ID: 1057021146

View in Genome Browser
Species Human (GRCh38)
Location 9:91698642-91698664
Sequence GAGAAAAAGGAGCAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1482
Summary {0: 1, 1: 11, 2: 33, 3: 146, 4: 1291}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057021146_1057021153 14 Left 1057021146 9:91698642-91698664 CCTTCCACCTGCTCCTTTTTCTC 0: 1
1: 11
2: 33
3: 146
4: 1291
Right 1057021153 9:91698679-91698701 CTTCTCCCACTTGTCTGTCTTGG No data
1057021146_1057021156 20 Left 1057021146 9:91698642-91698664 CCTTCCACCTGCTCCTTTTTCTC 0: 1
1: 11
2: 33
3: 146
4: 1291
Right 1057021156 9:91698685-91698707 CCACTTGTCTGTCTTGGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057021146 Original CRISPR GAGAAAAAGGAGCAGGTGGA AGG (reversed) Intronic
900149080 1:1170494-1170516 GAGAGGAAGGAGGAGGGGGAGGG - Intergenic
900247132 1:1641760-1641782 GAGGAAGAGGAGGAGGAGGAAGG - Exonic
900258356 1:1708892-1708914 GAGGAAGAGGAGGAGGAGGAAGG - Exonic
900334797 1:2157157-2157179 GAGAACAAGAAGGAGGAGGAAGG - Intronic
900690442 1:3977498-3977520 GTGACAAGGGAGAAGGTGGAAGG + Intergenic
900709768 1:4106384-4106406 GAGAAAAAGGAAGGGGTGGAGGG + Intergenic
900970514 1:5990101-5990123 AGGAGCAAGGAGCAGGTGGAAGG - Intronic
901061284 1:6473146-6473168 GACAAGATGGAGCAGCTGGAGGG - Exonic
901145828 1:7064110-7064132 GAGAAGAAGAAGGAGGAGGAGGG - Intronic
901331128 1:8409454-8409476 GAGGAATAGAAGCAGGGGGAAGG + Intronic
901753889 1:11429275-11429297 GAGAAAGGGGAGAAGGTGGCAGG + Intergenic
901756193 1:11443006-11443028 GAGAAAAAGGGAGAGGTGGAGGG + Intergenic
901913388 1:12478996-12479018 GCTAAAACAGAGCAGGTGGAAGG + Intronic
902176088 1:14652378-14652400 GAGAAACAGGAGGAGGAAGAAGG - Intronic
902324718 1:15692361-15692383 GAGGAAGAGGAGCAGGCAGAAGG - Intronic
902330430 1:15728600-15728622 AAGAAAATGGGGCAGGGGGAGGG + Intronic
902339878 1:15775997-15776019 GAGAAAAAGGAACAGGCAAAAGG + Intronic
902546194 1:17191979-17192001 AAGAAAAAGGAGAAGGAAGAGGG - Intergenic
902688989 1:18097900-18097922 GAGAAAGAGGAGGAGGTGTCAGG - Intergenic
902778921 1:18692199-18692221 AAGAAAAGGAAGAAGGTGGAAGG + Intronic
902991634 1:20191597-20191619 GAGAGAATGGAACAGCTGGAAGG - Exonic
903004772 1:20291418-20291440 GAGAAGAGGGAGCAGGAGAAGGG - Intronic
903116607 1:21183497-21183519 GAGAAAAAAAAGGAGGTGGCGGG + Intergenic
903389922 1:22956389-22956411 GAGAAAGAGGAGGAGGAGGAAGG + Intronic
903426194 1:23256233-23256255 GAGAAAAAAGGGCTGGGGGAAGG - Intergenic
903873089 1:26451360-26451382 AAGAAAAATGAGGAGTTGGATGG - Intronic
903929734 1:26855292-26855314 GAGAAAAGGAAGAAGGTGCAGGG + Exonic
903959885 1:27050227-27050249 CAGATACAGGAGAAGGTGGAGGG + Intergenic
904308906 1:29612559-29612581 AAGAAGAAAGAGAAGGTGGAAGG - Intergenic
904371494 1:30050296-30050318 GAGAAAGAGGGGTAGGAGGAAGG + Intergenic
904626089 1:31803816-31803838 GAGAAGAAGGAGGAGGAGGAGGG + Intronic
904933925 1:34113042-34113064 GAGAAAAAGAAGGACATGGATGG + Intronic
904953170 1:34260791-34260813 AAGAAAAAGGAGAAGGAGAAAGG + Intergenic
905015418 1:34774988-34775010 GAGAAGAAAGAGCAAGTGCAGGG + Intronic
905244908 1:36606049-36606071 GAGACAGAGAAGCAGATGGAAGG + Intergenic
905258786 1:36703088-36703110 GAGAAAGAGGAGGAGGTGCCAGG + Intergenic
905545233 1:38792576-38792598 CAAAAACAGGAGCAGGTGAAGGG + Intergenic
905908071 1:41633003-41633025 AGGAGAAAGGATCAGGTGGAAGG + Intronic
905940084 1:41856294-41856316 GAAAAGAAGGAGCAGATGGGTGG + Intronic
905980565 1:42222007-42222029 GAGGAGAAGGAGAAGGGGGAGGG + Intronic
906191973 1:43904758-43904780 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906191991 1:43904827-43904849 CAGGAATAGGAGCAGGAGGAGGG - Intronic
906192249 1:43905754-43905776 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192337 1:43906081-43906103 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192381 1:43906225-43906247 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906273924 1:44501940-44501962 GAGAAAAAGAAGGAGGAGGAAGG + Intronic
907231270 1:53001272-53001294 GAGAAAAAGGGAAAGGAGGATGG + Intronic
907633156 1:56105498-56105520 GAGACAGAGGAACAGGTGGTTGG + Intergenic
907703223 1:56810018-56810040 GAGAGAAAGAAGGAGGAGGAAGG + Intronic
907912791 1:58841488-58841510 GAGAAACAGGGACAAGTGGAAGG + Intergenic
908196059 1:61746443-61746465 GAGAAAAAGGAGCGAATGAAAGG + Intronic
908295972 1:62713443-62713465 AAGAAGAAAGAGAAGGTGGAAGG - Intergenic
908506163 1:64802366-64802388 TACAAAAGGGAGCAGGTGGGGGG - Intronic
908815783 1:68032344-68032366 GAAAAACAAGAGGAGGTGGAAGG + Intergenic
908896253 1:68903644-68903666 CACAGAAAGAAGCAGGTGGAAGG - Intergenic
909740476 1:79023649-79023671 GAGAAAAAGGAGCAGGTGAAAGG - Intergenic
909862792 1:80630134-80630156 GAGAAAAAGGAGCAGGTGAAAGG + Intergenic
909885281 1:80934399-80934421 GAGAAAGAGGAGGAAGAGGAGGG + Intergenic
910229177 1:84968715-84968737 GACAAGAAGGAGCAGGTTAAAGG - Intronic
910286120 1:85556141-85556163 GAGAAGGAGGAGAAGGAGGAAGG - Intronic
910549848 1:88463205-88463227 GGGAGAAAGGAGGAGGAGGAGGG - Intergenic
910837247 1:91527984-91528006 AAGAAAAAGGAGCAGGGCCAGGG + Intergenic
911013084 1:93302457-93302479 GAGAAAAAGGAAGAGGTCCAAGG - Intergenic
911729322 1:101276554-101276576 GAGAAGGTGGAGGAGGTGGAAGG - Intergenic
912052584 1:105548662-105548684 GAGAAAAAGGAAAAAGTAGAAGG + Intergenic
912228633 1:107766232-107766254 AAGAAGAAGGAGGAGGGGGAAGG - Intronic
912262397 1:108122519-108122541 GAGGAAAAGAAGCCGGTGGCAGG - Intergenic
912317760 1:108681749-108681771 GAGAAAAAGGAAAAAGTGGGAGG - Intergenic
912820348 1:112862814-112862836 GAGAAAAGGGAGCCCGTGAAAGG - Intergenic
913214778 1:116611037-116611059 AAGAATAAAGAGCAAGTGGAAGG - Intronic
913245905 1:116869735-116869757 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
913447508 1:118965315-118965337 GAAAAAATGGAGAAGTTGGAGGG + Intronic
913534239 1:119755990-119756012 GAGGAACAGGAGCAGGAAGATGG - Intronic
913565219 1:120066992-120067014 GAAAACAAGGAGCAAGAGGATGG + Intronic
913632911 1:120726567-120726589 GAAAACAAGGAGCAAGAGGATGG - Intergenic
914121092 1:144783186-144783208 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
914619724 1:149393570-149393592 GAAAACAAGGAGCAAGAGGATGG - Intergenic
914803665 1:150977301-150977323 GAGACAAAAGAGAAGGTGGATGG + Intergenic
914857275 1:151361980-151362002 GAAAAGAAGGAGGAGGAGGAAGG + Intergenic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
915035307 1:152918726-152918748 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
915115822 1:153598848-153598870 GAGAAAAAGCAGCCACTGGAGGG - Intergenic
915148093 1:153807391-153807413 GAGGGAAGGGAGGAGGTGGAAGG + Exonic
915271374 1:154756065-154756087 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
915782114 1:158563518-158563540 GACAAAGAGGAGCAGCTGGAGGG + Exonic
915951118 1:160190532-160190554 GAGGAATAGGAGCAGGGGGCGGG - Intergenic
915979884 1:160413697-160413719 GAGGAAAAGGAGCAGGCAAAGGG - Intronic
916023456 1:160814306-160814328 GAGAAAGAGGAAGAGGAGGAGGG + Intronic
916117549 1:161500056-161500078 GAGAAAAAAGAGCAGGGAAAGGG - Intergenic
916374681 1:164139452-164139474 AAGGAAAAGGGGCAGGTGGCTGG + Intergenic
916626808 1:166567111-166567133 GGGAAAAGAGAGAAGGTGGAAGG + Intergenic
916881664 1:169024696-169024718 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
916920331 1:169459922-169459944 AAAAAAAAGGAGGAGGCGGAGGG + Intronic
917164488 1:172097068-172097090 GAGAAGGGGGAGCAGGTGTAAGG + Intronic
917166145 1:172115373-172115395 GAGAAAGAGGAGAAGCAGGAGGG - Intronic
917443504 1:175087305-175087327 AAGAGAAAGGAGCAGGTAGCGGG + Intronic
917680792 1:177365071-177365093 GAGATGAAGGAATAGGTGGAAGG + Intergenic
918093210 1:181315054-181315076 GAGAAAGAGGAAAAGGTAGAGGG - Intergenic
918344913 1:183598631-183598653 GAGAAAGAAGAGCAGGGAGAGGG + Intergenic
918371364 1:183864761-183864783 TAGAGAAAGGAGCAGGTGGATGG + Intronic
919018961 1:192078489-192078511 GACAAATAGGAGTAGGGGGAAGG - Intergenic
919315081 1:195962320-195962342 AAAAAAAAGGAGCTGGTTGATGG - Intergenic
919492797 1:198226762-198226784 GAGAGAAAGAAGGAGGTGAAAGG - Intronic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
919759361 1:201087681-201087703 GAGAGAAGGGAGGAGGAGGAAGG - Intronic
919851925 1:201678838-201678860 GAGAAAAAGTCGAAGGAGGAAGG + Intronic
919866541 1:201787174-201787196 GAGAGGAAGCATCAGGTGGAGGG + Intronic
920517533 1:206597372-206597394 TAGGAAAAGCAGGAGGTGGAAGG + Intronic
920662797 1:207932098-207932120 AAGAAAAAGGATGAAGTGGAGGG - Intergenic
920700678 1:208216098-208216120 GAGAAAGAGCAGCAGGTGATGGG - Intronic
920737942 1:208552241-208552263 GAGAAAAGGAAGCAGAAGGAAGG - Intergenic
921137124 1:212271590-212271612 GACACAGAGGAGCAGCTGGAAGG - Intergenic
921179677 1:212622154-212622176 AAGCCAAAGGGGCAGGTGGAAGG - Intergenic
921219246 1:212961534-212961556 GAGAAAGAGGAGAAGATAGAAGG - Intronic
921259887 1:213376904-213376926 GAGAAGAAGAATGAGGTGGAGGG + Intergenic
921672250 1:217938504-217938526 GAGAAAAAGGAACAGAGAGAGGG - Intergenic
922006016 1:221531464-221531486 GAGAGAAGAGAGCAGGGGGAGGG - Intergenic
922174739 1:223188735-223188757 GAGATAAAGAAGGAGGAGGAAGG + Intergenic
922247740 1:223817229-223817251 GAGAGAAAGGATGAGGGGGAGGG + Intronic
922247748 1:223817247-223817269 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247756 1:223817265-223817287 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247764 1:223817283-223817305 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247772 1:223817301-223817323 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247780 1:223817319-223817341 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247788 1:223817337-223817359 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247796 1:223817355-223817377 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247804 1:223817373-223817395 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922333321 1:224597239-224597261 GTAAAAAAGGAGCAGGTGAAAGG - Intronic
922520100 1:226242790-226242812 GAGGAGAAGGAGGAAGTGGAGGG - Intronic
922841526 1:228646847-228646869 GAGAGCAAGGAGAAGATGGATGG + Intergenic
922909666 1:229205009-229205031 GAGAGGAAGGAGTGGGTGGAGGG + Intergenic
922984372 1:229854692-229854714 GGGAAAAGTGAGCAGATGGATGG - Intergenic
923072356 1:230577598-230577620 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
923517732 1:234711607-234711629 GGGAAGAAGGAGGAGGAGGATGG - Intergenic
923650958 1:235873037-235873059 GAGAAAGAGAAGCAGGAGAAAGG + Intronic
924078672 1:240369143-240369165 TAGAAAAGGCAGGAGGTGGAGGG - Intronic
924538337 1:244957726-244957748 GGGAAGAGGGAGCAGGGGGAGGG - Intergenic
924551348 1:245080902-245080924 GAGTACAAGGAGCAGGGAGAAGG - Intronic
924608669 1:245556299-245556321 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
924817276 1:247453652-247453674 GAGAAAAGGGAGAAGTTGTAGGG + Intergenic
1062806472 10:423819-423841 GAGGAAAACGGGGAGGTGGAGGG - Intronic
1062833467 10:621566-621588 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1062879422 10:966156-966178 GAGAAAAAGAAGAAGGAGGCTGG + Intergenic
1063281676 10:4636488-4636510 GAGAAAGAGGAGCAGAAGCAAGG - Intergenic
1063355583 10:5395524-5395546 GAGGACTAGCAGCAGGTGGACGG - Intronic
1063438560 10:6054033-6054055 GAGGAAGAGGAACGGGTGGAGGG - Intronic
1063621037 10:7649314-7649336 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1064784639 10:18880532-18880554 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1064979135 10:21148834-21148856 GAGAAAAAGGAGCAGACAAAAGG - Intronic
1064985172 10:21202759-21202781 AAGAAAAATTAGAAGGTGGAAGG - Intergenic
1065140390 10:22714132-22714154 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1065467978 10:26045688-26045710 GAGCAAAAGGAGCAGATGAAAGG - Intronic
1065550414 10:26863804-26863826 GAGGAACAGGAGTAGGAGGAAGG + Intergenic
1065664337 10:28041725-28041747 GACAGCAAGGAGGAGGTGGAAGG + Intergenic
1065768442 10:29053912-29053934 GAGAACAAGAAGCAGGTGAGAGG + Intergenic
1065790301 10:29254351-29254373 GAGGAAGAGGAGGAGGAGGATGG + Intergenic
1065839297 10:29687712-29687734 TAGAAAAAGGGGCAGGTAGGTGG - Intronic
1065973684 10:30824502-30824524 CAGAAGAAGGAGGAGATGGAGGG - Intronic
1066264424 10:33761923-33761945 AAGAAAAAGGAGGAGGTGCCAGG - Intergenic
1066307248 10:34157474-34157496 GAGAAAAAGGTGCACATGGCTGG - Intronic
1067090693 10:43264636-43264658 GAGAAAAAGGGGGAAGGGGAGGG + Intronic
1067327095 10:45279848-45279870 GAAAATAATGAGCAGGAGGAAGG + Intergenic
1067402364 10:45988429-45988451 GAGAAAAGGGAGTAGGTGAAAGG + Intronic
1067572131 10:47379435-47379457 AATAAGAAGGAGCAGGAGGATGG + Intronic
1067870714 10:49958062-49958084 GAGAAAAGGGAGCAGGTGAAAGG + Intronic
1068206285 10:53859021-53859043 GAAAAAAAGGAGGAGAGGGAAGG - Intronic
1068262457 10:54600249-54600271 GAGAAAGAGGAGAAAGTGGGAGG + Intronic
1068680699 10:59816963-59816985 GGCAAAAAGGAGGAGGTGCAGGG + Intronic
1068697223 10:59980544-59980566 GAGGAAAAGGAGGTTGTGGAGGG + Intergenic
1069145020 10:64880812-64880834 AAGAAAAAGCAGAATGTGGAAGG + Intergenic
1069274031 10:66567050-66567072 GAGAAAGAGGGGAAGGGGGAGGG + Intronic
1069668738 10:70183598-70183620 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1069854375 10:71431739-71431761 GAGAGAATAGAGCAGGGGGAAGG - Intronic
1069893206 10:71664812-71664834 GAGAGAAGGGAGGAGGGGGAAGG - Intronic
1069974022 10:72198178-72198200 GAGGGAAGGGAGCAGATGGAAGG + Intronic
1069974039 10:72198221-72198243 GAGGGAAGGGAGCAGATGGAAGG + Intronic
1069974057 10:72198269-72198291 GAGGGAAGGGAGCAGATGGAAGG + Intronic
1070326122 10:75390395-75390417 GAGAAAAAGGAAGAGGAGGAGGG - Intergenic
1070332598 10:75429116-75429138 AAGAACAAGGAGAAGGAGGAGGG - Intergenic
1070457889 10:76634955-76634977 TAGTAAAAGGAACAGTTGGAGGG + Intergenic
1070483610 10:76909507-76909529 GAGACAAGGGTGCAGGAGGATGG - Intronic
1070637092 10:78137709-78137731 GAGAAAGAGGAGAAAGAGGAAGG - Intergenic
1071400885 10:85269549-85269571 GAGAGAGAGGAGGAGGTGGCAGG + Intergenic
1071503931 10:86221879-86221901 GAGAAGGAGGAGGAGGGGGAGGG - Intronic
1071535440 10:86425125-86425147 GATAAAAAGGAGCTGGTTAATGG + Intergenic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1072479572 10:95797659-95797681 GAGAGAAAGGAGGAGGTGCCAGG + Intronic
1072639584 10:97201871-97201893 AAGAGGAGGGAGCAGGTGGAGGG - Intronic
1072667696 10:97406273-97406295 GAGAAAAGGGAACTGGTGGCTGG + Intronic
1072774272 10:98173698-98173720 GGGAAAAAAGAGTAGGGGGAGGG - Intronic
1072785000 10:98273404-98273426 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1072811710 10:98467506-98467528 GAGAGAAAGGAGGAGGGGCAGGG + Intronic
1072847852 10:98852288-98852310 CAGAAAAGGTAGCAGGTGAAAGG - Intronic
1073007153 10:100333259-100333281 GAGAAAACAGAGGAGGGGGAAGG + Intergenic
1073513887 10:104060360-104060382 GAGAAGAAAGAGAAGGAGGAGGG + Intronic
1073771130 10:106736957-106736979 GACAAAATGCAGCACGTGGAGGG - Intronic
1074353857 10:112763995-112764017 GAGAAAAAGAGAGAGGTGGAAGG + Intronic
1074538108 10:114343470-114343492 GAGACAAAGGAGCAGGGGTGAGG - Intronic
1074652848 10:115544297-115544319 GCAAAAAAGGAGCCAGTGGAAGG + Intronic
1074691141 10:116005100-116005122 GAGAAAGAGGAGGAGGAGGAAGG - Intergenic
1074776800 10:116773136-116773158 GAGGAAAAGGAGTGGGAGGAAGG - Intergenic
1075049898 10:119175731-119175753 GGGAAAGAGGAGCAGGAGGAAGG + Intronic
1075247615 10:120837741-120837763 GACAAAAGGGAGGAGGTGGCAGG + Intergenic
1075305744 10:121365811-121365833 GAGCCAAAGGAGCAGGGGGTGGG - Intergenic
1075969623 10:126641472-126641494 GGGAAAAAGGAGCGGGCGGATGG - Intronic
1076099153 10:127760354-127760376 GAGAAAAAGGACAATGTTGAAGG - Intergenic
1076114608 10:127886585-127886607 GAGAGAAAAGGGCAGGAGGAGGG + Intronic
1076318943 10:129564383-129564405 GAGAAGGAGGAGGAGGGGGAGGG - Intronic
1076599161 10:131645954-131645976 GAGGAAAAGGAGCAGGTGGAGGG - Intergenic
1076659997 10:132049330-132049352 AAGAAAGAGGAGGAAGTGGAAGG - Intergenic
1077086092 11:751985-752007 GAGAGAAAGGAACAGGTGAAAGG - Intronic
1077150767 11:1072172-1072194 GAGGGAAAGGAGGAGGAGGAAGG - Intergenic
1077294821 11:1821334-1821356 GGCAAAATGGAGTAGGTGGATGG + Intergenic
1077423039 11:2461847-2461869 GAGAGAAAGGGGTGGGTGGACGG + Intronic
1077523596 11:3050695-3050717 AAAAAAGAGCAGCAGGTGGAGGG - Intronic
1077924437 11:6666746-6666768 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1078048552 11:7940775-7940797 GAGAAAAAGCATAAGGAGGAAGG + Intergenic
1078099300 11:8320363-8320385 GAGAAAAAGAGAGAGGTGGAGGG + Intergenic
1078255626 11:9656101-9656123 AAGAAAAAGGAAAAGGTGGAGGG + Intergenic
1079303080 11:19296749-19296771 GACAAAGAGGAGAAGGAGGATGG + Intergenic
1079703936 11:23589047-23589069 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1080160529 11:29170030-29170052 GAAGAAAATGACCAGGTGGATGG - Intergenic
1080207019 11:29741559-29741581 GAGGAAAAGGAGGAAGTAGAAGG + Intergenic
1080550366 11:33369189-33369211 GAGAAAGAGGAAGAGGAGGAGGG - Intergenic
1080816557 11:35763351-35763373 GAGAGAAGAGAACAGGTGGAGGG + Intronic
1080997642 11:37623440-37623462 CACAAAAATGAGCATGTGGATGG - Intergenic
1081060590 11:38470566-38470588 AAGAAAAAGGAGGAGGGGAAGGG - Intergenic
1081230505 11:40580294-40580316 GAGAAAAATGAGCAAGAGTATGG + Intronic
1081752611 11:45522695-45522717 TAGGAGTAGGAGCAGGTGGAGGG + Intergenic
1082182216 11:49133480-49133502 AGTAAAAAGGAGCAGGAGGAGGG + Intergenic
1083231527 11:61324022-61324044 GAGAAGGAGGAACAGATGGATGG - Exonic
1083262359 11:61530206-61530228 AAGAGCAAGGCGCAGGTGGAAGG - Intronic
1083355709 11:62064536-62064558 GAGAAAAAGGAGCAGGTAAAAGG + Intergenic
1083573431 11:63772133-63772155 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1083573437 11:63772154-63772176 GGGAAGAAGGAGAAGGAGGAGGG + Intergenic
1083884634 11:65566418-65566440 GAGGGAAAGGAGGAGGGGGAGGG - Intergenic
1083893079 11:65606639-65606661 GAGAATAAGGAGCTGGGGGGCGG + Intronic
1084104869 11:66974969-66974991 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
1084208144 11:67607795-67607817 GAGCAAAAGGAGCTTATGGAAGG - Intronic
1084370210 11:68736784-68736806 GAGAACAAAGAGGAGGAGGAGGG + Intronic
1084737259 11:71113587-71113609 AAGAAACAGGAGCAAGGGGAAGG + Intronic
1084860508 11:72014930-72014952 GAGGCAAAGGAGAAGGTGGCAGG - Exonic
1084937156 11:72592989-72593011 GAGAGATGGGACCAGGTGGAAGG - Intronic
1085127046 11:74008918-74008940 GAGAACAAGGAGAAGGGAGAGGG + Intronic
1085128381 11:74017490-74017512 GAGAAAATGGAGCACGTGGAAGG + Intronic
1085227603 11:74936468-74936490 GAGACAAAGGAGCAGGTCAGGGG - Intronic
1086056117 11:82649068-82649090 GAGAAGAAGGAGCAGAAGAAAGG - Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086554309 11:88091064-88091086 AAGAAAAAGGACCAGGAGAAGGG + Intergenic
1086598182 11:88600238-88600260 GAGGAAGAGGAGGAGGAGGAAGG - Intronic
1086683290 11:89701466-89701488 AGTAAAAAGGAGCAGGAGGAGGG - Intergenic
1086827630 11:91519047-91519069 GAGAAAGAGGAGAAGGAGGAGGG + Intergenic
1086952596 11:92906235-92906257 GAGGAAAAGGAAGAGGAGGAGGG + Intergenic
1087432911 11:98076136-98076158 GAGAAAAAGAAGCGGGGAGAGGG - Intergenic
1087512419 11:99114462-99114484 GAAGAAAAGGAGAAGGAGGAAGG - Intronic
1087672848 11:101127893-101127915 AAGATAAAGGAGGAGGAGGAAGG - Exonic
1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG + Intergenic
1088838700 11:113603746-113603768 GAAAGAAAGGAGAAGCTGGAAGG + Intergenic
1089081378 11:115778870-115778892 GAGAAAATGAAGCAAGAGGAAGG - Intergenic
1089362318 11:117899181-117899203 GAGAAAAAGCAGGATCTGGATGG - Intergenic
1089445068 11:118545433-118545455 GAGGGAAAAGAGCAGATGGAGGG + Exonic
1089627312 11:119759619-119759641 GAGAAAATGGAGCAGGAAGAAGG + Intergenic
1089647693 11:119890905-119890927 GAGACCAAGAAGCAGGTGGGAGG + Intergenic
1089744593 11:120607867-120607889 GAGCAACTGGAGAAGGTGGAGGG + Intronic
1089876800 11:121730227-121730249 GAGAAGAAGGGACAGGAGGAGGG - Intergenic
1089910963 11:122100573-122100595 GAGAAAAAAGGGCAGTTGGGTGG + Intergenic
1089957539 11:122585646-122585668 GAGAAAAAGAGGCAGGAGGAAGG + Intergenic
1090166067 11:124548873-124548895 GAGAACACTGAGCAGCTGGAAGG - Intergenic
1090380239 11:126321410-126321432 GAGAAAGGGCAGCAGCTGGATGG - Intronic
1090761465 11:129840401-129840423 GAGAAAAATGAGGAAGTGCAGGG + Intronic
1090817651 11:130314005-130314027 GAGAAAAAGCAGAAGGGGAAAGG + Intronic
1090976841 11:131686514-131686536 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1091209171 11:133842118-133842140 GAGGAGAAGGGCCAGGTGGAGGG + Intronic
1091337143 11:134780705-134780727 GAGAAGAAGGAGAAAGAGGAGGG - Intergenic
1091392480 12:134071-134093 GAGTAAAAAGAGCATGTGTAGGG + Intronic
1091653415 12:2326152-2326174 GAGAAAAAGGAGGATGACGAGGG + Intronic
1091852031 12:3707132-3707154 CATATAAAGGGGCAGGTGGATGG + Intronic
1091976750 12:4831559-4831581 GAGAAAGCGGAGCTGGAGGATGG - Intronic
1091996304 12:4996785-4996807 GAGAAAAGGGAGGAGGAAGAGGG + Intergenic
1092041241 12:5386542-5386564 GAGGAAAAGGAGGAGGATGAAGG - Intergenic
1092071668 12:5636554-5636576 GAGAGAAAACAGCAGGTGGAAGG + Intronic
1092195488 12:6547414-6547436 AAGAAAAAGAAACAGGTGTAGGG + Intronic
1092322095 12:7487082-7487104 GAGAGAGAGGGGAAGGTGGATGG + Intronic
1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG + Intergenic
1092714368 12:11373293-11373315 AAGAGAAATGAGCAGGAGGAAGG + Intronic
1092774309 12:11929202-11929224 GGGATGAAGGAGCAGGGGGAGGG - Intergenic
1092829452 12:12429691-12429713 GAGAAAAAGGTGGAGGGTGAGGG - Intronic
1092964621 12:13629633-13629655 GAGAAGGAGGAGCAAGAGGAGGG - Intronic
1092966989 12:13653587-13653609 GAAAAAAAGGAGGAGTTGCAAGG + Intronic
1093025208 12:14239514-14239536 CAGAAAGAGGAGCAGGCGTAGGG + Intergenic
1093084579 12:14852466-14852488 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1093110262 12:15143780-15143802 GAGAAGAAAGAGGAGTTGGAGGG + Intronic
1093125396 12:15322563-15322585 GAGGAAAGGGAGCAGGCGCAGGG + Exonic
1093222153 12:16434642-16434664 AAGAAAAAAGTGCAGGTAGAAGG - Intronic
1093457072 12:19374985-19375007 GAGAAGGAGGAGGAGGAGGAAGG + Intronic
1093667543 12:21832366-21832388 GAAAGAAAGGAACAGATGGATGG + Intronic
1093971782 12:25382564-25382586 GAGAAGAAGGGGCATGAGGACGG + Intergenic
1094030326 12:26004711-26004733 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1094129893 12:27063500-27063522 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1094228923 12:28080655-28080677 GAGAGACAGGAGGAGGTGCAAGG - Intergenic
1094269058 12:28590986-28591008 GAGACAATGGATCAGGTGGAGGG - Intergenic
1094579862 12:31724684-31724706 GAGAAAAAGGTGGCGGTGGGGGG - Intronic
1095474712 12:42574045-42574067 GAGAAAAGGGAGCTGAGGGATGG + Intronic
1095655338 12:44661938-44661960 GAGAGAGAGGAGCAGGAGGGAGG - Intronic
1095977338 12:47948803-47948825 GAGAGAATGGAGCAGGTAGGAGG - Intergenic
1096023092 12:48338379-48338401 GGGAAAAAGGAGGTGGTGGCAGG + Exonic
1096199908 12:49674036-49674058 GAGGAAATGGAACAGATGGATGG + Intronic
1096528419 12:52228133-52228155 AAGAAGAAGGAGGAGGGGGAGGG - Intergenic
1096638281 12:52975036-52975058 GAGGAGAAGGAGCAGGGAGAGGG + Intergenic
1096701298 12:53384743-53384765 GAGAAGACGAGGCAGGTGGATGG + Intronic
1096737782 12:53669344-53669366 GTGAAAAAGAGGCAGGTAGAAGG + Intronic
1097032495 12:56099778-56099800 TAGAAAAAGGAGGAGTTGGCTGG + Intronic
1097349986 12:58538106-58538128 GAGAAGAAGGTGCATGTGGATGG + Intergenic
1097420203 12:59368341-59368363 GAGAAAGGGCAGCAGGAGGAAGG - Intergenic
1097641962 12:62192395-62192417 GAAAGAAAGGAGCGGGGGGAGGG + Exonic
1097938381 12:65278487-65278509 GAGAAGGAGGAGGAGGAGGACGG + Intergenic
1098035642 12:66299608-66299630 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1098159012 12:67630045-67630067 GAGAGAGAGGGGCAGGTGCAAGG + Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098450610 12:70614030-70614052 GAGGAAAAGGAGAAGGAGGAGGG + Intronic
1098495882 12:71135285-71135307 AAGAAGAAGGAGGAGGGGGAGGG + Intronic
1098504854 12:71237612-71237634 TAGAAAAAAGAGGAGGAGGAGGG - Intronic
1098574564 12:72026621-72026643 GAGAAGAAAGAGCAGGAGGAAGG - Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1098948169 12:76610607-76610629 GACAAAGAGGAGGAGGAGGAGGG + Intergenic
1099163849 12:79276968-79276990 GAGGAAGAGGAGGAGGAGGAGGG + Intronic
1099398439 12:82170982-82171004 AAGAAAAAGAAGGAGGAGGAGGG + Intergenic
1099439913 12:82687113-82687135 GAGAAAGAGGCGCGGGTGGGAGG - Exonic
1099580705 12:84443833-84443855 TAGAAAAAGGAGCAGGTGAAAGG - Intergenic
1099600261 12:84726571-84726593 GAGGAAAAGGAGGAAGAGGAGGG + Intergenic
1099965050 12:89437196-89437218 GTGAAAAAGGAGGGGTTGGAGGG - Intronic
1100237086 12:92672061-92672083 GAAAAAAAAGAGGAGGTGGCCGG - Intergenic
1100413330 12:94345540-94345562 GAGAAAAAGGCGCAGGTAAAAGG - Intronic
1100647229 12:96544460-96544482 GAGAAAAAGGAGCAGGAGAAAGG - Intronic
1100704605 12:97186521-97186543 GAGAAAGGGGAGCAGGAGAAAGG + Intergenic
1100963945 12:99992047-99992069 GAGAAAAAGGAGCAGGTGACAGG + Intergenic
1101086644 12:101243007-101243029 GGGAAAAAGCAGGGGGTGGAGGG + Intergenic
1101114508 12:101518820-101518842 AAGATAAAGGAGCAGGTAAAGGG + Intergenic
1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG + Intronic
1101840610 12:108325049-108325071 GAGGAAAAGGAGGAGGGAGAAGG + Intronic
1102330037 12:112021181-112021203 GAGAAAGGGGAGCATGTGGTAGG - Intronic
1102746235 12:115251366-115251388 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1102746249 12:115251457-115251479 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1102749148 12:115277179-115277201 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1102808101 12:115799714-115799736 GAGGAAGAGGAGGAGGGGGAGGG + Intergenic
1102823068 12:115924443-115924465 GAGAAGAAGAAGGAGGAGGAGGG + Intergenic
1102974966 12:117200150-117200172 GAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1103022639 12:117548324-117548346 GAGGAAAAGGAGGAAGAGGAGGG - Intronic
1103032945 12:117632520-117632542 TAGAAAAAGGAGTAGGTGGCAGG - Intronic
1103173090 12:118838778-118838800 GGGAAAAGGGGGAAGGTGGAAGG - Intergenic
1103235367 12:119368150-119368172 GAAAAGAAGGAGGAGGAGGAAGG + Intronic
1103235392 12:119368216-119368238 GAGGAAGAGGAGGAGGAGGAGGG + Intronic
1103309312 12:119991144-119991166 AAAAAAAAGGGGCAGGGGGATGG + Intronic
1103341568 12:120223871-120223893 GAGAAAAAGGAACAGGGGCCAGG + Intronic
1103434601 12:120915142-120915164 GAGAAAATGGAGGGGGTTGAGGG - Intergenic
1103686515 12:122736285-122736307 AAGAAAAAGGAGCTTGTGCAGGG - Intergenic
1103714318 12:122935169-122935191 CAAAAAAAAGAGCAGGTGGCAGG + Intronic
1103747247 12:123133658-123133680 GGGAAAGAGGAGGAGGTTGAAGG - Intronic
1103834429 12:123807726-123807748 GAGAAAGAGGAGGAGAGGGAGGG + Intronic
1103894581 12:124264588-124264610 AAAAAAAAGGAGGAAGTGGATGG - Intronic
1103917263 12:124382323-124382345 GAGAAAGCGGAGCAGATGCAGGG - Intronic
1104189158 12:126461569-126461591 CAGATAAAGGGGCAGGTGAATGG - Intergenic
1104310044 12:127646409-127646431 GAGAAGAAGAAGCAGGTGGAGGG + Intergenic
1104367507 12:128191408-128191430 GAGCAAGAGGAGGAAGTGGAGGG - Intergenic
1104520898 12:129474056-129474078 TACAGAAAGGAGCAGGTGAAAGG - Intronic
1104781260 12:131422026-131422048 GAGAAAAAGGAGGAGGGAGAAGG - Intergenic
1104956021 12:132466204-132466226 GAGGAAGAGGAGGAGGGGGACGG - Intergenic
1105577788 13:21669816-21669838 AACAAAGAGGAGCAGGGGGAGGG + Intergenic
1105595870 13:21837401-21837423 GAGAGAAAGGGGCAGGGGGAAGG - Intergenic
1105891847 13:24687718-24687740 GTGGAAAAGGAGCAGGCGTAAGG + Intronic
1106389962 13:29325504-29325526 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1106426256 13:29633208-29633230 TAGAAAGAGGAGCTGGTGGCTGG - Intergenic
1106538357 13:30667893-30667915 AAGAAAAAAGACCAGGAGGAAGG + Intergenic
1106653835 13:31721053-31721075 GAGAAAAAGGAGGAGGTGCCAGG - Intergenic
1106931491 13:34670581-34670603 GAGAAAAAAGAGGAGATGGGAGG + Intergenic
1107106620 13:36650040-36650062 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1107758489 13:43651246-43651268 AAGAAAAAGGAAGAGGGGGAGGG + Intronic
1107827500 13:44342030-44342052 GAGAACAAAAAGCAGGAGGAAGG + Intergenic
1107879706 13:44822305-44822327 GAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1108319210 13:49271277-49271299 GGGAAAAAAGAGCAGGAGGAAGG + Intronic
1108692584 13:52872624-52872646 AAGAAAAAGGAGCATGGAGATGG + Intergenic
1108813334 13:54258231-54258253 GAGAGAAAGAAGGAAGTGGAAGG - Intergenic
1108813819 13:54266823-54266845 GAGAAAAACCCACAGGTGGAGGG - Intergenic
1108910515 13:55545406-55545428 GAGAAAAAGGAGAAAATGGTAGG + Intergenic
1108983640 13:56554499-56554521 AAGAAAAATAAGAAGGTGGAGGG + Intergenic
1109555390 13:63968008-63968030 GAGAAAAAGGAGGAAGAAGAGGG - Intergenic
1109973130 13:69796444-69796466 GAGAGACAGGAGCAGGTGTCAGG - Intronic
1109993571 13:70091298-70091320 GAGAAAAAAGAGTTGGAGGAAGG - Intronic
1109998440 13:70162085-70162107 GAGAAAAAGGAAGAGATGGAGGG + Intergenic
1110346103 13:74449541-74449563 GAGAAAAACAAACACGTGGAAGG - Intergenic
1110398527 13:75062625-75062647 GAGAAGAAGGAGGAGAAGGAAGG + Intergenic
1110495512 13:76163239-76163261 GGAAAAAAGGAGCAGGAGGGAGG + Intergenic
1110754173 13:79152297-79152319 GAGAAAAAGGAGGAGGGTGGTGG - Intergenic
1110807528 13:79774356-79774378 GAGGAAAAGGAGGAAGAGGAGGG + Intergenic
1111353791 13:87070318-87070340 GAGAAGAAGGAGAAGGGGAAGGG - Intergenic
1111622851 13:90746719-90746741 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
1112004096 13:95239282-95239304 GAGAAAAAAGAACAGATGAAGGG + Intronic
1112404611 13:99107889-99107911 GAGAAAGAGGAAAAGGAGGAAGG + Intergenic
1112495165 13:99898351-99898373 GTTAAAAAGGGGCAGGGGGATGG + Intergenic
1112722466 13:102260131-102260153 GAAAAAAAGAAGCGGGAGGAGGG + Intronic
1112826257 13:103395864-103395886 GATAAAAAGGAGCAGGGGAGAGG + Intergenic
1113059250 13:106303501-106303523 CAGAAGACTGAGCAGGTGGAGGG + Intergenic
1113241273 13:108340322-108340344 AAGCAAAAGCAGGAGGTGGAAGG + Intergenic
1113904634 13:113813471-113813493 GAGAAAAAAGATAAGGTGGAGGG + Exonic
1113909679 13:113836254-113836276 GAGGAAGAGGAGGAGGAGGAGGG + Intronic
1114316465 14:21514355-21514377 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
1114525388 14:23364771-23364793 AAGAAAAAGGAGAATGGGGAGGG + Intronic
1114820474 14:26012092-26012114 GAGAAAAATAAGAAGATGGATGG + Intergenic
1115074783 14:29374918-29374940 GTGAAAAAGAAGCAGGTAGCAGG - Intergenic
1115275594 14:31605788-31605810 GAGGAAGAGGAGGAGGAGGAAGG - Intronic
1115659133 14:35474601-35474623 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1117243064 14:53854992-53855014 GAGATAAAGGAGTGGGTGGAGGG + Intergenic
1117553334 14:56858110-56858132 GAGAGAAAGAAGGAGGAGGAGGG + Intergenic
1117667841 14:58076076-58076098 GAGAAAGAGGAGGAAGGGGAGGG + Intronic
1118110423 14:62712054-62712076 GAGAAGCAGGTGCAGGAGGAAGG + Intronic
1118205599 14:63720324-63720346 GAGAAAAAGGAAAAGAAGGATGG + Intronic
1118626080 14:67660578-67660600 CAGAAAGAGGAGCAGGAGAAGGG - Intronic
1118656244 14:67952706-67952728 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1118882463 14:69841213-69841235 GAGAAAGAGGAGCCAGTGAAAGG - Intergenic
1119278250 14:73380365-73380387 CAGAAGGAGGAGCAGGTTGAAGG + Intronic
1119319508 14:73721361-73721383 GAGAAGGAGGAGCAGGAAGAGGG - Exonic
1119484287 14:74978005-74978027 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1119706381 14:76785102-76785124 GAGAATGAAGAGCAGGTGGATGG + Intergenic
1119809574 14:77505480-77505502 GAGAAAACTGAGGACGTGGAGGG - Intergenic
1119918531 14:78425272-78425294 GAGAAGAGGGAGCATGTGGAAGG + Intronic
1119956238 14:78801466-78801488 GAGAGAAAAGAGCATGTGAAGGG + Intronic
1120120189 14:80669684-80669706 GAGAAAAAGGAGCTTTTGGTAGG + Intronic
1120163257 14:81168131-81168153 GAGAAAAAGGAGCAGGTGCAAGG - Intergenic
1120188921 14:81422278-81422300 GAGAAAAAGGAGGAGGTGCCAGG - Intronic
1120227592 14:81808602-81808624 GAGAGAAAGGAGGAAGTAGAAGG - Intergenic
1120897629 14:89547990-89548012 GAGAGAAAGTAGGAGGTGGAAGG + Intronic
1121085011 14:91139251-91139273 GAGAACAAGGAGGAGGAGGAAGG - Intronic
1121557361 14:94848539-94848561 GAGAAAATGGAGCAGGAGAGTGG + Intergenic
1121655975 14:95595959-95595981 GAGAAAATGGAGCAGAGGCAGGG + Intergenic
1121657089 14:95605074-95605096 GAAAAAAAGGGGCAGGGGGAAGG - Intergenic
1121787705 14:96674837-96674859 GAGACAAAGGAGGAGTGGGAGGG - Intergenic
1122082414 14:99274709-99274731 GAGGAAAAGGGGGAGGAGGAGGG - Intergenic
1122357156 14:101130130-101130152 GAGACAAGGGAGGAGGTGGCAGG + Intergenic
1122878041 14:104677835-104677857 GAGGAAGGGGAGGAGGTGGAAGG - Intergenic
1123022665 14:105408958-105408980 GAGGAGGAGGAGCAGGAGGAGGG - Intronic
1123221422 14:106860397-106860419 GAGAAAAAGGAGGAGGGGTTGGG - Intergenic
1123477318 15:20598996-20599018 GAGGAAGAGGAGCAGCAGGAAGG - Intergenic
1123640698 15:22401386-22401408 GAGGAAGAGGAGCAGCAGGAAGG + Intergenic
1123899147 15:24858863-24858885 GAGAAAAAGGAAAAGGGGGTGGG - Intronic
1124097813 15:26665599-26665621 CAGAAAAAGGAGCTGGTGTCAGG + Intronic
1124459631 15:29877610-29877632 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1125024817 15:35019525-35019547 GAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1125052774 15:35320713-35320735 AAGAAATAGGATAAGGTGGATGG - Intronic
1125547265 15:40515243-40515265 GAGAAGTAGCAGCAGGGGGAGGG - Intergenic
1125891060 15:43267605-43267627 GGGAGAAAAGCGCAGGTGGAAGG + Intergenic
1126052308 15:44697158-44697180 GAGGAGAAGGAGGAGGAGGAAGG - Intronic
1126540051 15:49812544-49812566 GAGAAAAAGAAGGAAGAGGAGGG - Intergenic
1126567659 15:50116392-50116414 GAAAAGGAGGAGAAGGTGGAGGG + Intronic
1126711714 15:51464783-51464805 GAGAAAATGGATCAGTTTGAAGG - Exonic
1126764161 15:51996690-51996712 AAGAAGAAGGAGGAGGAGGACGG - Intronic
1126921429 15:53529942-53529964 GAGGAAATGTAGCAGGAGGAAGG - Intronic
1126950718 15:53877591-53877613 GAGAATAGGGAGGAGGAGGAGGG + Intergenic
1127054814 15:55120862-55120884 GAGAAGCAGGAGCAGGTTGTTGG - Intergenic
1127260631 15:57324054-57324076 GAGAAAAGGGAGGAGGAGAAAGG + Intergenic
1128513209 15:68326356-68326378 GAGAACTAGGAGCAGCTGGTGGG - Intronic
1128558269 15:68646385-68646407 GAGGAAGAGGTGCATGTGGAAGG + Intronic
1128721141 15:69949325-69949347 GAGGAAAAGGAGGAGGTGCGGGG - Intergenic
1128987838 15:72234266-72234288 GGGGAAAAGGAACAGGTGAAAGG - Intergenic
1129174086 15:73827406-73827428 GAGATAAAGGAGATGGTGGGAGG - Intergenic
1129498040 15:76005821-76005843 GAGAAAGAGGAGGAGTTGGCAGG + Intronic
1129683436 15:77671291-77671313 GAGAAGAGGGAGAAGGTAGAGGG + Intronic
1129765037 15:78159291-78159313 AAGAAAAAGGAGGAGGGGGTAGG - Intronic
1130226006 15:82058867-82058889 GAGAGGAAGGAGAAGGGGGAAGG - Intergenic
1130686532 15:86042460-86042482 GAGAAAAAGGACAAGGTGTCTGG - Intergenic
1130747203 15:86668036-86668058 GAGAGAGAGGAGCAGGTGCCAGG + Intronic
1130748909 15:86688255-86688277 GAGAAAGAGGAGGAGGAGAAGGG + Intronic
1130883046 15:88071324-88071346 GAGCACAAGCTGCAGGTGGAGGG + Intronic
1131139823 15:89968109-89968131 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1131279577 15:91009692-91009714 GAAAAGAAGGAGCTGGTGGTGGG + Intronic
1131312606 15:91304566-91304588 GAGAAAAAGAGGGAGGAGGAAGG + Intergenic
1131413245 15:92228892-92228914 GAGAAACAGAACCAGCTGGATGG + Intergenic
1131430147 15:92380754-92380776 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1131552878 15:93373061-93373083 GAGCAAGAGAAGCGGGTGGAGGG + Intergenic
1131646455 15:94350166-94350188 GAGAAAAAGCAGGAGATGTAAGG + Intronic
1131800147 15:96060007-96060029 GAGTACCAGGAGCAGGTGAAGGG + Intergenic
1133392737 16:5422708-5422730 GAGAAAGAGGAGGAGGGAGAGGG + Intergenic
1133392761 16:5422795-5422817 AAGAAAGAGGAGGAGGAGGAGGG + Intergenic
1133460674 16:5983927-5983949 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1133673856 16:8050913-8050935 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1133725579 16:8534420-8534442 GAGAAGTGGGAGCAGGTGGAGGG + Intergenic
1133898246 16:9949517-9949539 GAGAAAAATGAACAGATGGATGG + Intronic
1134375236 16:13665981-13666003 GAGAAAAACGAGGGGGAGGAAGG + Intergenic
1134523569 16:14928961-14928983 GAAGAAGAGGAGCAGGGGGAAGG - Intronic
1135059000 16:19255138-19255160 GAGACTCAGGAGCAGGTGGGAGG - Intronic
1135229192 16:20689706-20689728 AAGTAAAAGGAGGAGGTGAATGG - Intronic
1135232064 16:20717865-20717887 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
1135271498 16:21073637-21073659 AAGATAAAGGAGCAGGAGAAAGG - Intronic
1135727543 16:24868814-24868836 GAAAAAGAGGAGGAGGAGGAAGG - Intronic
1135934800 16:26770611-26770633 GAGGAAAAGGAGAAGAGGGAAGG + Intergenic
1135942452 16:26834310-26834332 GAGAAGAAGAAGGAGGGGGAGGG + Intergenic
1136003222 16:27311974-27311996 CAGAAAAACATGCAGGTGGAAGG - Intergenic
1136404585 16:30036782-30036804 GGGAAATAAGAGCAGGTGCAGGG + Intronic
1136423409 16:30151995-30152017 GAGAAAAAGAAGCAGGTGAAAGG + Intergenic
1137350703 16:47711914-47711936 GATAAAAAGGTAGAGGTGGAGGG - Intergenic
1137499226 16:48997694-48997716 GAGGAAAGGAAGCAGGGGGAGGG - Intergenic
1137507376 16:49065878-49065900 TAGAAAAAAGAGCAGGTGGAAGG - Intergenic
1137556975 16:49477040-49477062 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1137556991 16:49477122-49477144 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1137557129 16:49477565-49477587 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1137557150 16:49477671-49477693 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1137557161 16:49477739-49477761 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1137589023 16:49682208-49682230 GAGAAAAAGGGGCAGGAGGAAGG - Intronic
1137783374 16:51116312-51116334 GGGAAAAAGGAGAAGGGGGCTGG - Intergenic
1138050871 16:53776010-53776032 GGGAAAAAGGGGATGGTGGAGGG + Intronic
1138266518 16:55663779-55663801 GAGATAAGGGAGCAGATGGAAGG - Intronic
1138364498 16:56463085-56463107 GAGAAGAGGGAGCAGGGAGAAGG - Intronic
1138396589 16:56709343-56709365 GAGACAAAGGGAAAGGTGGAGGG + Intronic
1138609736 16:58113321-58113343 GGGGAAGAGGAGGAGGTGGAGGG + Intergenic
1138618621 16:58193795-58193817 GAGAAAAAGGAGGAGGAAAATGG - Intronic
1138670689 16:58611900-58611922 GAGAAAAAGAAGTAGGTGTGAGG - Intronic
1139800087 16:69515452-69515474 GAGAAAAAGGGGCAGGAGATAGG - Intergenic
1140024277 16:71270258-71270280 GAGGAAGAGGAGGAGGAGGAAGG + Intergenic
1140139407 16:72240965-72240987 GTGGCAAAGGTGCAGGTGGAGGG + Intergenic
1140244799 16:73238423-73238445 GAGAAAAAGAAGAGGGTGAAGGG - Intergenic
1140858836 16:79001649-79001671 AAAAAAAAGGAGCTGGTGGCAGG + Intronic
1140872784 16:79122272-79122294 AAGAAAAGGGAGGAGGTGGGAGG + Intronic
1140973203 16:80033349-80033371 GAGAAAAAGGGGAAAGAGGAAGG + Intergenic
1141007121 16:80363056-80363078 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1141046941 16:80723860-80723882 GAGAAAGAGGAGGAAGAGGAAGG + Intronic
1141065878 16:80913266-80913288 GATGGAAAAGAGCAGGTGGATGG + Intergenic
1141230951 16:82167247-82167269 AAGAAAAAGAAGGATGTGGATGG - Intronic
1141522027 16:84586979-84587001 GAGGAAAGGGAGCAGAGGGAGGG - Intronic
1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG + Exonic
1142882841 17:2894880-2894902 GAGAGAACGGAGCGGCTGGAAGG - Intronic
1143035221 17:3991298-3991320 GAGAAAGAGGAGGAGGAGGCCGG - Intergenic
1143138055 17:4723131-4723153 GAGGTCAAGGAGCAGGTGCACGG - Intergenic
1143193781 17:5059804-5059826 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1143276125 17:5712226-5712248 GAGACAGATGAGCAGGAGGAGGG + Intergenic
1143361128 17:6372189-6372211 GAGAAGAAGCAGCAGGAGGGAGG + Intergenic
1143391543 17:6561692-6561714 GAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1143577245 17:7801451-7801473 GAGATACAGGAGCAAGGGGATGG + Intronic
1143795144 17:9330237-9330259 GAGAATAAAGAACAGTTGGAAGG - Intronic
1143953992 17:10654807-10654829 AAGCACAAGGACCAGGTGGAGGG + Intronic
1145042881 17:19589913-19589935 GAGAAACAAGAGCCGGGGGAAGG - Intergenic
1145208456 17:20996726-20996748 GAGGAAGAGGTGCAGGAGGAAGG - Intergenic
1145221625 17:21094204-21094226 GAGAAAGAGGAGGAGGGAGAGGG + Intergenic
1145262420 17:21362432-21362454 CAGATAAAGGAGAAGATGGATGG + Intergenic
1145760283 17:27421645-27421667 GAGATGAAAGAGCAAGTGGATGG + Intergenic
1145769101 17:27479564-27479586 GAGCAAAGAAAGCAGGTGGAGGG - Intronic
1145798769 17:27670681-27670703 GAGATGAAAGAGCAAGTGGATGG - Intergenic
1146603102 17:34235486-34235508 TGGAAAAGGGAGCAGGTGGGAGG - Intergenic
1146607220 17:34271032-34271054 GAAAGAAAGGAAGAGGTGGAGGG - Intronic
1146632216 17:34478976-34478998 GAGCAAAAGAAGCAGCTGAAAGG + Intergenic
1146635384 17:34500340-34500362 GAGAAAACAGAGCAGGATGAGGG - Intergenic
1146651441 17:34609293-34609315 GAGAAAAAGGATGAGATGGACGG + Intronic
1146768759 17:35548805-35548827 GAGGAAACTGAGCAGATGGAGGG + Exonic
1146883601 17:36456969-36456991 GAGACGAACGAGCAAGTGGATGG - Intergenic
1146947232 17:36882155-36882177 GAGACAAAAGAGCAGGTGGAGGG - Intergenic
1147200907 17:38800196-38800218 GAGAACAGGCAGCAGGTGGGTGG - Intergenic
1147319014 17:39634897-39634919 CAGGAAAAGCAGCAGGTGGCTGG + Intronic
1147328016 17:39679239-39679261 GAGAAAAAGCAGCAGATGGCCGG - Intronic
1147879254 17:43643392-43643414 AAGAAAAAGGAGAAGGTCCAGGG + Intronic
1147882414 17:43662711-43662733 GAGAAAGGGAAGCAGGTGGGTGG - Intergenic
1148097824 17:45066006-45066028 GAAAAAAAGGGGCAGGAGGCTGG - Intronic
1148435253 17:47679220-47679242 GAGAAAAAGAAGCAGAGGGCTGG - Intronic
1148695932 17:49558281-49558303 GAGGAAAAGGGGCAGGAGCAGGG - Intergenic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1149114172 17:53071751-53071773 GAGGAAGAGGAGGAGGAGGAGGG + Intergenic
1149170276 17:53801384-53801406 GAGAGAAAGGGGGAGGAGGAAGG + Intergenic
1149273160 17:55004713-55004735 GAGAAGGAGGAGGAGGGGGAAGG + Intronic
1149447395 17:56724275-56724297 GGGAAGGAGGAGGAGGTGGAAGG - Intergenic
1149578304 17:57729247-57729269 GAAGAGAAGGAACAGGTGGAAGG - Intergenic
1149812789 17:59693691-59693713 AACAAAAAGGAGCAGGGGGCAGG - Intronic
1149926358 17:60705958-60705980 GAGGAGATGGAGGAGGTGGAAGG - Intronic
1150089440 17:62310017-62310039 GAGGAGGAGGAGCAGGAGGAAGG - Intergenic
1150150897 17:62808223-62808245 GAGGAAGAGGGGCAGGTGTAGGG - Exonic
1150428931 17:65100603-65100625 GAGGGAGAGGAGGAGGTGGAGGG - Intergenic
1150643098 17:66962875-66962897 GAGGAAGAGGAGGAGGAGGAGGG + Intergenic
1151251033 17:72835395-72835417 GGGGAAGAGGAGGAGGTGGAGGG + Intronic
1151383907 17:73743723-73743745 GAGAAAGAAGAGGAGGAGGAGGG - Intergenic
1151383918 17:73743768-73743790 GAGGAAGAGGAGCGGGAGGAAGG - Intergenic
1151418488 17:73982298-73982320 GAGAAGAGGGAGCAAGGGGAGGG + Intergenic
1152297549 17:79476942-79476964 GAAGAAAAGGAGGAGGAGGAAGG + Intronic
1152346602 17:79756296-79756318 GAAAAATAAAAGCAGGTGGAGGG - Intergenic
1152598362 17:81249221-81249243 GAGAAAGAGGAGGAGGGAGAAGG + Intronic
1152837526 17:82543584-82543606 GAGAAACCGGAGCAGTAGGAAGG + Intronic
1152863805 17:82710517-82710539 GAGGACAAGAAGGAGGTGGACGG + Intergenic
1152928375 17:83098228-83098250 GAGGGAAAAGGGCAGGTGGAGGG - Intergenic
1152945931 17:83197318-83197340 CAGAAAAAGCAGCAGGCGGTTGG + Intergenic
1153185227 18:2478801-2478823 GAGAAAGAGGAGGAGGAAGAAGG + Intergenic
1154032520 18:10766224-10766246 GAGGAACAGGAGGAGGAGGAGGG + Intronic
1154132603 18:11750242-11750264 CTGAGAAAGGAGCAGGTAGAAGG + Intronic
1154172926 18:12063780-12063802 TAGAGAAGGGAGCAGGTGGCCGG + Intergenic
1154374033 18:13794070-13794092 GAGCAAGAGGAGCAGGTGGACGG - Intergenic
1154989182 18:21583997-21584019 GAGAAAAAGGAGATGGTGGAAGG + Intronic
1155066654 18:22274124-22274146 GAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1155168281 18:23248390-23248412 AAGAAAGAGGAGCCGGTGCAGGG + Intronic
1155910286 18:31498028-31498050 GAGAAAATGGAGCCGGGGGCCGG - Exonic
1156791769 18:40984132-40984154 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1156985302 18:43343937-43343959 GTGAAAAATGAGTAGGTAGAAGG - Intergenic
1157138404 18:45081682-45081704 GAGAAATAAGAGCTGGAGGAAGG - Intergenic
1157199752 18:45650021-45650043 CAGAAAAAGGAAGAGATGGAGGG - Intronic
1157326098 18:46669701-46669723 AAGAAAAAAGGGCAGGTGGTGGG - Intronic
1157556306 18:48615316-48615338 GAGAAGAAGGAGCAGAGAGAGGG - Intronic
1157618744 18:49003258-49003280 GGGAAAATGGAGGAGGGGGAAGG - Intergenic
1157775350 18:50390682-50390704 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
1158098036 18:53797255-53797277 GAGAAACAGGTGTTGGTGGAAGG + Intergenic
1159517675 18:69478401-69478423 GAGAAAAAGGAGGAGAAGGAAGG - Intronic
1159841872 18:73407560-73407582 GAGATAAAGGAGAACATGGAAGG - Intergenic
1160769158 19:822464-822486 GAGACAAAAGAGCTGGGGGAGGG + Intergenic
1160845622 19:1164803-1164825 GAGGAGGAGGAGCAGGAGGAGGG + Intronic
1160859388 19:1231209-1231231 GAGAGCACGGAGCAGGAGGAGGG - Exonic
1161287939 19:3478484-3478506 GAGATAAAGGGAAAGGTGGAAGG + Intronic
1161370550 19:3908693-3908715 GAGAAAAGGGAGGAGGAGGGGGG - Intronic
1161478957 19:4501244-4501266 GAGGACAAGGAGCACGAGGAGGG + Exonic
1161513362 19:4683598-4683620 GAGATCGAGGACCAGGTGGAGGG - Exonic
1161515456 19:4693788-4693810 GAGAAAAAGCAGATGGTGCAGGG - Intronic
1161635117 19:5383652-5383674 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1161789256 19:6349235-6349257 GAGAAGCAGAGGCAGGTGGATGG + Intergenic
1162038175 19:7953557-7953579 GAGAAGGAGGAGGAGGGGGAAGG - Intergenic
1162124727 19:8493371-8493393 GAGAGGCAGGAGCAGCTGGAGGG - Intronic
1162176797 19:8836386-8836408 GAGGACAAGGAGGAGGAGGAAGG - Intronic
1162422716 19:10574962-10574984 GTGGAAAAGGAAGAGGTGGAGGG - Exonic
1162500499 19:11050797-11050819 GAGGGAAGGGTGCAGGTGGAGGG + Intronic
1162527169 19:11213053-11213075 GAGCATAATGAGCAGGAGGAGGG - Intronic
1162661781 19:12175131-12175153 GAGAAAAAAGAGCAAGTGAAAGG + Intronic
1162753682 19:12844287-12844309 TAGAAAAGGGAGCAGATGAAGGG - Intronic
1162968530 19:14166921-14166943 GAGAAGAAGGGGCCGGGGGAGGG + Intronic
1162974957 19:14203312-14203334 GGGAGAAAGGAGGGGGTGGAGGG + Intronic
1163041862 19:14608595-14608617 GAGAAAAAAGGGAGGGTGGAAGG + Intronic
1163229121 19:15988021-15988043 GAGAGAAAGGAGCAGAGAGAAGG - Intergenic
1163234794 19:16023948-16023970 GGAAAAAAGGTGCAGGAGGAAGG - Intergenic
1163387259 19:17007459-17007481 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1163468345 19:17482682-17482704 GAGAGAATGGAGCGGGAGGAGGG + Intronic
1163682487 19:18691210-18691232 AAGAAAAAGGAAAAGATGGAGGG + Intronic
1163713978 19:18863517-18863539 GAGCAGAAGGTGCTGGTGGAGGG + Exonic
1163834703 19:19566128-19566150 GAGAAAAAGGAGCTAGTCCATGG + Intronic
1163862353 19:19748902-19748924 GAAAAAGAGGTGCAGGAGGAAGG - Intergenic
1164211940 19:23106207-23106229 AAGAAAAAAGAGGAGGAGGAAGG + Intronic
1164292311 19:23879573-23879595 GAGAAAAAGGAGAGGGAGGTGGG + Intergenic
1164324425 19:24179474-24179496 GAGGAAGAGGAGCAGGAGGATGG + Intergenic
1164588304 19:29491501-29491523 GAGAGAAAGGAGGAGGTGCCAGG + Intergenic
1164592025 19:29512499-29512521 GAGAACAAGGATGAGGAGGAAGG + Intergenic
1164696574 19:30249337-30249359 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1164696578 19:30249343-30249365 GAGGAGAAGGAGGAGGGGGAGGG + Intronic
1164794293 19:31014015-31014037 GAGAAACAGGAGAAAGAGGAGGG + Intergenic
1164847289 19:31444228-31444250 AAGAAGAAGAAGAAGGTGGAAGG + Intergenic
1164854481 19:31510532-31510554 GACAGAGAGGAGCAGGTGGAGGG + Intergenic
1164858638 19:31544969-31544991 GAGAAAGAGAAGGAGGAGGAGGG - Intergenic
1164858646 19:31545021-31545043 GAGAAAGAGAAGAAGGAGGAGGG - Intergenic
1164883274 19:31754583-31754605 GAGAGCAAGGAGCAGGTGCCAGG + Intergenic
1164949790 19:32327468-32327490 GAGAAAACGGAGCTGAAGGAAGG + Intergenic
1165603956 19:37082958-37082980 GGAAGAAAGGAGCAGGTAGAGGG - Intronic
1165810213 19:38607573-38607595 AAAAAAAAGAAGAAGGTGGAAGG + Intronic
1165984765 19:39758347-39758369 GTGAAAATGGTGCAGGTGAAGGG + Intergenic
1166347964 19:42178047-42178069 GAGGAAAAGGAGAAGGGAGAGGG + Intronic
1166389078 19:42398936-42398958 GGAAAAGAGGAGCAGGTTGATGG + Intergenic
1166442251 19:42825145-42825167 GAGAAGAAAGAGGCGGTGGAGGG + Intronic
1166478976 19:43153412-43153434 GAGAAGAAAGAGGCGGTGGAGGG + Intronic
1166501644 19:43345752-43345774 GAGAAAAAAGAGGCGGTGGAGGG + Intergenic
1166508470 19:43387706-43387728 GAGAAGAAAGAGGCGGTGGAGGG - Intergenic
1166649981 19:44565718-44565740 GAGGAAAAGGAGGAAGAGGAGGG - Intergenic
1166652187 19:44582857-44582879 GAGGAAGAGGAGGAGGAGGACGG + Intergenic
1167056071 19:47112362-47112384 GAGGAAGAGGAGGAGGAGGAAGG - Intronic
1167153919 19:47726554-47726576 GAGAAGAAGGAGGAGGAGGAGGG - Intronic
1167383987 19:49153511-49153533 GAGGAAGAGGAGGAGGAGGAGGG - Exonic
1167406111 19:49309887-49309909 GAGAAAAGGGAGGTGGGGGAGGG - Intronic
1167618015 19:50546885-50546907 GAGGAAAAGGAGCCAGTGGCTGG - Intronic
1167686496 19:50960009-50960031 GAGGAGAAGGAGGAGGAGGAGGG + Intronic
1167775639 19:51552998-51553020 GAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1168077593 19:53990021-53990043 GAGAAGAAGGAGTTGGTGAAAGG + Exonic
1168240720 19:55087567-55087589 AAGCAAAAGAAGAAGGTGGAAGG + Exonic
1168276935 19:55284019-55284041 GAGAGAAAGGACGAGGTGGCGGG + Intronic
1168335966 19:55597915-55597937 GAGACAGAGGAGCAGGTGAGGGG + Intronic
1168468593 19:56623107-56623129 GGGAAAGTGGAGCTGGTGGAGGG + Exonic
1168489661 19:56797644-56797666 GAGGAAGAGGAGGAGGAGGAGGG - Intronic
1168510131 19:56967270-56967292 GAGAAAGAGGAGGAAGAGGAGGG - Intergenic
1168565532 19:57419175-57419197 CAGTAAAAGGAACAGGTGGCTGG - Intronic
1168599656 19:57707688-57707710 GGGAACAAAGAGCAGGGGGAAGG - Intronic
925206868 2:2014472-2014494 GAGTCAAAGGAGTGGGTGGAAGG + Intronic
925306188 2:2849442-2849464 GAAAAAAAGAAGGAGGGGGAGGG - Intergenic
925384440 2:3452342-3452364 GACAAAAAGAACCAGGTGGAGGG - Intronic
925402566 2:3586028-3586050 AGGAAAAAGGAGGAGGGGGAAGG + Intergenic
925496218 2:4452473-4452495 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
925508471 2:4597081-4597103 AAGAAAAAGGAGGAGGAGGAAGG + Intergenic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
925714328 2:6771018-6771040 GTGACAAAGTGGCAGGTGGATGG - Intergenic
926033921 2:9618931-9618953 GAGAAAAAGGACTAAGGGGAAGG - Intronic
926510407 2:13770042-13770064 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
926548015 2:14266196-14266218 CAAGAAAGGGAGCAGGTGGACGG + Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
927855474 2:26525005-26525027 GAGAAACAGGAACAAGTGGAAGG - Intronic
927924431 2:27000623-27000645 GAGAGACAGGAGGAGGAGGAGGG + Intronic
927986151 2:27412015-27412037 CAGAAAAAGGTGCAGTTTGAGGG + Intergenic
928088125 2:28358371-28358393 GAGAACCTGGTGCAGGTGGAAGG + Intergenic
928102957 2:28450064-28450086 GAGTAAAAGGAGAAGATAGAAGG - Intergenic
928105803 2:28469991-28470013 GAGAAGAAAGAGGAGGAGGAGGG + Intronic
928242400 2:29597817-29597839 GAGATAGCGGGGCAGGTGGAGGG + Intronic
928619336 2:33072596-33072618 GAGAAAAAAGTGCAGGTGAAAGG + Intronic
929219142 2:39445318-39445340 GAGGAAAAGTAGCAGTAGGAGGG - Intergenic
929325968 2:40611052-40611074 GAGAAAGAGGAGGAGGTGCCGGG + Intronic
929530415 2:42747486-42747508 GAGAAAGAGGAGCAGGTGAAAGG + Intronic
929532569 2:42762043-42762065 GAGAAAAAGTATCAGGCAGAGGG - Intergenic
929912647 2:46103883-46103905 GATGGAAAGGAGGAGGTGGAAGG + Intronic
930364680 2:50424289-50424311 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
930470079 2:51801366-51801388 GAGAAAAAGGAGGAGTTGCCAGG + Intergenic
931096574 2:58947381-58947403 GGGGAAAAGGAGCAGGAGAAAGG - Intergenic
931174075 2:59835325-59835347 AAGAAAAAAGAGAAGGGGGAAGG - Intergenic
931799657 2:65746492-65746514 GAGCAGAAGGAGCAGGAGGAAGG + Intergenic
931840875 2:66146742-66146764 GAGGACAAGTAGCAGATGGAGGG - Intergenic
931992776 2:67807774-67807796 GAGAAGAAGGAGAAGGAAGAAGG - Intergenic
932781446 2:74561041-74561063 GAGAAACAGGTGGAGGAGGAGGG + Intronic
932831051 2:74990618-74990640 GAGATAAAGGGGCAGAAGGAGGG - Intergenic
933266617 2:80187704-80187726 GAGAAAGAGGGGCAGATGGTTGG + Intronic
933390792 2:81664055-81664077 AAAAAAAAGGAGCAGTTGGTTGG + Intergenic
933496248 2:83053635-83053657 GAGAAAGAGGAGGAGGAAGAGGG + Intergenic
933808558 2:86017849-86017871 GGGAAAAAAGAGAAGGAGGAGGG - Intergenic
934083501 2:88489503-88489525 GAGAAAGAGAAGCAGGTGTGAGG + Intergenic
934105966 2:88694678-88694700 GAGAGAAAGGAGCAAGTGGAAGG - Intronic
934653224 2:96104137-96104159 AAGGAAAAGGAGGAGGAGGAGGG - Intergenic
934915726 2:98299598-98299620 CAGAAAAAGGATCTTGTGGAGGG - Intronic
935132154 2:100268753-100268775 GAGGAAGAGAACCAGGTGGAAGG - Intergenic
935184420 2:100718595-100718617 GAGGGAAAGGAGCAGGTGAAAGG + Intergenic
935314329 2:101816630-101816652 GAGCAAAAGGAGAAGGTAGGTGG - Intronic
935367274 2:102307849-102307871 GAGGAAGAGGACCTGGTGGATGG + Intergenic
935403407 2:102683733-102683755 GAGAAAGAGAAACAGGAGGATGG - Intronic
935531701 2:104240509-104240531 GAGGAAGAGGAGGAGGAGGAGGG + Intergenic
935756251 2:106278291-106278313 GGGAAAAAGGAAAAGGGGGAGGG - Intergenic
935818437 2:106869570-106869592 GAGCAAAAGCAGCAGCAGGAGGG - Intronic
936113228 2:109682186-109682208 GGGAAAAAGGAAAAGGGGGAGGG + Intergenic
936272489 2:111059927-111059949 GAGAAGAAGGAGGAGGAAGAGGG + Intronic
936379439 2:111970828-111970850 GAGAAGGAGGAGAAGGAGGAGGG - Intronic
936679809 2:114757200-114757222 GAGAAAAATGGGCAGGAGGAAGG + Intronic
936924619 2:117723600-117723622 GAGAGAAGGGAGCAGGAGAAAGG + Intergenic
937025185 2:118691813-118691835 CAGAAAAGGGACCAGTTGGAGGG + Intergenic
937237026 2:120437224-120437246 GAGATAAAAGAGCAGGAGAAGGG + Intergenic
937240435 2:120457628-120457650 GAAAAAAAAGAGCAAGAGGATGG + Intergenic
937268638 2:120633139-120633161 CAGAAAAAGGAGGGGGAGGAGGG + Intergenic
937327142 2:120996801-120996823 GAGGAAAAGGAGAAGGAGGAGGG - Intergenic
937677344 2:124606719-124606741 AAGAAAAAAGAGCTGGTGCAGGG + Intronic
937953718 2:127407903-127407925 GAGAGACAGGAGCAGAAGGAGGG - Intergenic
938236406 2:129709945-129709967 TTGAAAAAGGAGAAGGTGAAAGG - Intergenic
938310516 2:130285883-130285905 TAGAGAAGGGAGCAGGTGGTCGG - Intergenic
938444411 2:131366484-131366506 TAGAGAAGGGAGCAGGTGGTCGG + Intergenic
938463934 2:131514795-131514817 CAGGATGAGGAGCAGGTGGAAGG + Intergenic
938736594 2:134191669-134191691 GAGAAAGAGGAGGAGGAGGAGGG - Intronic
939059825 2:137408315-137408337 AAGATAAAGGAGAAGGGGGAAGG - Intronic
939136065 2:138295781-138295803 AAGAAAAAGGAAGAGGAGGAGGG - Intergenic
939177188 2:138762083-138762105 GGGAGAAAGGAGCAGGTGTGAGG + Intronic
939651280 2:144765604-144765626 GAGAAAAAAGAGGATGTGGGTGG + Intergenic
939966951 2:148619639-148619661 GGGAAAAAGGAGGAGGAGGAGGG - Intergenic
940216128 2:151305390-151305412 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
940379214 2:152995103-152995125 GTGAAAGAGAAGGAGGTGGAGGG + Intergenic
940535924 2:154944194-154944216 GGTAAAAAGTAGTAGGTGGAAGG - Intergenic
940549807 2:155139774-155139796 GCGAAAAAGGAGCAGGTGAAAGG - Intergenic
941085099 2:161108172-161108194 TAGAAAATGTAGCAGGTGGTAGG - Intergenic
941650100 2:168083214-168083236 AAAAAAAAGGAGAATGTGGAAGG - Intronic
941719649 2:168799773-168799795 AAGGACAAGGAGCAGGTGGCTGG - Intronic
942178787 2:173359955-173359977 GAGCAAAAGTAGCAGCAGGAAGG - Intronic
942241134 2:173964753-173964775 GGGAAAGAGGAGGAGGAGGAGGG - Intronic
942419651 2:175794895-175794917 GAGAAAAAGGGGCAGGAGACAGG + Intergenic
942496027 2:176541046-176541068 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
942751423 2:179292127-179292149 GAGACAATGGAGCATGTGAATGG - Intergenic
942762200 2:179412327-179412349 GAGAAATTGGAGAAGGGGGAGGG - Intergenic
942799093 2:179856334-179856356 CAGAAGGAGGAGCAGGTTGAGGG - Intronic
942800729 2:179872586-179872608 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
942938826 2:181592125-181592147 GAAATAAAGGAGAAGGTGTAGGG - Intronic
943034484 2:182725206-182725228 GAGAAAAGGGAGAAGGAAGAGGG - Intronic
943311132 2:186326119-186326141 GAGAAAGAGGAGCAGGAGAAAGG - Intergenic
943325551 2:186493391-186493413 AAGAGAAAAGAGCAGGTAGAAGG - Intronic
943464958 2:188217867-188217889 AAGAAAAGGGAGCAGGAGGCTGG - Intergenic
943570626 2:189569519-189569541 GAGAAAAAGGAGGAGGATAAAGG - Intronic
943805630 2:192121447-192121469 GAGGGGAAGGAGGAGGTGGAAGG + Intronic
944224226 2:197334055-197334077 CAGAAAAAGGAGCAGGTTTGGGG + Intergenic
944648785 2:201807820-201807842 GGGGAAAAGGAGCGGGTGAAAGG - Intronic
944668921 2:201979393-201979415 GAGAAAAAGGCCAAGGGGGAGGG - Intergenic
945012887 2:205483590-205483612 GAGAAAAAGGAGAGAGGGGAGGG - Intronic
945257335 2:207813493-207813515 GAGGAGAAGGAGGAGGAGGACGG + Intergenic
945365674 2:208950282-208950304 GAGAAATACGAGTAAGTGGAAGG + Intergenic
946029982 2:216695820-216695842 GAGAATGGGGAGGAGGTGGAGGG + Intergenic
946179965 2:217943083-217943105 GAGAGGGAGGAGCAGGGGGAAGG + Intronic
946456784 2:219832940-219832962 GAGAAAAGGAGGCAGGAGGAGGG + Intergenic
946632624 2:221687266-221687288 GAGAAAAAGGAACACCAGGATGG + Intergenic
946677510 2:222177423-222177445 GAGCATAAGGAGTAAGTGGAAGG + Intergenic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
947248341 2:228074976-228074998 GAGGAAAAAGAGAAGGAGGAAGG + Intronic
947445095 2:230157167-230157189 AAGAGAAAGCAGCAGGGGGAAGG - Intergenic
947608601 2:231507547-231507569 GAGGAAGAGGAGGAGGGGGAAGG - Intergenic
947653879 2:231810043-231810065 GAGGAACAGCAGCAGGTAGAGGG - Intergenic
947699180 2:232218113-232218135 GAGAAAAAGAAGCGGGTGAAAGG + Intronic
947714550 2:232333140-232333162 GAGAAGGAGGAGGTGGTGGAAGG - Intronic
947753584 2:232545344-232545366 AAGAAAAAGGAACAGGGGCAGGG + Intronic
947760945 2:232603411-232603433 GAGGAGGAGGAGGAGGTGGAAGG + Intergenic
947970600 2:234319921-234319943 GAGAAGAAGGAGGAGGAGGGAGG - Intergenic
948014116 2:234673858-234673880 GAGAGAAAGAACCAGGAGGAAGG + Intergenic
948276027 2:236709505-236709527 GAGAAATAGGACAAGGTGGCTGG + Intergenic
948309821 2:236976763-236976785 GAGAACAAGGAGGAGGGGGAAGG - Intergenic
948319959 2:237061284-237061306 GAGCAAAATGGGCATGTGGAGGG - Intergenic
948458560 2:238118458-238118480 GAGTGAATGGAGGAGGTGGATGG + Intronic
948458587 2:238118565-238118587 GAGTGAATGGAGGAGGTGGATGG + Intronic
948538971 2:238672223-238672245 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
948539007 2:238672382-238672404 GAGAAGAAGGAGAAGGAGAAGGG - Intergenic
1168829322 20:835923-835945 GAAAGAAAGAAGCAGGTGGGAGG + Intronic
1169261667 20:4143647-4143669 GAGAAAAAGAAGCAGGTGAAAGG - Intronic
1169384978 20:5141077-5141099 GAGAGAAAGGAGCAGGAGAAAGG - Intronic
1169664081 20:8015144-8015166 GAGGAAGTGGAGGAGGTGGATGG + Intronic
1169792364 20:9425025-9425047 AAGACAAAGGAGAAGGAGGAAGG - Intronic
1169931826 20:10841836-10841858 GAAAAAAAGATGCATGTGGAAGG + Intergenic
1170230696 20:14043783-14043805 GAGAAAAAGGATCATGTGAAAGG + Intronic
1170306354 20:14942441-14942463 AAGAAAAAGGAGGAGGAGAAAGG - Intronic
1171059575 20:21943280-21943302 GAGAAAGAGGAGCTGGAGGAAGG - Intergenic
1171070482 20:22063279-22063301 GTGAAAAAAGTGAAGGTGGATGG - Intergenic
1171094619 20:22319493-22319515 GAGAAAGAGGAAAAGGAGGAGGG + Intergenic
1171161081 20:22924413-22924435 GATAAAAGGGAGCAGGAGGTAGG + Intergenic
1171318140 20:24214021-24214043 GAGAAAAATGATCAGATGAAAGG - Intergenic
1171480293 20:25450168-25450190 CGGGAAAAGGAGCAGGTGAAAGG + Intronic
1172613159 20:36266527-36266549 GAGAAGAATGAGCGGGAGGATGG + Intronic
1172616423 20:36288707-36288729 GAGGAAGAGGAGCAAGAGGAGGG + Intergenic
1172842918 20:37912783-37912805 GAGAGTAAGGGGCCGGTGGAGGG - Intronic
1172849298 20:37949202-37949224 GAGAAACATGAGCTGGGGGAGGG + Intergenic
1172981595 20:38946553-38946575 TATATAAAGGAGCAGGAGGAGGG - Intronic
1172997809 20:39083813-39083835 GGGAAAAGGGAGCAGGTGGTTGG - Intergenic
1173160056 20:40645873-40645895 GAGGAAGAGGAGAAGATGGAAGG + Intergenic
1173201634 20:40959413-40959435 GAGAGAAAGGAGGAGAGGGAAGG + Intergenic
1173357189 20:42304917-42304939 GGAAAAAAAGAGCAGGTGGCAGG - Intronic
1173408192 20:42785792-42785814 GAGACAAAGGGGAAGGAGGAAGG - Intronic
1173600229 20:44289697-44289719 GATACAGAGGAGCACGTGGAGGG + Intergenic
1173671267 20:44800644-44800666 GAGACAAAGGAGGAACTGGAGGG + Intronic
1173736449 20:45364809-45364831 GAGAACAAGCAGCAGGAGCAAGG - Intronic
1173782442 20:45767729-45767751 AATAAAAAGGAGAAGGAGGAAGG + Intronic
1173858290 20:46265307-46265329 GAGAAAGAGGAGGAGGAAGAGGG - Intronic
1173924075 20:46767955-46767977 GGGAAAAGTGAGGAGGTGGAAGG - Intergenic
1174150375 20:48482158-48482180 GAGGAGGAGGAGCAGGGGGAAGG + Intergenic
1174308901 20:49635188-49635210 GAGAAAAAGTAAGAGGGGGAGGG + Exonic
1174528932 20:51195656-51195678 GAGAAAAGGGAGGAGGTGCCGGG + Intergenic
1174709528 20:52690275-52690297 AAGAAAAAGGAGAAGGGGAAGGG - Intergenic
1174720644 20:52808427-52808449 GAGAAAGAGGAGGAGGAAGAGGG - Intergenic
1175073396 20:56353622-56353644 GAGAAGCAGGAGCAGCAGGAGGG - Intergenic
1175131320 20:56791815-56791837 AAGGAACAGGAACAGGTGGAAGG - Intergenic
1175298817 20:57928537-57928559 GAGAAAAGGGAGGAGGAAGAGGG - Intergenic
1175298908 20:57928882-57928904 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1175438036 20:58968340-58968362 GAGAAAAAAGGGCAAGTGGGAGG + Intergenic
1175452092 20:59077925-59077947 GGGAAGAAGGAGGAGGAGGATGG + Intergenic
1175608770 20:60332853-60332875 GAGAAAAGGAAGCAAGTGAAAGG + Intergenic
1175657805 20:60787023-60787045 GGGAGAAAGGAGGAGGAGGAGGG - Intergenic
1175891585 20:62318245-62318267 GAGGAAGAGGAGGAGGGGGAGGG + Intronic
1176735541 21:10542825-10542847 TATAAAAAGGAGCAGGTCGTAGG + Intronic
1177115953 21:17087640-17087662 AAGAAAAAGGAGGAGGAGGAGGG + Intergenic
1177182517 21:17758461-17758483 GAGACAGAGGAACAGGAGGATGG - Intergenic
1177303227 21:19277502-19277524 GAGAAAAAGGAGCAGGTAAAAGG + Intergenic
1177507233 21:22034756-22034778 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1178502337 21:33136061-33136083 TAAAATCAGGAGCAGGTGGATGG + Intergenic
1178536575 21:33414852-33414874 GAGAAAAAGAAGAGGGAGGAAGG - Intronic
1178721713 21:35016591-35016613 CAGAAGAAGGAGCAGGATGAGGG - Intronic
1178746592 21:35256963-35256985 GAGAAAAAGGGGGAGGCAGAAGG + Intronic
1178893072 21:36536187-36536209 GAGGAAACAGAGCAGGTGCAAGG - Intronic
1178982128 21:37273524-37273546 GAGAAGGAGGAGGAGGGGGAGGG + Intergenic
1178982134 21:37273547-37273569 GAGAAAGAGGAGGATGAGGAGGG + Intergenic
1179081804 21:38178535-38178557 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1179131380 21:38640335-38640357 GAGAAACAGGAGATGGGGGAAGG + Intronic
1179300362 21:40102927-40102949 GAGTAAAAGGAGTAGAGGGATGG - Intronic
1179396481 21:41044944-41044966 GAGAGGGAGGAGCAGCTGGAAGG + Intergenic
1179483999 21:41698002-41698024 GAGGAAAAGAAACAGGTGGGTGG - Intergenic
1179587535 21:42383265-42383287 GGGAGAGAGGAGCAGGTGCATGG - Intronic
1179625747 21:42648677-42648699 CATAAAAAGAAACAGGTGGAGGG + Intergenic
1179799320 21:43803549-43803571 GAGGAAGAGGAGCAGGAGGAGGG + Exonic
1180301617 22:11040954-11040976 GAGGAGAAGGAGGAGGAGGAAGG + Intergenic
1180872540 22:19154653-19154675 GAGAAGAAGAAGGAGGAGGAGGG - Intergenic
1181112098 22:20608225-20608247 CAGAATGAGGAGCAGATGGAAGG - Intergenic
1181342697 22:22195565-22195587 CAGAAACACCAGCAGGTGGAGGG - Intergenic
1181441506 22:22938237-22938259 GGGAGAAAGGGGTAGGTGGATGG + Intergenic
1181508449 22:23377584-23377606 GAGAAGAAAGAGGAGGAGGAAGG + Intergenic
1181744333 22:24945370-24945392 GAGACAAAGGTGGATGTGGATGG + Intronic
1181813626 22:25420851-25420873 GAGGAGAAGGAGGAGGCGGAGGG + Intergenic
1181977208 22:26738467-26738489 GAGAACAAGGAGGAGGGGAAGGG - Intergenic
1182358902 22:29735258-29735280 GAGAAAAAGGGGCTGTGGGAAGG - Intronic
1182522418 22:30891999-30892021 GTGAAGAAGCAGCAGCTGGAGGG + Intronic
1182692443 22:32173518-32173540 GAGAGAATGGAGCAGCTGGAAGG - Intergenic
1182724864 22:32436389-32436411 GAGGAAGAGGAGGAGGAGGAGGG + Intronic
1182738369 22:32547389-32547411 GAGACAGAGAAGGAGGTGGAAGG - Intronic
1183178676 22:36243967-36243989 GAGAAATACCATCAGGTGGAGGG + Intergenic
1183737014 22:39649761-39649783 GAGGAGGAGGAGCAGGCGGATGG + Exonic
1184061317 22:42083818-42083840 GAGAAAAAGCAGCAGGTGAAAGG - Exonic
1184334064 22:43843025-43843047 GAGAAAAAGGAACAGGTGAAAGG - Intronic
1184361454 22:44021387-44021409 GAGAAAAAGGAGCAGGTGAAAGG + Intronic
1184449735 22:44575846-44575868 GAGAAAGAGGAGGAGGAGGGAGG + Intergenic
1184449765 22:44575980-44576002 GAGAAAGAGGAGGAGGAGGGAGG + Intergenic
1184449811 22:44576159-44576181 GAGAAAGAGAAGGAGGCGGAAGG + Intergenic
1184526672 22:45027990-45028012 GAGGAGAAGGAGGAGGTGGAAGG + Intergenic
1184744555 22:46448685-46448707 GAGAACAAGGAGTGAGTGGAAGG + Intronic
1184785990 22:46672274-46672296 GAGAAAACGGAGCTGGTGGAGGG + Intronic
1184794516 22:46724047-46724069 GAGAAGACGGAGGAGGTGGAAGG - Intronic
1184989886 22:48160220-48160242 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1185055297 22:48575955-48575977 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1185097158 22:48816554-48816576 GAGGAAGAGGAGGAGGAGGAGGG - Intronic
1185403899 22:50634332-50634354 GAAAAACAGGTGCAGCTGGAAGG - Intergenic
949127947 3:469091-469113 GAGGAAAAGGAGAAGGGGGACGG - Intergenic
949250082 3:1973143-1973165 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
949371852 3:3343886-3343908 GAGAGAAGGGAGCAGGTCTAGGG - Intergenic
949567239 3:5256265-5256287 GAGAAAAAAGAGAAGGAGAAGGG - Intergenic
949657345 3:6235823-6235845 CAGACAAAGGAGCATGTAGAGGG - Intergenic
949908840 3:8883087-8883109 GAGAAAAAGGAGTATGTGAGGGG + Intronic
949946397 3:9193286-9193308 GAGAAAAAAGAGCAATCGGATGG - Intronic
950002869 3:9670661-9670683 GGGGAAAAGGAGGGGGTGGAAGG + Intronic
950225470 3:11230080-11230102 GAACAAAAGGAGTAGGTGGCTGG + Intronic
950283318 3:11725246-11725268 GAAGAAAAGGAGAAGGAGGAGGG - Intergenic
950401660 3:12773736-12773758 GAAGAAAAGGAGCAGGAGGAAGG + Intergenic
950655311 3:14432804-14432826 GAGAAAGAGGAGCTTGGGGAGGG - Intronic
950841660 3:15973949-15973971 GAGGAAGAGGAGAAGGAGGAAGG - Intergenic
951134596 3:19089865-19089887 GAGAAAAAGGAAGAGATGGAGGG + Intergenic
951160409 3:19412894-19412916 GAGAAAAAGGAACACGTTGGTGG + Intronic
951556546 3:23926415-23926437 GAGCAAGAGGAGGAGGAGGAAGG - Intronic
951726602 3:25767489-25767511 AAGAAAGAGGTGCAGGTGGAGGG + Intronic
951934006 3:28001702-28001724 GAGAAACAGGAGCAGGAAGAGGG + Intergenic
951963217 3:28352070-28352092 GAGACAAAGGAGACGGGGGAAGG - Intronic
952283868 3:31948963-31948985 GAGAAAAGGGAGCAGGTGTTTGG + Intronic
952432611 3:33238611-33238633 GATAAAAAGAAGAAGGTGGCCGG + Intergenic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952486500 3:33816853-33816875 GAGAATAAGGAGCAGATGGCAGG + Intronic
952561417 3:34598091-34598113 GAGAAAAAGAAACAGTGGGAAGG - Intergenic
952747019 3:36791101-36791123 GGGAAAAGGGAGCAGGGGAAAGG + Intergenic
953204151 3:40806530-40806552 GACAAAATGAAGGAGGTGGAAGG - Intergenic
953230239 3:41058297-41058319 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
953365400 3:42340417-42340439 GAGAAGGAGGAGAAGGAGGAGGG + Intergenic
953612470 3:44458701-44458723 GAGAAAAAGGAGCAGGTGAAAGG - Intronic
953708439 3:45248675-45248697 GAGAAGAAGGATCAAATGGAAGG + Intergenic
953837208 3:46357060-46357082 GAGCAGGAGGGGCAGGTGGAGGG + Intronic
953955203 3:47226688-47226710 AAGAGAAAGGAGCTGGAGGAGGG + Intergenic
954008635 3:47614950-47614972 GAGACAAGGGAGTAGGTGGGTGG - Intronic
954152028 3:48662563-48662585 GAGGAGAAGGAGCAGGAGTATGG + Exonic
954546787 3:51443096-51443118 GAAAAAAAAGGGCAGATGGATGG + Intronic
954788836 3:53115537-53115559 GAGAGAAAGGAAAAGGTGGCGGG - Intronic
954812804 3:53258238-53258260 GAGAGAAAGGAGCAGGTGAAAGG - Intergenic
954912745 3:54122542-54122564 CAGAAAAAGGAGCGGGTGGGGGG - Intronic
954914378 3:54136317-54136339 GAGGAAAAGGAGAAGGTTGGAGG - Intronic
954992490 3:54853582-54853604 GAGACATAGAAGCAGGTAGAAGG + Intronic
955148544 3:56344317-56344339 GAGAATGAGGAGGAGGAGGAGGG - Intronic
955307450 3:57848549-57848571 AAGAAAAAGGAGAAGGAGGGAGG - Intronic
955514294 3:59711510-59711532 GAGAAGGAGGAGAAGGAGGAGGG - Intergenic
955793668 3:62613125-62613147 GAGAAGGAGGAGCAGCTTGATGG - Intronic
955941492 3:64150539-64150561 GAGAAGAAGGAGGAGGAAGAAGG - Intronic
956009634 3:64817047-64817069 AAGAGAAAGGAGCTGGGGGAGGG - Intergenic
956198803 3:66683940-66683962 AAGAAAAAGGAGGAGGAGGAGGG - Intergenic
956272422 3:67462199-67462221 AAGAAAAAGGAGCAGGTGAAAGG - Intronic
956437597 3:69248658-69248680 GACAGAATGGAGCAGGTAGAGGG + Intronic
956657573 3:71567162-71567184 AAGAAAAATGAGAAAGTGGACGG + Intronic
957151351 3:76490141-76490163 CATAAAAAGGAGGAAGTGGAAGG - Intronic
957303164 3:78420038-78420060 AAGAAAAAGTAGCAGGTGAAAGG + Intergenic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
957642772 3:82879310-82879332 AAGGAAATGTAGCAGGTGGAAGG + Intergenic
958157765 3:89776246-89776268 AAGAAAGAGGAGGAGGAGGAGGG - Intergenic
958906602 3:99948621-99948643 GAGAGGAAGGAGGAGGAGGAGGG + Intronic
959963891 3:112332608-112332630 GAGAAGAAGGAGAAGGAGAAGGG + Intronic
960016806 3:112900204-112900226 TAGAAAAAGGAGTATGTGGAGGG + Intergenic
960141912 3:114159306-114159328 AAGAAAGAGGGGCAGGTGTAGGG - Intronic
960153668 3:114276061-114276083 GAGAAAGAGTACCAGGAGGAGGG - Intergenic
960243295 3:115371142-115371164 GAGAGAAAGGAGAATGTGGAAGG - Intergenic
960350383 3:116585757-116585779 AAGAAAGAGGAGAAGGAGGAGGG + Intronic
960420315 3:117437273-117437295 AAGAAAAAGCAGCAGGGGAAGGG + Intergenic
960466238 3:117999167-117999189 GAGGAAAGGGATCAGGTAGAAGG - Intergenic
960715033 3:120566716-120566738 AAGAGAAAGGAGCGGGAGGAGGG - Intergenic
960935126 3:122894653-122894675 GGGAACAGGGAGCAGGTGAAAGG - Intergenic
961072189 3:123943404-123943426 AGGAAAAAGGAGCAGGTGAAAGG - Intronic
961756346 3:129129279-129129301 GAGCGAGTGGAGCAGGTGGAGGG + Intronic
961909591 3:130301143-130301165 GAGGAAAAGGACCAGGGGAAGGG + Intergenic
962054411 3:131854796-131854818 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
962146000 3:132840743-132840765 GAAAAAATGGAGCAGATGCATGG - Intergenic
962338652 3:134562312-134562334 GAGAGAGAGGAGCAGGAGGCTGG + Exonic
962464273 3:135642196-135642218 GAGAAAATGGAGGAGGGGGAGGG - Intergenic
962684459 3:137833623-137833645 GAGAGAAAGAAGCATGTGGGAGG - Intergenic
962812117 3:138968492-138968514 GAGAAAGAGTAGTAGCTGGAGGG + Intergenic
962952186 3:140229486-140229508 GAGAAAAAGGAAAAGGAGGGTGG - Intronic
962958732 3:140290515-140290537 GAGGAAAAGGAGGAGGTAGGGGG + Intronic
963283565 3:143411379-143411401 GATATGAAGTAGCAGGTGGAAGG - Intronic
963327347 3:143877129-143877151 GAGGAAAAGGAGAAGGTGTGGGG - Intergenic
963702675 3:148645692-148645714 GAGTCAAAAGAGCATGTGGAAGG - Intergenic
963718918 3:148837490-148837512 AAAAAAAAGGAGAAGTTGGATGG + Intronic
963771618 3:149392052-149392074 GAGAAAAAGAGGTAGGTGGAGGG - Intergenic
963836828 3:150066690-150066712 GAGGAAGAGGAGGAGGAGGAGGG + Intergenic
964006266 3:151832967-151832989 GAGCAAGAAGAGCAGGAGGAGGG + Intergenic
964051476 3:152399297-152399319 AAGAAATAGGAGCAGGGGGAGGG - Intronic
964236002 3:154528592-154528614 AAGAAAAAGGAAAAGGAGGAAGG - Intergenic
964374401 3:156035408-156035430 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
964376342 3:156052159-156052181 AAGAAAAAGGGGGAGGGGGAGGG - Intronic
964519864 3:157553488-157553510 GAGAAAAAGAAGCAGGTGAAAGG - Intronic
964909253 3:161758072-161758094 GAGAAAGAGAAGAAGGTGGTTGG + Intergenic
965251555 3:166350009-166350031 GAGAAAAGGGAGCTTGTGCAGGG - Intergenic
965553313 3:169992809-169992831 GAGAAAAAGGAAGATGAGGAGGG + Exonic
965611359 3:170547131-170547153 GAGGAAAAGGAGAAGAAGGAAGG - Intronic
966425494 3:179775852-179775874 GAGGGAGAGGCGCAGGTGGAGGG - Intronic
966559181 3:181300033-181300055 GAGAAGAAGGAGGAGGAGAAGGG + Intergenic
966624426 3:182001046-182001068 GAGGAAAGGGTGGAGGTGGAAGG - Intergenic
966947909 3:184790271-184790293 GAGAAAAAGAAGGCTGTGGAAGG + Intergenic
967095530 3:186174445-186174467 GAAAAAAAGGAGAAGGTTGGGGG + Intronic
967117176 3:186352570-186352592 GAGGAACAGGAGCAGGTGTGGGG - Intronic
967121328 3:186385252-186385274 GAGATGAAGGAGGAGGTGCAAGG + Intergenic
967146793 3:186613149-186613171 AAGACAAAGGAGCAGGACGAGGG - Exonic
968041419 3:195592257-195592279 GAGAGAAAGGAGAAGGAGGGAGG + Intergenic
968889324 4:3359256-3359278 GAGGGAGAGGAGGAGGTGGAGGG - Intronic
969199308 4:5589971-5589993 TAGAGAAAAGAGAAGGTGGAGGG + Intronic
969372633 4:6743515-6743537 AAGAAAAAGAAGAAGGGGGAGGG - Intergenic
969414632 4:7050439-7050461 GAGAAAAAGGAGCTGGTGCTGGG + Intronic
969444331 4:7235520-7235542 GAGAACACAGAGCGGGTGGATGG + Intronic
969506454 4:7591184-7591206 GAGAAGAAGGAGAAGGTGGGAGG - Intronic
969515342 4:7644711-7644733 GAGGGAAAGGAGCAGCTTGAGGG - Intronic
969519628 4:7668414-7668436 GAGAAAATGGTTCGGGTGGAGGG + Intronic
969543501 4:7808814-7808836 GAGAAAGAGGAGCAGGTGCCAGG - Intronic
969723094 4:8904143-8904165 GAGGAGAAGCAGCAGGTCGAGGG - Intergenic
970063792 4:12068027-12068049 GAGAAAAAGGAGGAGAAGAACGG + Intergenic
970227496 4:13874862-13874884 GAAAGAGAGGAGCAGATGGATGG - Intergenic
970383370 4:15531069-15531091 GAGATAAAGTAGTAGCTGGATGG - Intronic
970780784 4:19734991-19735013 GAGGAAAAGGAGAAAGTGAAAGG + Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
970863821 4:20736116-20736138 GAGTGAAAGGAACAGGTGGCTGG - Intronic
971008196 4:22399179-22399201 AAGAAAAAGTAGCAGGAGAATGG - Intronic
971055924 4:22912396-22912418 GAGAGAAAGGGGAAGGAGGAAGG - Intergenic
971335787 4:25722933-25722955 GAGAAAAAGGAATAGGAGAAGGG + Intergenic
971678672 4:29668255-29668277 AAGAAAAAGGAGCAAGTAAAAGG + Intergenic
971769829 4:30882107-30882129 GAGAAACGGGAGGAGGAGGAGGG - Intronic
971919800 4:32923107-32923129 AAGACAAAGGAGCAGGTGGCTGG - Intergenic
972927071 4:44022812-44022834 GAGAAAAAGGAAGAGGATGAAGG - Intergenic
972990497 4:44817683-44817705 GAGGAAGAGGAGAAGGAGGAAGG + Intergenic
973084145 4:46033041-46033063 GAGATAAAGGACCAAGGGGAGGG - Intergenic
973114759 4:46441773-46441795 GGGGAAAAGGAGCTGGAGGAGGG - Intronic
973273775 4:48287858-48287880 GAGAAAAAGGAACAGGGGAAAGG - Intergenic
973571092 4:52240472-52240494 CTGAAAAAGAAGGAGGTGGAGGG - Intergenic
973616725 4:52686217-52686239 GAGAAAGAGGAGGAAGAGGAAGG - Intergenic
973690754 4:53428113-53428135 GAAGAAATGGAGGAGGTGGAAGG - Exonic
974229283 4:59088962-59088984 TAGAAAAAGAAGAAGGAGGAGGG - Intergenic
974660344 4:64880450-64880472 GAGGAAGAGGAGCAGGATGAAGG + Intergenic
974919925 4:68226082-68226104 GAGAAGATGGAGGAGGTAGATGG - Intergenic
975156237 4:71076014-71076036 GGGAAACAGGGGCAGGTTGACGG - Intergenic
975388524 4:73788134-73788156 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
975590521 4:75995178-75995200 GAGAAAATGAAGCAGGGGAAGGG - Intergenic
975647484 4:76559588-76559610 GAGAAAAAGAGGCAGGTACATGG - Intronic
976001706 4:80381871-80381893 AGGAAAAAGGAACAGGAGGAAGG - Intronic
976006030 4:80431543-80431565 GAGAAGAAGGAGAAGGGGAAGGG - Intronic
976143258 4:82015283-82015305 GAAGAAAAGGAGAAGGAGGAGGG + Intronic
976283604 4:83349278-83349300 GAGAAAAATGAGTAGGAGGATGG - Intergenic
976704692 4:88008025-88008047 GAGGAGGAGGAGGAGGTGGAAGG + Exonic
976737917 4:88329195-88329217 GAGAAAAAGGAGCAGGTGAAAGG + Intergenic
976743150 4:88377877-88377899 GATGAAAAGAAGCAGTTGGAAGG - Intergenic
976771145 4:88653753-88653775 GAAATAAAGGAACAGCTGGAAGG + Intronic
976839053 4:89409576-89409598 GAGAAAGAGGAACAGATGGAGGG + Intergenic
977066932 4:92329965-92329987 GAGAAAAAGGAAGAGGAGTATGG + Intronic
977232067 4:94463546-94463568 GAGAAAGAGGAGGAAGAGGAAGG + Intronic
977551732 4:98450048-98450070 GAAAAAAAGGAAAAGGTGAAGGG - Intergenic
977839617 4:101686974-101686996 GAGCAAAAGGGGAACGTGGAAGG - Intronic
978021841 4:103824140-103824162 GAGAAAAATGAGCAAGGGAATGG + Intergenic
978037714 4:104016474-104016496 GAGAAAGAGCAAGAGGTGGAGGG + Intergenic
978224377 4:106316336-106316358 GAGAAAGAGGTGCGGGGGGACGG + Intronic
978370946 4:108029172-108029194 GAGAGGAGGGAGCAGGTGGTGGG - Intronic
978384990 4:108169319-108169341 GAGGAAAAGGAGTGGGTGGGTGG - Intergenic
978676119 4:111318312-111318334 AAGAAAAAGAAGCAGATGGAGGG + Intergenic
978685254 4:111434709-111434731 GGGAAAATGAAGCAGGTGGGGGG + Intergenic
978844638 4:113258194-113258216 GAGAAAAAGGAAAGGGAGGAAGG - Intronic
978858321 4:113418646-113418668 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
978935609 4:114371416-114371438 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
979405014 4:120299168-120299190 AAGAAAAAGGAGAAAGAGGAAGG - Intergenic
979481189 4:121219327-121219349 GAGGAAAAGGAGGAGGAGGGAGG - Intronic
979559559 4:122086961-122086983 GAGAAACAGGAGGAGGAGAAAGG + Intergenic
980156447 4:129113792-129113814 GAGCAAAAGGAGGAGAAGGAGGG - Exonic
980669482 4:135986075-135986097 GAGAAAGAGGAGAAGGTAGCTGG + Intergenic
981021181 4:140030527-140030549 GACAAAAAGGAAAAGGTGGGAGG - Intronic
981025053 4:140069476-140069498 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981025068 4:140069537-140069559 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
981102178 4:140841237-140841259 AACAAAAAAGAGCAGATGGAAGG + Intergenic
981254402 4:142644303-142644325 GAGAAGGAGGAGGAGGAGGAGGG + Intronic
981552996 4:145960642-145960664 GAGAGAAAGGAGCTGGTTGAAGG + Intergenic
982057096 4:151562417-151562439 GAGCAAAAGGAGCAGAAGAAAGG - Intronic
982253524 4:153431214-153431236 CAGAAAAAGGAGTAGGTTGTAGG + Intergenic
982865463 4:160505182-160505204 GAGAAAAAAGAGCAGTTGAAAGG - Intergenic
983421019 4:167516994-167517016 GTGAAAAAGGAGCAGTTAGAGGG - Intergenic
983551490 4:169021880-169021902 GAAAAGAAAGTGCAGGTGGAGGG + Intergenic
983759109 4:171383534-171383556 GAGAAAAATGAACAGGCAGATGG + Intergenic
985388955 4:189474645-189474667 GAGAAAAAGAAACAGGAAGAGGG + Intergenic
985627643 5:998184-998206 GAGAAAGAGGAAAAGGGGGACGG + Intergenic
985882744 5:2652752-2652774 GAGCATAGGGGGCAGGTGGATGG - Intergenic
986129375 5:4912731-4912753 GAGAGAAAGGAGAAGGAAGAAGG + Intergenic
986221730 5:5774769-5774791 GAGGAGAAGGAGGAGGGGGAGGG - Intergenic
986477399 5:8149447-8149469 AAGACAGAGGAGCAGGTTGATGG + Intergenic
987095454 5:14545614-14545636 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
987241957 5:16009041-16009063 GAGAAGGAGGAGGAGGAGGAGGG + Intergenic
987743023 5:21934772-21934794 GAGAAAAGGAAGAATGTGGAGGG - Intronic
988211986 5:28215856-28215878 GAGAAGAAGGAGGTGGGGGAGGG - Intergenic
988400597 5:30755174-30755196 GAGACAAAAGAGCATGTGAAGGG - Intergenic
988723278 5:33900497-33900519 GAGAAAAAGGAGCCAATGGCCGG + Intergenic
989167564 5:38446204-38446226 GCAAAAATGGAGGAGGTGGAAGG - Intronic
989512697 5:42306533-42306555 CAGACAAAGGAGAAGTTGGAAGG + Intergenic
989607454 5:43258076-43258098 GAGGATGACGAGCAGGTGGAGGG - Intronic
990066417 5:51720977-51720999 AAGAAAAAAAAGCAGGTGGTGGG + Intergenic
990079747 5:51898867-51898889 GAGAAAGAGGAGGAAGAGGAGGG + Intergenic
990395879 5:55377822-55377844 GAGAAAAAGCAGCAGGTGAAAGG - Intronic
990604611 5:57396107-57396129 AAAAAAAGGGAGCAGGTGAAAGG + Intergenic
990626265 5:57614949-57614971 GAGAGAACAGAGCAGATGGATGG + Intergenic
991116140 5:62957709-62957731 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
991137564 5:63199973-63199995 GAAGAAAAGTAGAAGGTGGAGGG - Intergenic
991195756 5:63930236-63930258 GAGAAAAAGGAAAAGTTGGGGGG + Intergenic
991602579 5:68368224-68368246 CAGAAAAATGAGCTGGTTGACGG + Intergenic
992152347 5:73917615-73917637 GAGCAAAACCAGCAGGTGGGTGG + Intronic
992384423 5:76270044-76270066 GAGACAAAGGAGAAAGGGGATGG + Intronic
994238388 5:97392122-97392144 AAGAAAAAGGACCAGGGGAAGGG - Intergenic
994825392 5:104707621-104707643 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
995016788 5:107318875-107318897 GAAAAGAAGGAGGAGGAGGAAGG + Intergenic
995072469 5:107940601-107940623 GAGAAAATGAAGTAGTTGGAGGG + Intronic
995735854 5:115298386-115298408 GAGAAGAAGGAGAAGGGAGAAGG + Intergenic
996437397 5:123450045-123450067 GGGAAAAAGGAGTATGTGAAAGG - Intergenic
996905644 5:128596691-128596713 GAGAAAAAGAACCAGATGGCGGG + Intronic
997297226 5:132776155-132776177 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
997362590 5:133304752-133304774 GAGAAGAAGGAACTGGTGCAGGG + Intronic
997585997 5:135043853-135043875 GGCAAAAAGGAGCAGATGAAGGG + Intronic
997619530 5:135276564-135276586 GAAAAAAAGGAGGAGGAGGAAGG - Intronic
998010849 5:138694544-138694566 GAGAAAAAGGAGCAAGTGAAAGG + Intronic
998164334 5:139834240-139834262 GAGGAAAAGGAGCAGGTTTTTGG + Intronic
998194767 5:140058775-140058797 GAGGAAAAGGAGGAAGAGGAAGG - Intergenic
998395023 5:141812678-141812700 GAGGAGGAGGAGCAGGAGGAGGG + Intergenic
999116982 5:149173080-149173102 GAGAGAGAGGAGCAAGAGGAAGG + Intronic
999213982 5:149916159-149916181 AAGAAAAAAGAGAAGGTAGACGG - Intronic
999450084 5:151671541-151671563 GAGAGACAGGGGCAGGGGGAAGG - Intronic
999774580 5:154802121-154802143 GAGGAGATGGAGCAGATGGATGG + Exonic
1000149912 5:158489864-158489886 GTGAAAAAAGAAGAGGTGGAAGG + Intergenic
1000316060 5:160092788-160092810 GAGGAAGTGGAGGAGGTGGAAGG + Exonic
1000329857 5:160197990-160198012 GAGAAAGAGGAGCAGGAGGTGGG + Intronic
1000488723 5:161881946-161881968 GAGAAGGAGGGGCAGGGGGAGGG + Intronic
1000515635 5:162234036-162234058 GAAAAAAAAGAGCATGTGCAGGG - Intergenic
1001304621 5:170562674-170562696 GAGAAAATGGAGCATGTCGTGGG - Intronic
1001858281 5:175031748-175031770 GAAAGAAAGGAGCTGGGGGAGGG - Intergenic
1002187155 5:177459677-177459699 GAGGAAGAGGAGGAGGAGGAAGG + Intronic
1002548247 5:179967152-179967174 GAGAAGAAGGAGTAGGTAGGTGG - Intronic
1003487847 6:6595217-6595239 GGGGAAAAGGAGTAGGAGGAGGG + Intronic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003631544 6:7791971-7791993 GAGAAACAGGACCAATTGGATGG + Intronic
1003934420 6:10960661-10960683 GAGAAAGGGGAGCAAGTGGAAGG + Intronic
1004157997 6:13187640-13187662 CAGAAAGAGGAGCAGGTTGAAGG + Intronic
1004278499 6:14258885-14258907 GAGAAAGAGGAGGAGGAGGGAGG + Intergenic
1005000648 6:21237231-21237253 GAAAAAAAAAAGCAGGGGGATGG + Intergenic
1005002975 6:21261302-21261324 AAGAAGAAGGAGGAGGAGGAAGG + Intergenic
1005061840 6:21783797-21783819 GCAAAAAAGGAGAAGGAGGAAGG - Intergenic
1005132042 6:22520500-22520522 GAGAGAAGGGAGAAGGGGGAAGG + Intergenic
1005385242 6:25279272-25279294 GAGAAGGAGGAGAAGGAGGAGGG + Intronic
1005617330 6:27586646-27586668 GGGAAAAAGGTGCAGGAGAAGGG + Intergenic
1005666807 6:28065897-28065919 GAGAACAGGGAGAAGGTGGTTGG - Intergenic
1005697504 6:28365019-28365041 CAGTAAATGGAGCATGTGGAAGG - Intronic
1005864027 6:29925077-29925099 TAGGAAAAGGAGCAGAGGGAAGG + Intergenic
1005905360 6:30258466-30258488 GAGGAAAAGGAGCAAGGGAAAGG + Intergenic
1006043603 6:31274289-31274311 GAGGACAAGGAGCAGGGGAAAGG - Intronic
1006053185 6:31359285-31359307 GAGGACAAGGAGCAGGAGAAAGG - Intergenic
1006108603 6:31730804-31730826 GAGAAAATGGAGGGGGTTGAGGG + Exonic
1006185794 6:32181102-32181124 AAGAAAAGGGAGCTGATGGATGG + Exonic
1006268855 6:32948909-32948931 GAGGAGAAGGAGGAGGAGGATGG - Intronic
1006425119 6:33958892-33958914 GGGAAAAAGGAAAGGGTGGAGGG - Intergenic
1006437807 6:34035299-34035321 GAGAAAGAGGAGGAGGGGGAAGG + Intronic
1006460399 6:34154662-34154684 GACAAAAAGCAGCAGCAGGAGGG + Intronic
1007502044 6:42305732-42305754 AAGAAAAAGGAACAGGGGGAGGG + Intronic
1007658487 6:43467511-43467533 GAGAATAAGGACCAAGTGAAAGG - Intergenic
1007694662 6:43724683-43724705 GAGACTAAGGAGCAGGAGGCAGG - Intergenic
1008004302 6:46393745-46393767 GAGAAAAAGTAATAGGTGGTTGG - Intronic
1008246135 6:49175926-49175948 GAGAAAGGGGAGTAGGAGGAAGG + Intergenic
1008267266 6:49443887-49443909 GAGACAAAGGAGCATGTTAAGGG + Intronic
1008288372 6:49682480-49682502 GAGGAATAGGAGGAGGAGGAGGG - Intergenic
1008441114 6:51532689-51532711 GAGAAAAAAAAGGAGGTGAAAGG - Intergenic
1008593626 6:53018777-53018799 GAGAGAAAAGAGAAAGTGGAAGG + Intronic
1008609442 6:53172411-53172433 GAGAAAACGAAGCAGATAGACGG + Intergenic
1009968398 6:70601807-70601829 GAGAAAAACCAGCAGTGGGAAGG - Intergenic
1010116854 6:72322944-72322966 AACAAAAAGCAGCAGCTGGAAGG + Intronic
1010238245 6:73592633-73592655 GAGAAAAAGCAGCAGGTGAAAGG + Intergenic
1010469993 6:76216467-76216489 GAGAAAATGGAGCTTCTGGAAGG + Intergenic
1010941562 6:81924802-81924824 GTGGAGAAGGAGGAGGTGGAAGG + Intergenic
1011064718 6:83312551-83312573 GAGAAAGAGGGGGAGGTTGATGG + Intronic
1011194098 6:84764447-84764469 GAGCAGCAGGAGGAGGTGGAAGG - Exonic
1011277230 6:85643066-85643088 GAGAAGGAGGAGCTGGAGGAGGG - Exonic
1011553309 6:88549277-88549299 AAGAAAGAGGAGGAGGAGGAAGG - Intergenic
1011675742 6:89731805-89731827 GAGAAAAAGGAAAAGGTGGGGGG - Intronic
1011742617 6:90377649-90377671 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1012165669 6:95948056-95948078 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1012724081 6:102786044-102786066 GACAAAAAGCAGAAGGTGAATGG - Intergenic
1013172428 6:107648745-107648767 CAGAAATAGGAAAAGGTGGATGG - Intronic
1013325235 6:109039081-109039103 GAGGAAAAGGAGAAGGAGGGAGG + Intronic
1013550721 6:111205190-111205212 GAGAAAAAGGAGATGGTGTTGGG + Intronic
1014243248 6:119040996-119041018 GAGCTAAAGGAGGAAGTGGAAGG - Intronic
1014249084 6:119097792-119097814 GAGAAAAAGGAGCAGGTGAAAGG - Intronic
1014318329 6:119894464-119894486 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1014570020 6:122996887-122996909 GAGAAAAGGGGGGAGGGGGAGGG - Intronic
1014869973 6:126581949-126581971 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1015313347 6:131789572-131789594 GTGAAAAAGGACCAGGGGCAAGG - Intergenic
1015790023 6:136957406-136957428 GAGAAAGAGGAGCTGGGGCAGGG + Intergenic
1016487551 6:144558740-144558762 GAGAGAAAGAAGGAGGTGAAAGG + Intronic
1016634820 6:146275971-146275993 GAGAAGAAAGAGGAGGAGGAAGG + Intronic
1016830115 6:148425728-148425750 AAAAAAAAGGAGGAGGGGGAGGG - Intronic
1017404877 6:154108376-154108398 GAGAAAAACGTGCCAGTGGAAGG + Intronic
1018552181 6:165010238-165010260 GAGACAAAGTATCAGGAGGAAGG - Intergenic
1019227113 6:170522452-170522474 GAGAAAAAGAAGGCGGGGGACGG + Intergenic
1019945372 7:4324541-4324563 GAAGAAAAGGAGAAGGAGGATGG - Intergenic
1020577401 7:9950017-9950039 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1020601958 7:10286742-10286764 GAGAAAAAACAGCATGGGGAAGG + Intergenic
1020742187 7:12035019-12035041 GAGAAAACAGAGAAGGTGAAAGG + Intergenic
1020792217 7:12641248-12641270 GAGAAGAAGTTGCAGGTGGAGGG - Intronic
1021029594 7:15714773-15714795 GAGAGAAAGGAGGAGAAGGAGGG + Intergenic
1021158857 7:17246846-17246868 GAGAAAAAGGAGAAGGTGAAAGG - Intergenic
1021211978 7:17864776-17864798 GAGAAGGAGGAGAAGGGGGAGGG + Intronic
1021622461 7:22562254-22562276 AAGAAGAAGGAGGAGGAGGAGGG - Intronic
1021649405 7:22818998-22819020 TAGAAAAAGGACGGGGTGGAGGG + Intronic
1021717121 7:23470396-23470418 AAGAGAAAGGAGGAGGAGGAGGG + Exonic
1022011005 7:26308216-26308238 GAGAAAAAGGAGCAGGTTGAAGG - Intronic
1022099953 7:27163516-27163538 GAGAGAAGGGAGAAGGCGGAAGG + Exonic
1022253208 7:28629321-28629343 AAGGAAAGGGAGGAGGTGGAAGG - Intronic
1022481005 7:30743032-30743054 AAGAAAGAGGCGCAGGAGGAGGG - Intronic
1022665913 7:32410376-32410398 GAGAAGGAGGAGGGGGTGGAGGG + Intergenic
1022761918 7:33364685-33364707 GAGAAAAGGGCGGAGGGGGAGGG - Intronic
1022782548 7:33601027-33601049 TAGGAAAAGGGGCAGGGGGAGGG + Intronic
1022886617 7:34653338-34653360 GAGAGAAAGGAGGAGGTGCCAGG + Intergenic
1022924268 7:35044297-35044319 GAGAAGAAGGGGCAGGAAGAGGG - Intergenic
1023026336 7:36053846-36053868 GAGGAAGAGGAGGAGGTGGGAGG - Intergenic
1023280692 7:38566055-38566077 AAGGGAAAGGAGCAGGTGGTGGG - Intronic
1023528120 7:41126486-41126508 GAGAAAAACCAGCATATGGATGG + Intergenic
1023873753 7:44276118-44276140 GGGAAAGAGGGGCAGGGGGAGGG + Intronic
1023919716 7:44618695-44618717 GAGAAAAAGCAGCAGGTGAAAGG - Intronic
1024136242 7:46412099-46412121 GAAGAAAAGGAGCAGGTGAAAGG + Intergenic
1024195568 7:47055368-47055390 GAGAAGGAGGAGGAGGAGGAGGG - Intergenic
1024196446 7:47063966-47063988 GAGGAGGAGGAGGAGGTGGAGGG - Intergenic
1024196455 7:47064001-47064023 GAGGAGGAGGAGGAGGTGGAGGG - Intergenic
1024196559 7:47064898-47064920 GAGGAGGAGGAGGAGGTGGAGGG - Intergenic
1024227488 7:47337160-47337182 GAGCAAAAGGATCTGGTGGATGG - Intronic
1024547600 7:50535514-50535536 GCGAAGGAGGAGCACGTGGAGGG + Intronic
1024632313 7:51260037-51260059 GAGAAGAAGGAGCAGAGGAAAGG - Intronic
1024785070 7:52898158-52898180 GAGAGAAAGGAGGAGAGGGAGGG + Intergenic
1024846259 7:53646192-53646214 AAGAAGAAGGAGGAGGAGGAAGG - Intergenic
1025288171 7:57685618-57685640 GAGACCAAGGAGCAGGAGCATGG + Intergenic
1026159064 7:67852834-67852856 GAGAGAAAGGAGGAGGAGGAGGG + Intergenic
1026184382 7:68070800-68070822 GAGAAAAGAGAGCAGGTTGAGGG + Intergenic
1026206234 7:68260278-68260300 GAGACAAAAGAGAAGGAGGAAGG - Intergenic
1026217663 7:68364018-68364040 GAGAAAAAGAAGAAGGAGGAGGG - Intergenic
1026245417 7:68615282-68615304 GAGAAGAAGGAGGAGGAAGAGGG + Intergenic
1026341263 7:69436175-69436197 AAGAAAAATAAGAAGGTGGATGG - Intergenic
1026494079 7:70887904-70887926 GAGAAAGAGAAGAAGGTAGAGGG + Intergenic
1026638776 7:72106565-72106587 GAGAAAAAGAGGAAGGTGGAAGG + Intronic
1026678351 7:72446940-72446962 GAGGAAAAGCAGAAGGGGGAAGG + Intronic
1026802276 7:73407885-73407907 AAGAAAAAGGAGCAGCGGGGTGG + Intergenic
1027190066 7:75991345-75991367 GAGAGGTAGCAGCAGGTGGACGG - Intronic
1027253504 7:76414682-76414704 AAAAAAAAGGAGGAGGAGGAGGG - Intronic
1027529376 7:79311563-79311585 GGGAAATAGGGGCAGGTGGTGGG - Intronic
1028070824 7:86448032-86448054 AAAAAAAAGGAGGAGGAGGAGGG + Intergenic
1028246828 7:88489565-88489587 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1028629439 7:92918585-92918607 AATAAAAAGAATCAGGTGGAAGG - Intergenic
1029094963 7:98077827-98077849 GAGAAAGAGGAGCAGGTACCAGG - Intergenic
1029309641 7:99650730-99650752 GAGGCAGAGGAGAAGGTGGACGG - Intronic
1029519877 7:101053181-101053203 GAGGAAGAGGAGGAGCTGGAGGG - Intronic
1029542336 7:101191232-101191254 GAGAAAAAGGAGCAGGAGAGAGG + Intergenic
1029822576 7:103160063-103160085 GAGAAGAAGGGGCAGGAAGACGG - Intergenic
1029886461 7:103877810-103877832 AAGAAGAAGGAGGAGGAGGAAGG - Intronic
1029906499 7:104098630-104098652 GAGCACAGGAAGCAGGTGGAAGG + Intergenic
1029939769 7:104467829-104467851 GAGAAGGAGGAGCAGGATGAAGG - Intronic
1029983689 7:104902419-104902441 GAGAAGGAGGAGGAGGAGGAGGG + Intronic
1030034445 7:105396689-105396711 GAGGAGAAGGAGGAGGAGGAAGG + Intronic
1030035506 7:105405226-105405248 GAGAAAAAGTAGCAGCTTGGTGG + Intergenic
1030644559 7:112045399-112045421 GAGAAAAATGATGATGTGGAGGG - Intronic
1030814149 7:114013605-114013627 GAGAAAGAGAAAGAGGTGGAGGG + Intronic
1030835394 7:114277769-114277791 CAGAAAGAGGCGGAGGTGGATGG + Intronic
1031616816 7:123891106-123891128 GAAAAGCAGGAGCAGCTGGAAGG - Intergenic
1031943596 7:127815493-127815515 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1031961200 7:127991553-127991575 GAGCAAAATTAGCAGGTAGAAGG - Intronic
1032159668 7:129501015-129501037 GAGAAGAAAGTGCAGGTGGAGGG + Intergenic
1032431825 7:131868290-131868312 GAGAAGAAGGAGCAGGTGAAAGG + Intergenic
1032515033 7:132500461-132500483 GAGAAGAAGAAGGAGGGGGAGGG + Intronic
1032523564 7:132563183-132563205 GAGGAAGAGGAGGAGGAGGAAGG - Intronic
1032733620 7:134669460-134669482 GAGAAAAAGGAGGGGATGGAAGG - Intronic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1033154603 7:138946106-138946128 GAGAAAAGGGAGCAGATGAGAGG - Intronic
1033497601 7:141915552-141915574 TAGAAAATGGAGCAGTAGGAAGG - Intronic
1033839422 7:145356260-145356282 GAGGAAAAGGAGGAAGAGGAGGG - Intergenic
1033932088 7:146536501-146536523 GACACAGAGAAGCAGGTGGAAGG + Intronic
1033983968 7:147200063-147200085 GTGAGAAAGGAGGAGGGGGAGGG - Intronic
1034120299 7:148620727-148620749 GAGTCAAAGGGGCAGCTGGAAGG - Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034912556 7:155009369-155009391 GAGAAAAAGGTGGAGCAGGATGG - Intergenic
1034944105 7:155250879-155250901 GAGAAAAGGGTGCATATGGAGGG + Intergenic
1034945486 7:155259156-155259178 AAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034978901 7:155463399-155463421 AGGAAAAAGGAGAAGGAGGAGGG - Exonic
1035130752 7:156650914-156650936 GAGTAACAGCAGCAGGTGAAGGG - Intronic
1035760446 8:2064777-2064799 GAGGAGAAGGAGGAGGGGGATGG - Intronic
1036078778 8:5529693-5529715 GAGAAAAAGAAGGTGGGGGAAGG + Intergenic
1036429740 8:8679116-8679138 GAGAAAGAGGACCAAGTGAAAGG + Intergenic
1036448446 8:8843648-8843670 GAGAAAAAGAAGAAAGTGAAAGG + Intronic
1036778465 8:11629494-11629516 GAGAAAGCGGTGCAGGTGGGAGG + Intergenic
1036945680 8:13092368-13092390 GAGGAAAAGGATCAGTTCGATGG + Intronic
1037218182 8:16483870-16483892 GAGGAAGAGGAGGAGGAGGATGG + Intronic
1037218195 8:16483930-16483952 GAGGAAGAGGAGGAGGAGGATGG + Intronic
1037271597 8:17136516-17136538 GGGAAAATGGAGCTTGTGGAGGG + Intergenic
1037507022 8:19540789-19540811 GAGAAAGATGATCCGGTGGAGGG - Intronic
1037545500 8:19916131-19916153 CAAAAAAAGCAGCAGTTGGAGGG - Intronic
1037586722 8:20281903-20281925 GAGAGAAAAGAGTTGGTGGAAGG + Intronic
1037773740 8:21818941-21818963 GAGAAAGATGAGGAGGAGGAGGG - Intergenic
1037778864 8:21854159-21854181 GAGAAGGAGGAGGAGGAGGAAGG + Intergenic
1037926645 8:22848638-22848660 GAGAAAAAGAGGCAGGTGGGAGG + Intronic
1038313415 8:26463163-26463185 GAGAAGGAGGAGGAGGAGGAAGG - Intronic
1038339542 8:26673923-26673945 GAGGAAGAGGAGGAGGAGGAGGG - Intergenic
1038398204 8:27262492-27262514 GCGATCAGGGAGCAGGTGGAGGG + Intergenic
1038459664 8:27705206-27705228 GAGAAAGAGGGGCAGGTCGAAGG + Intergenic
1038483642 8:27918788-27918810 GAGAAAGAGGAGGAGGAGGAGGG + Intronic
1038483660 8:27918869-27918891 GGGAAGAAGGAGAAGGAGGAGGG + Intronic
1038568157 8:28636987-28637009 GAAAGAAAGAAGCGGGTGGAGGG + Intronic
1038882201 8:31627561-31627583 GAGAAAAAGAAGGAGGGGGAGGG - Intergenic
1039194112 8:35011249-35011271 GAGATACAGGAGCAGCTGGATGG - Intergenic
1039396280 8:37227900-37227922 GAGAGGAAGGTGCAGGGGGAAGG - Intergenic
1039435988 8:37559566-37559588 GAGGAAAAGAAGGAGGGGGAGGG + Intergenic
1039582088 8:38675219-38675241 GAGACAAAAGAGCAGGGGGGAGG - Intergenic
1039691304 8:39867669-39867691 GAGAAGAAGAAGGAGGGGGAAGG - Intergenic
1039827273 8:41185192-41185214 AAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1039884396 8:41646954-41646976 GAGAAGGAGGAGGAGGGGGAGGG - Intronic
1039962455 8:42260059-42260081 GAGAAACAGGAGCAACGGGAAGG + Intergenic
1040079752 8:43274856-43274878 GAGGAAGAGGAGGAGGGGGAGGG - Intergenic
1041067041 8:54092087-54092109 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1041267607 8:56080332-56080354 AAGAAGAAGGAGGAGGGGGAGGG + Intergenic
1041267616 8:56080364-56080386 GAGGAGAAGGAGAAGGCGGAAGG + Intergenic
1041347883 8:56920442-56920464 GAGAAGACGGAGAAGGAGGAAGG + Intergenic
1041479446 8:58302592-58302614 GAGAAGGAGGAGGAGGTGGAGGG + Intergenic
1041762817 8:61385086-61385108 GAGGAAAGGGAGCAGGAGCATGG + Intronic
1042498440 8:69482589-69482611 GAGAGAGAGGGGCAGGGGGAGGG + Intronic
1042552200 8:70004092-70004114 GAGAAAAGGGAGAAAGTGGTAGG + Intergenic
1042719517 8:71812276-71812298 GAGAGAAAGGAGAAGGCTGAAGG - Intergenic
1042940526 8:74102815-74102837 GACAAGCAGGAGCAGGTGGGTGG + Intergenic
1042949784 8:74189145-74189167 GAAAGAAAGGAGGAGGAGGATGG - Intergenic
1043115602 8:76250045-76250067 GAGAAGAAGGAGGAAGAGGAAGG - Intergenic
1043192025 8:77237596-77237618 GAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1043231916 8:77813903-77813925 GAGATAAAGAATTAGGTGGAGGG - Intergenic
1043385588 8:79744634-79744656 AAGTAAAAGGAGAAGGGGGATGG + Intergenic
1043386432 8:79752561-79752583 GAGGAAAAGGAGGAGGAAGAAGG + Intergenic
1043573383 8:81630215-81630237 GAGAAAAAGCAGCAGATGAAAGG + Intergenic
1043796672 8:84550234-84550256 AAGGAAAAGGAGAAAGTGGAGGG - Intronic
1043855012 8:85255092-85255114 GAGAAGAAGAAGGAGGAGGAAGG - Intronic
1043965687 8:86472452-86472474 GAGAAACAGAAGCAGCTGAAGGG - Exonic
1044478316 8:92654739-92654761 GAAAAAAAGGTGGAGATGGAGGG + Intergenic
1044711680 8:95064694-95064716 AAAAAAAAGGAGCAGGTGAAGGG - Intronic
1044831147 8:96250675-96250697 AAGAAGAAGGAGGAGGAGGAGGG + Intronic
1045130036 8:99140687-99140709 GAGAAGGAGGAGGAGGAGGAGGG - Intronic
1045358607 8:101411788-101411810 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1045680427 8:104653747-104653769 GAGAAAACGGGGCAGGAGGTGGG + Intronic
1045981774 8:108198016-108198038 GAGGAAGTGGAGGAGGTGGAAGG - Intergenic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1046399937 8:113691896-113691918 GAGAAAGAGGAGGAGGAGGAGGG - Intergenic
1047221538 8:122922608-122922630 GAGGAGAAGGAACAGGAGGAAGG - Intronic
1047620720 8:126603833-126603855 GAGAAAAAGGAGTAGGGAAAAGG + Intergenic
1047797004 8:128267835-128267857 GAGGAAGAGGCCCAGGTGGAAGG - Intergenic
1047800209 8:128301286-128301308 AGGGAAAAGGAGGAGGTGGAGGG + Intergenic
1048033536 8:130655167-130655189 GGGTAAAAGGAGTTGGTGGAAGG + Intergenic
1048074462 8:131053958-131053980 CAGAGAAAGGAACAGATGGAGGG - Intergenic
1048297282 8:133223616-133223638 GAGAGAAAGAAACAGGAGGAAGG - Intronic
1048545326 8:135381606-135381628 CAGAAAGAGGCACAGGTGGAAGG - Intergenic
1048941146 8:139401954-139401976 GAGAAGAAGGATAAGGGGGATGG - Intergenic
1049278185 8:141730384-141730406 GAGAGGAAGGAGGAGGAGGAGGG - Intergenic
1049286766 8:141780150-141780172 GAGCAAAAGGAGGTGGTGGGGGG + Intergenic
1049356804 8:142193077-142193099 AGGAAAAAGGAGCAGGAGGGAGG + Intergenic
1049365436 8:142234719-142234741 GGGATGAGGGAGCAGGTGGATGG - Intronic
1049402619 8:142436336-142436358 GCGAAAGGGGAGCAGGAGGAGGG - Intergenic
1049411499 8:142475751-142475773 GAGCAGAAGGGGCCGGTGGAGGG + Intronic
1049571575 8:143372448-143372470 GAGAAACGGGAGCAGGGTGAGGG + Intronic
1049742235 8:144246742-144246764 CTGAAAAGGGAGCAGGTGGTGGG + Intronic
1050106170 9:2169124-2169146 GACAATTAGGAGCAGGTTGAGGG - Intronic
1050210422 9:3248113-3248135 GAGTAGACGGATCAGGTGGAAGG + Exonic
1050475935 9:6041080-6041102 GAGAAGAAGGAGGATGAGGAAGG - Intergenic
1050575831 9:6994311-6994333 GAAGAAAAGCAGCAGGGGGAGGG - Intronic
1051024450 9:12590190-12590212 AAGAAAAGGGAGCTGGTGAATGG - Intergenic
1051078340 9:13266834-13266856 GAGAAAGAGAAGGAGGAGGAAGG + Intronic
1051170386 9:14314705-14314727 GAGAAGGAGGAGGAGGAGGAAGG - Intronic
1051424213 9:16917384-16917406 GAGAAAAGGGACCTGGTGGGAGG + Intergenic
1051765244 9:20515499-20515521 GAGAAAATGGGGGAGGAGGAAGG + Intronic
1052961017 9:34296665-34296687 AAGAAAAAGGTTCAGGTGGTTGG - Intronic
1053184959 9:36008230-36008252 GAGGAGAAGGAGAAGGAGGAGGG - Intergenic
1053330434 9:37201346-37201368 GAAAAGAATGAGAAGGTGGAAGG - Intronic
1053560343 9:39186329-39186351 GAGAGAGAGAAGCAGGAGGAGGG + Intronic
1053824446 9:42006572-42006594 GAGAGAGAGAAGCAGGAGGAGGG + Intronic
1054136775 9:61432626-61432648 GAGAGAGAGAAGCAGGAGGAGGG - Intergenic
1054606125 9:67180791-67180813 GAGAGAGAGAAGCAGGAGGAGGG - Intergenic
1054747227 9:68866867-68866889 GGGAAAAAGGTGCAGATGGTAGG + Intronic
1054973233 9:71113413-71113435 GAGGAAAAGGAGCAGATGAGAGG + Intronic
1055195115 9:73581554-73581576 GAGAAAAAGGAGGAGCAGGAGGG - Intergenic
1055222230 9:73950231-73950253 CAGAAAAAGGAGGTGGTGAATGG - Intergenic
1055238851 9:74159309-74159331 GTCAAAAAGGAGCAAGAGGAGGG + Intergenic
1055298150 9:74854572-74854594 GAGAAGAAGGAGGAGGTTGCTGG - Intronic
1055332012 9:75194593-75194615 GAGAAAAAGTGGGAGGTAGAGGG + Intergenic
1055650376 9:78401109-78401131 GAGAAAAAGGAGAATTTGCAAGG - Intergenic
1056024213 9:82475732-82475754 GAAAAGATGGAGGAGGTGGAAGG + Intergenic
1056672552 9:88642842-88642864 GAGAAGAAGGAGGAGAGGGAGGG - Intergenic
1057002479 9:91524398-91524420 GAGAAAAAGGGGCAGGTGAAAGG - Intergenic
1057021146 9:91698642-91698664 GAGAAAAAGGAGCAGGTGGAAGG - Intronic
1057497397 9:95571919-95571941 GAGGAAGAGGAGCAGAGGGAAGG + Intergenic
1057513061 9:95697017-95697039 TGCAAAAAGCAGCAGGTGGAGGG + Intergenic
1057842978 9:98501139-98501161 AAAAAAAAGGAGCAGGGGGCGGG - Intronic
1058031052 9:100197896-100197918 GAGAAAAAGGATCAGGTGAAAGG + Intronic
1058111091 9:101030943-101030965 GAAAAAAAGAAGCAGGGGGTGGG + Intronic
1058181951 9:101809259-101809281 TAGAACAAAGAGCAGGAGGAAGG + Intergenic
1058561469 9:106233307-106233329 AAGAAAAAGGAGGAGGAAGAAGG - Intergenic
1058715963 9:107722206-107722228 GAGGAGAAGGAGGAGGAGGAAGG - Intergenic
1058913285 9:109541023-109541045 GAGAAGGAGGAGGAGGAGGAAGG - Intergenic
1058944258 9:109841765-109841787 GAGAGAAAGGAGAGGGTGGGGGG + Intronic
1058944298 9:109841883-109841905 GAGATAGAGGAGAAGTTGGAAGG + Intronic
1058956141 9:109950502-109950524 CAGACAGAGGAGCAGGTGTAGGG - Intronic
1059059060 9:111015799-111015821 GAGAAATAGTTGCAGGTAGAAGG - Intronic
1059402069 9:114076817-114076839 GAGGAAGAGGAGGAGGTGGAGGG - Intronic
1059780532 9:117521730-117521752 CAGAAAAAGGACCAGGAGCATGG + Intergenic
1059911142 9:119045577-119045599 GAGAAATAGACCCAGGTGGAAGG + Intergenic
1060110706 9:120904566-120904588 CAGAAACAGGACCGGGTGGAAGG - Exonic
1060431689 9:123556270-123556292 GATAAAAAGGAGTAGGAGGGTGG + Intronic
1060657671 9:125383464-125383486 GAAGAAAAGGATCAGATGGATGG - Intergenic
1061221945 9:129257291-129257313 AATAAAAAGGAGCTGGGGGAGGG - Intergenic
1061347268 9:130036747-130036769 AAGAAAAAGGAGCAGTAGGCCGG + Intronic
1061366953 9:130177120-130177142 GGCACACAGGAGCAGGTGGAGGG + Intronic
1061394083 9:130333759-130333781 GGGCAGAAGGAGCAGGTGGTAGG + Intronic
1061399561 9:130360964-130360986 TAGACAAATGGGCAGGTGGATGG - Intronic
1061656790 9:132098047-132098069 GAGGAAAGGGAGAAGGTGGATGG + Intergenic
1061812310 9:133169411-133169433 GAGAAAAAGGAGCAGGTGAAAGG + Intergenic
1061899681 9:133666509-133666531 GAGAGGAAGGAGGAGGAGGAGGG - Intronic
1062107300 9:134762710-134762732 GAGAAAGAGGAGCAGCTCCAGGG + Intronic
1062527890 9:136985616-136985638 CAAAACAAGGAGCAGGTGGGCGG - Exonic
1185504960 X:625187-625209 GAGGAGAAGGAGGAGGAGGAGGG - Intronic
1185504972 X:625227-625249 GAGTAGAAGGAGGAGGAGGAGGG - Intronic
1185575471 X:1168957-1168979 GAGAAAGAGGAAGAGGAGGAGGG + Intergenic
1185603490 X:1354616-1354638 GAGAAAATGGAGAAAGAGGAGGG + Intronic
1185662142 X:1736001-1736023 GAGAAAGCGGAGGAGGAGGAGGG - Intergenic
1185787482 X:2903110-2903132 GAGAAAAAGAAGAAGGAGAAGGG - Intergenic
1185954860 X:4478252-4478274 GAGAAGAAGGAGGAGGAGGAGGG + Intergenic
1186042302 X:5494300-5494322 CAGAAAAAAGAGCATGTGTAGGG - Intergenic
1186178422 X:6949371-6949393 GAGGAAAAGGATAAGGAGGAGGG - Intergenic
1186730131 X:12401313-12401335 GGGGAAAAGGAGGAGATGGAGGG - Intronic
1186974970 X:14892342-14892364 GAGAGAAAGGAGGAGGTGCCAGG + Intronic
1187111412 X:16304801-16304823 GAGGAAAAGGAGGGGATGGAGGG + Intergenic
1187457816 X:19458273-19458295 GACAAAAAGCAGCAGCTCGAGGG + Intronic
1187735359 X:22297738-22297760 TAGAAAGAAGAGCAGGTGCAGGG + Intergenic
1188036461 X:25322941-25322963 GAGAAAAAGGAGAAAGAGGAAGG - Intergenic
1188505061 X:30873568-30873590 GAAAAAGGGGAGGAGGTGGAAGG - Intronic
1188511793 X:30944019-30944041 GAAAAAAAGGAGTGGGAGGAAGG + Intronic
1188580968 X:31713042-31713064 GAGAAATAGCAGCTGGTGAATGG - Intronic
1188702466 X:33281997-33282019 GAGACATTGGAGCAGCTGGAGGG - Intronic
1188982138 X:36735982-36736004 GAGAAATAGTAGGAGGTGTATGG - Intergenic
1189122673 X:38411726-38411748 GAGACAAAGGAGCAGAGTGATGG - Intronic
1189156493 X:38762469-38762491 GAGAAAGAGGAGGAAGGGGAGGG + Intergenic
1189197072 X:39161922-39161944 GAGAAAGAGGAGGAGGAGGAGGG - Intergenic
1189197098 X:39162060-39162082 GAGAAAGGGGAGGAGGAGGAAGG - Intergenic
1189463860 X:41263444-41263466 GAGAAAAAGGAGCAGGTGAAAGG + Intergenic
1189726740 X:43975088-43975110 GGGAGAAATGAGAAGGTGGACGG - Intergenic
1189887328 X:45561594-45561616 GAGATAAGGGAGGATGTGGAAGG + Intergenic
1190093753 X:47462532-47462554 CAGAACAAGGATCAGCTGGAGGG - Intronic
1190123389 X:47682579-47682601 GAGGAAGAGGAGGAGGAGGAAGG - Intergenic
1190536517 X:51433594-51433616 GAGAAAAATCAGCAGGAGGGGGG - Intergenic
1191148170 X:57190651-57190673 GAGTGCAAGGAGCGGGTGGAGGG - Intergenic
1192034821 X:67550732-67550754 GAGAAAATGGTGGAGGTGGGGGG - Intronic
1192079611 X:68033836-68033858 GAGAAAGAGGAGGAGGTGCCAGG - Intergenic
1192235831 X:69295402-69295424 GAAAGAACGGAGCAGGTAGAGGG + Intergenic
1192486713 X:71533730-71533752 GAGATGAAGGAGGAGATGGAGGG - Intronic
1192533639 X:71910788-71910810 GAGAAAAGAGAGGAGGAGGAGGG + Intergenic
1192637913 X:72837531-72837553 GAGCAAAAGAAGCAGAAGGAAGG + Intronic
1192643801 X:72883284-72883306 GAGCAAAAGAAGCAGAAGGAAGG - Intronic
1194723124 X:97363921-97363943 GAGAACAAGGACCAGGGGAAAGG - Intronic
1194763758 X:97825280-97825302 GAGGAAAAGGAGCAGGTCTGAGG + Intergenic
1194776820 X:97975616-97975638 GAAGAATAGGAGGAGGTGGAGGG - Intergenic
1194830025 X:98612125-98612147 AATAAAAAGGAGCATGTAGATGG - Intergenic
1194847721 X:98832478-98832500 GAGAGAAAGAAGCAGGAGAAGGG - Intergenic
1194989406 X:100530031-100530053 GGGAAAGAGGAGATGGTGGATGG - Intergenic
1195323710 X:103741326-103741348 GAGAAGTTGGTGCAGGTGGAAGG - Intergenic
1195514696 X:105760401-105760423 GAGAGAAAGAAAGAGGTGGAGGG + Intronic
1195696234 X:107669615-107669637 AAAAAAAAGGAGGAGGAGGAGGG - Intergenic
1195878253 X:109564648-109564670 GAAAAGCAGGAGCAGCTGGAAGG - Intergenic
1196491989 X:116278400-116278422 GAGAAAAAAGAAGAGATGGAAGG + Intergenic
1196613341 X:117738873-117738895 AAAGAAAAGGAGCAGGGGGATGG + Intergenic
1196856463 X:119989959-119989981 GAGAAGCAGGAGGAGGAGGATGG + Intergenic
1196899204 X:120366657-120366679 GAGGAAAAGGAGGAGGAAGAGGG + Exonic
1196931804 X:120689193-120689215 GAGTAAAAGGAGCAGGTCCTGGG - Intergenic
1197222107 X:123924244-123924266 TAAAATATGGAGCAGGTGGAGGG - Intergenic
1197759233 X:130015917-130015939 GTGAAAATGGAGAAGGTGGATGG + Exonic
1197812231 X:130455512-130455534 GAGCAAAGGGGGCAGGGGGAGGG - Intergenic
1197856798 X:130921751-130921773 GAGAAAAAGGAGGAAGAGGAAGG - Intergenic
1198184042 X:134237015-134237037 AAGAAATAGGAGCTCGTGGAAGG - Intergenic
1198706172 X:139450819-139450841 AAGAAAAAGGAGGAGAGGGAAGG + Intergenic
1198816636 X:140598529-140598551 GAGATAGAGAAGCAGGTGTAGGG - Intergenic
1199265077 X:145819107-145819129 GAGAGAAAGGTGGAGGTGGTTGG - Exonic
1199266897 X:145838669-145838691 AAGAAAAAGGAGCATTTTGAGGG + Intergenic
1199599802 X:149535214-149535236 GAGGAAAAGGAGGAGGGGGTGGG - Intergenic
1199619730 X:149688372-149688394 GAGAAAAAGAAGAAGGTGAAAGG + Intronic
1199650838 X:149945038-149945060 GAGGAAAAGGAGGAGGGGGTTGG + Intergenic
1199665200 X:150090944-150090966 GAGAATGTGGAGAAGGTGGATGG + Intergenic
1200287590 X:154838486-154838508 GAGAAAAAGGAACAGAATGAAGG + Intronic
1200795112 Y:7333575-7333597 AAAAAAAAGGAACAGGGGGAAGG - Intergenic
1201304631 Y:12540247-12540269 GAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1201454013 Y:14148437-14148459 GAGAAAAAGGAGAAAGGGGTTGG - Intergenic
1202593925 Y:26516373-26516395 GAGAGTAAGGAGGTGGTGGAGGG + Intergenic