ID: 1057020264

View in Genome Browser
Species Human (GRCh38)
Location 9:91691885-91691907
Sequence GGGTATATGCAGAGGGAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057020257_1057020264 7 Left 1057020257 9:91691855-91691877 CCAGCAGAAAAAGAGGGGTCTGG 0: 1
1: 0
2: 2
3: 22
4: 195
Right 1057020264 9:91691885-91691907 GGGTATATGCAGAGGGAAACAGG No data
1057020256_1057020264 8 Left 1057020256 9:91691854-91691876 CCCAGCAGAAAAAGAGGGGTCTG 0: 1
1: 0
2: 0
3: 13
4: 179
Right 1057020264 9:91691885-91691907 GGGTATATGCAGAGGGAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057020264 Original CRISPR GGGTATATGCAGAGGGAAAC AGG Intronic
No off target data available for this crispr