ID: 1057024364

View in Genome Browser
Species Human (GRCh38)
Location 9:91724270-91724292
Sequence TGTCCTTGAAGCGGGGCCGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 65}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057024359_1057024364 0 Left 1057024359 9:91724247-91724269 CCAGGCTCGGAGCCGGCTGTGGA 0: 1
1: 0
2: 2
3: 14
4: 156
Right 1057024364 9:91724270-91724292 TGTCCTTGAAGCGGGGCCGCCGG 0: 1
1: 0
2: 0
3: 13
4: 65
1057024357_1057024364 1 Left 1057024357 9:91724246-91724268 CCCAGGCTCGGAGCCGGCTGTGG 0: 1
1: 0
2: 0
3: 15
4: 137
Right 1057024364 9:91724270-91724292 TGTCCTTGAAGCGGGGCCGCCGG 0: 1
1: 0
2: 0
3: 13
4: 65
1057024351_1057024364 28 Left 1057024351 9:91724219-91724241 CCGAGCTGTTGTAGTTGGAAAGG 0: 1
1: 0
2: 1
3: 25
4: 234
Right 1057024364 9:91724270-91724292 TGTCCTTGAAGCGGGGCCGCCGG 0: 1
1: 0
2: 0
3: 13
4: 65
1057024356_1057024364 2 Left 1057024356 9:91724245-91724267 CCCCAGGCTCGGAGCCGGCTGTG 0: 1
1: 0
2: 0
3: 11
4: 148
Right 1057024364 9:91724270-91724292 TGTCCTTGAAGCGGGGCCGCCGG 0: 1
1: 0
2: 0
3: 13
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057024364 Original CRISPR TGTCCTTGAAGCGGGGCCGC CGG Exonic
903224709 1:21887959-21887981 TGTCCCTGCAGTCGGGCCGCCGG + Exonic
905615394 1:39394054-39394076 TGTCTTTGAGGCTGGGCTGCTGG + Intronic
908355649 1:63323245-63323267 TGTCCGTGATGGGGTGCCGCCGG - Exonic
916043625 1:160982060-160982082 TAGGCTTGAAGCGGGGCAGCGGG - Intergenic
918445323 1:184611541-184611563 TGTCCTTGAACCAGGACTGCAGG - Intronic
1072555134 10:96509034-96509056 TGTCCTCGAAGCATGGCAGCTGG - Intronic
1074295499 10:112183789-112183811 TGGCATTGACGCGGGGCCGCCGG + Intronic
1076793586 10:132788541-132788563 TCTCCAGGCAGCGGGGCCGCCGG - Intergenic
1077321357 11:1943755-1943777 TGCCCTTGCAGCGGGGCTCCTGG + Intergenic
1083619172 11:64040525-64040547 TGTCCTTGCAGATGGGCCTCTGG + Intronic
1083961905 11:66019224-66019246 TGTCCTTGAAGCTGGGGGGTGGG - Intronic
1084151935 11:67291702-67291724 TGACCTGGCAGCGGGGCCGGAGG + Exonic
1084171234 11:67401893-67401915 AGGCCTGGAGGCGGGGCCGCGGG - Intronic
1092380244 12:7990230-7990252 TGGTCTTGAAGCGGGGACGTGGG + Intergenic
1095989931 12:48027606-48027628 TGTCAGTTAAGAGGGGCCGCAGG + Intergenic
1096365477 12:51025847-51025869 TTTTGTTGAAGCGGGGCGGCGGG + Intronic
1099926015 12:89018684-89018706 TGTCCATGAAGTGGGGTTGCTGG - Intergenic
1105847739 13:24308029-24308051 TGTCAGCAAAGCGGGGCCGCAGG + Intronic
1107898555 13:44989681-44989703 GGGCCTTGAAGCCGGGCGGCAGG - Exonic
1119779569 14:77269283-77269305 TGTACTGGAAGAGGGGCAGCAGG + Exonic
1121106548 14:91283586-91283608 TGGCCTAGAAGCAGGGCAGCAGG + Intronic
1122740630 14:103869793-103869815 TGTCCATGAAGAGGGGCAGCAGG - Intergenic
1124431457 15:29612293-29612315 TTTCCTTGAAGCTGGCCCCCAGG + Intergenic
1128322452 15:66703095-66703117 TGTCGTCGAAGGGGCGCCGCAGG - Exonic
1131230367 15:90654688-90654710 TGGCCTTGAATCTGGGCCCCTGG + Intergenic
1132517512 16:372671-372693 TGTCCTTGCAGCTGGACCGCAGG - Exonic
1132815849 16:1826313-1826335 GGTCCTTGCAGCGGGGCAGCAGG + Intronic
1132984341 16:2756432-2756454 TGTCCCTGGTGCGGGGCCGCCGG + Exonic
1143981577 17:10874606-10874628 TGTCCTTGCTGCTGGGCCACAGG + Intergenic
1146182584 17:30707616-30707638 AGTCCCTGAAGCGGGGCTGCTGG - Intergenic
1146954220 17:36927658-36927680 CGTCCTTGAAGAGGGGCCGGGGG - Intergenic
1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG + Intronic
1150675898 17:67245597-67245619 CTTCCTGGAAGCGCGGCCGCAGG - Intronic
1151396529 17:73826754-73826776 AGTCCTTGAAGCAGGGCAGGTGG + Intergenic
1152603467 17:81277185-81277207 GGTCCTAGAAGTGGAGCCGCTGG - Intronic
1152705980 17:81843914-81843936 CCTCCTTCAAGCGAGGCCGCAGG + Exonic
1153012839 18:555456-555478 AGTCCTAGAAGCTGGGCCTCAGG + Intergenic
1156463093 18:37332633-37332655 TGTGCTTGAGGCTGGGCCTCTGG - Intronic
1160350710 18:78175875-78175897 TGTCCTAGAAGAGCGGCTGCAGG + Intergenic
1161054916 19:2185946-2185968 TGTCCTCGGAGCGGAGCGGCTGG - Intronic
1162976238 19:14208189-14208211 AGTCCCTGAAGCGGGGCTGCTGG + Intergenic
1164943071 19:32266606-32266628 TGTCCTTGAAGCAGGGCCCACGG + Intergenic
1166382443 19:42362080-42362102 TGTCCTTTAGGCTGGGCTGCGGG + Exonic
925386410 2:3464869-3464891 TGCCCTTGAGGAGGGGCCACGGG + Intronic
931235650 2:60410616-60410638 TGTCCTTGAAGGTGAGCCTCGGG - Intergenic
938101204 2:128499327-128499349 TGCCCTTGAAGAGGGGCAGGGGG + Intergenic
948194810 2:236087366-236087388 TGTCCTTGGAGCAGGGCTGTCGG - Intronic
1169848766 20:10026606-10026628 TGTCCTTACAGCGTGGCAGCTGG + Intronic
1181466267 22:23112298-23112320 TGTGCTTGGGGCGGGGCCGAAGG - Intronic
1184022894 22:41833047-41833069 CGGCCTGGAGGCGGGGCCGCAGG + Intergenic
1184147078 22:42617984-42618006 TGTTCTTAAAACGGGGCAGCAGG - Exonic
1184404597 22:44292785-44292807 GGTCCTTGAAACTGGGCAGCTGG + Intronic
1184421420 22:44384817-44384839 TGGCCTGAAAGTGGGGCCGCGGG + Intergenic
1184889863 22:47373087-47373109 TGTCCTGGACGTGGGGACGCCGG - Intergenic
1184944794 22:47795560-47795582 TGTCCCTGAGGCCGGGCCGATGG + Intergenic
956680928 3:71780042-71780064 TTCCCTAGAAGAGGGGCCGCTGG - Intronic
956787572 3:72655294-72655316 TGTCCTTGCAGCGGGGAGGCCGG + Intergenic
961542309 3:127608444-127608466 CGTCCTTGGAGCGGGGCAGCCGG - Exonic
962688235 3:137868044-137868066 TGTCCTTGTAGCGGGGACTTTGG - Intergenic
969291409 4:6242425-6242447 TGTCCTTGGAGCAGGGTCCCTGG + Intergenic
969527715 4:7712436-7712458 TGTCCATCAAGCGGGGCCACTGG + Intronic
972396927 4:38665000-38665022 TGTCCTGGGAGGGGGGCGGCGGG - Intronic
973789561 4:54365466-54365488 TGGCCTTGAATCTGGGCTGCTGG + Intergenic
980333698 4:131441269-131441291 TGTCCTGGAAGTGGGGCCCACGG + Intergenic
992152013 5:73914244-73914266 TGTCCTTTGAGAGGGGCAGCTGG + Intronic
995864357 5:116675635-116675657 TTTCCTTGGAGCGGGGAGGCAGG - Intergenic
1022465682 7:30652167-30652189 TGTCCCTGCAGCGGAGCCGCAGG - Intronic
1023203638 7:37724812-37724834 TGTCCTTGAGGTGGGGCCTATGG + Intronic
1024259492 7:47563209-47563231 AGTCCTTGAAGGGGGGCTCCAGG - Intronic
1030187696 7:106779680-106779702 TGTCCTTCAAGCCAGGCCCCAGG - Intergenic
1037767661 8:21782009-21782031 TGTCCTGGAAGCAGGGAGGCAGG + Intronic
1043929544 8:86075157-86075179 TGTCCTTGCAGCATGGCAGCTGG + Intronic
1055107152 9:72525036-72525058 TGTCCTTGAAGCCGGCCTTCTGG - Intronic
1057024364 9:91724270-91724292 TGTCCTTGAAGCGGGGCCGCCGG + Exonic
1059917618 9:119121205-119121227 CGTCCTTGAAGCAGGTCCCCTGG + Intergenic
1060998213 9:127886766-127886788 TGCGCTGGAGGCGGGGCCGCTGG + Exonic
1062500297 9:136849217-136849239 TTTCCTTTAAGCGGGGCTGGCGG + Exonic
1062718573 9:138023296-138023318 TGTCCTTGTCGCGGTGCCGGTGG - Exonic
1193905296 X:87236762-87236784 TGTCCTTGCAGAGGGGCTGATGG - Intergenic