 CAGTACCAAACTGCCACAGTAGG + Intergenic
952451577 3:33439146-33439168 CAAGAGGAAACAGCCTGAGAGGG + Intronic
957051497 3:75415584-75415606 CAGGTCCACACACCCTGAGGTGG + Intergenic
959403622 3:105933628-105933650 CAGGACCAAAGAGCCGGGATTGG - Intergenic
960588061 3:119339167-119339189 CAGCAACACACAGCATGAGTGGG + Intronic
962444075 3:135449417-135449439 CAGGCCACACCAGCCTGAGTAGG + Intergenic
965122724 3:164583952-164583974 CTGGAGCACACAGCCAGAGTGGG + Intergenic
968107118 3:196009202-196009224 AAGGACCACACAGCCTGAGCTGG + Intergenic
968520113 4:1031339-1031361 CTGAATCAAACTGCCTGAGTGGG - Intergenic
968796990 4:2713479-2713501 CAGGCCCAAGGAGCATGAGTGGG - Intronic
971267936 4:25111208-25111230 TGGGACCCAAGAGCCTGAGTAGG - Intergenic
976056449 4:81074143-81074165 AAGGACCATACAGCATGACTAGG - Intergenic
976457251 4:85262537-85262559 CTGGACCTTAAAGCCTGAGTTGG - Intergenic
979247884 4:118530134-118530156 CAGATCCAAACAGCAAGAGTAGG + Intergenic
980870172 4:138602415-138602437 CAGCAACAAACACCCTGAGCAGG + Intergenic
982789730 4:159576914-159576936 AAAGACTAAATAGCCTGAGTGGG - Intergenic
987410835 5:17613250-17613272 CTGGCCCAAGCAGCCTGAGGTGG + Intergenic
990331665 5:54733157-54733179 CAATTCCCAACAGCCTGAGTGGG - Intergenic
990714503 5:58621898-58621920 CAGGAAGGAAGAGCCTGAGTGGG + Intronic
992230888 5:74662933-74662955 CAGCTTCAAAAAGCCTGAGTTGG - Intronic
999397497 5:151239395-151239417 CAGCAACAATGAGCCTGAGTTGG + Intronic
1000285716 5:159824557-159824579 CAGGACCAAAAAGTCTGTCTTGG - Intergenic
1002602874 5:180364061-180364083 AAGGAACAAAAAGCCTGAGGAGG - Intergenic
1003051074 6:2781933-2781955 TGGGACCAAACAGCCTGGGCTGG - Intronic
1006457809 6:34142097-34142119 CAGGAGCCATCAGTCTGAGTGGG + Intronic
1007493513 6:42243080-42243102 CAGGACCTACCCTCCTGAGTAGG - Intronic
1007730175 6:43940793-43940815 CGGGGCCAAACAGCCTGAAGAGG + Intergenic
1007842479 6:44728087-44728109 CAGGGGAAAACAGCCTGAGCAGG + Intergenic
1011859880 6:91741261-91741283 CAGGAGCAGACAGGATGAGTGGG + Intergenic
1016065750 6:139681508-139681530 CAGTACCAAAAAACCTGAATGGG - Intergenic
1019934563 7:4245870-4245892 TAGGACAAGACAGCCTGAGGGGG - Intronic
1021450885 7:20783682-20783704 CAAGCCCCGACAGCCTGAGTAGG + Intronic
1024751384 7:52469681-52469703 CAGGAATAAACAGACTGAATAGG - Intergenic
1028916118 7:96261063-96261085 CAGGTGCAAAGAGCCTGAGAGGG - Intronic
1033059865 7:138095878-138095900 CAGCACAAAACAGACTGAGAAGG - Intronic
1035306974 7:157939656-157939678 CAGCACCAGACAGACAGAGTTGG + Intronic
1037737348 8:21578427-21578449 AAGTACCAATCAGCCTGATTGGG + Intergenic
1043908606 8:85834783-85834805 CAGGACCAATATGCCTGAGTAGG - Intergenic
1045657407 8:104401091-104401113 CAAGGCCAAAGTGCCTGAGTGGG - Intronic
1046981087 8:120336935-120336957 CAGTACCTAACAGCCTGCGAAGG - Intronic
1047225427 8:122952369-122952391 CAGGACAACTCAGCCTGGGTCGG - Exonic
1057016549 9:91657531-91657553 CAGGACCAAACAGCCTGAGTTGG - Intronic
1057858888 9:98624319-98624341 CATGACCTCACAGCCTCAGTGGG + Intronic
1059312060 9:113395341-113395363 CTGGACAAGACAGCCTCAGTGGG - Intronic
1061500339 9:130998150-130998172 CAGGAACACACAGCGGGAGTGGG - Intergenic
1062710873 9:137974578-137974600 CAGGTCCAGACAGCCTCGGTCGG - Intronic
1187711207 X:22056389-22056411 CATGACCAAACAGACTTAGAAGG - Intronic
1192179777 X:68909233-68909255 CAGGACAAGTCAGGCTGAGTGGG - Intergenic
1195549977 X:106157330-106157352 CAGGACCATTCTGCCTGAGCAGG - Intergenic
1197618673 X:128722211-128722233 AGTGACCAAACAGGCTGAGTGGG + Intergenic
1198644880 X:138795504-138795526 CAGGAACACACAGCCTATGTTGG + Intronic
1199416183 X:147585725-147585747 CAGGAAAAAACAGACTGATTTGG + Intergenic
1200705656 Y:6440465-6440487 CAGAACCACACAGCCTAAGTTGG - Intergenic
1201028455 Y:9724243-9724265 CAGAACCACACAGCCTAAGTTGG + Intergenic