ID: 1057025093

View in Genome Browser
Species Human (GRCh38)
Location 9:91728850-91728872
Sequence GTGGAGTGGCATGCAGCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 5, 3: 40, 4: 284}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057025093 Original CRISPR GTGGAGTGGCATGCAGCTGT GGG (reversed) Intronic
901052000 1:6429947-6429969 GTCGAGTCACATGCTGCTGTGGG - Intronic
901509504 1:9709564-9709586 GTGTAGTGGTGTGCACCTGTAGG + Intronic
901537573 1:9892452-9892474 GTGCAGTGGCTTGCACCTGTAGG + Intronic
901855473 1:12041800-12041822 GAGGAGTGGAATGGAGGTGTGGG - Intergenic
902286870 1:15412742-15412764 TGGAAGTGGCATGCAGCTGAGGG + Intronic
902424048 1:16305247-16305269 GCGTGGTGGCATGCACCTGTGGG + Intronic
902482233 1:16718067-16718089 GTCGAGTCACATGCTGCTGTGGG + Intergenic
903020369 1:20389575-20389597 CTGGAGTGGCCTCCAGATGTGGG + Intergenic
907074182 1:51563943-51563965 GTGTGGTGGCATGCACCTGGTGG + Intergenic
907391795 1:54163045-54163067 CTGGAGAGGCAGGCAGCTGGGGG + Intronic
910015598 1:82519568-82519590 GAGGAGTGGGATGCAGGTGTGGG + Intergenic
911173677 1:94796823-94796845 GTGTGGTGGCATGCACTTGTAGG + Intergenic
911475902 1:98371940-98371962 GGGGTGTGGCATGTTGCTGTTGG + Intergenic
918222092 1:182444424-182444446 GTGGGATGGCATGCATGTGTTGG + Intergenic
918247415 1:182672079-182672101 GTGCAGAGGGAGGCAGCTGTGGG - Intronic
919750028 1:201031799-201031821 GTGGAGTGGTCTGCAGGTGGGGG - Intergenic
920848933 1:209615555-209615577 CTGGAGAGGCATGAAGCTGGAGG - Intronic
921584191 1:216928605-216928627 GGTCAGTGGCATGCAGCTGGAGG - Intronic
922807300 1:228397081-228397103 GTGGGGTGGGACCCAGCTGTTGG - Intronic
923712272 1:236396833-236396855 GTGGAGTGGGATGGGGCAGTAGG - Intronic
924404755 1:243730895-243730917 GTGGTGGGGCAGGCAGCTCTGGG - Intronic
1062946049 10:1463016-1463038 GTGGGGTGGGACGCAGCTGGTGG + Intronic
1064218174 10:13417740-13417762 GGGGAGTAGCATGCGGCTGGTGG + Intergenic
1064524112 10:16235174-16235196 GTGGATTGGCCTGCAGGAGTGGG + Intergenic
1064666730 10:17660610-17660632 GTGCAGTGGCTTGCACCTGTAGG + Intronic
1064842335 10:19607819-19607841 GTGGGCTGGGATACAGCTGTTGG - Exonic
1066117827 10:32256020-32256042 GTGTGGTGACATGCAACTGTGGG - Intergenic
1066419284 10:35249069-35249091 GAGTGGTGGCATGCACCTGTTGG - Intronic
1068711579 10:60140969-60140991 GGGGAGTGGCATGGAGCTCCAGG + Intronic
1068827635 10:61456805-61456827 GTGGAGTACCATGCAGCTGTGGG + Intergenic
1069019933 10:63474992-63475014 GTGAAGTGGCATGAAGGTGCTGG + Intergenic
1069316809 10:67114888-67114910 GTGGAGTTTAATGCAGCTTTGGG + Intronic
1069504055 10:68980858-68980880 ATGTAGTGGCATGCACCTGTAGG + Intronic
1069691938 10:70359413-70359435 GTGTGGTGGCATGCACCTGTGGG + Intronic
1069998907 10:72361490-72361512 ATGGAATACCATGCAGCTGTGGG + Intergenic
1070629492 10:78074858-78074880 GCGTGGTGGCATGCACCTGTAGG - Intergenic
1070996043 10:80783630-80783652 GTGGATTCACATGCAGTTGTAGG + Intergenic
1071097375 10:81993483-81993505 TTGTGGTGGCATGCATCTGTAGG - Intronic
1071342290 10:84660043-84660065 GGGGAGTGGCCTGCAGCTGAAGG - Intergenic
1071949577 10:90687370-90687392 GTCGAGACGCATGCAGCTGCAGG + Intergenic
1072607421 10:96996478-96996500 GTGGCCTGGCAGTCAGCTGTGGG - Intergenic
1073370218 10:102981527-102981549 GTGTGGTGGCATGCACCTGTGGG - Intronic
1075122243 10:119672589-119672611 GTGGAGTGGCGTGCTGCTCCTGG - Exonic
1075388239 10:122073257-122073279 GGGGAGTGGCATGCAGCCCCGGG + Intronic
1075912709 10:126139653-126139675 GGGGAGTGGCATCCAGGGGTGGG + Intronic
1078346539 11:10554628-10554650 GTGGAGTGGGAGGCAGTTTTGGG + Intergenic
1078919518 11:15816502-15816524 GTGGAGGGGCAGGAAGGTGTTGG + Intergenic
1079304025 11:19306732-19306754 GTGGTGTTCCCTGCAGCTGTAGG - Intergenic
1081044017 11:38249938-38249960 GTGGAGGGGCAGGCAGCTCCAGG + Intergenic
1081885103 11:46488612-46488634 GTGGAGTGTCCTGTAGATGTCGG - Intronic
1083378458 11:62244872-62244894 GTGGAGTGGCCTTTTGCTGTGGG + Intergenic
1083607959 11:63990186-63990208 GTGGAGAGGCAGGCAGCAGTGGG + Intronic
1083977392 11:66134403-66134425 GTGTAGTGGCAGGCACCTGTAGG - Intronic
1084080036 11:66816698-66816720 GTGCACTGGCATGCATCTGTAGG - Intronic
1084287461 11:68141373-68141395 GTGCAGTGGCAGGCAGGGGTGGG + Intergenic
1085017737 11:73186205-73186227 GTGGAGTGGGTTGCAGCTGAGGG - Intergenic
1085147260 11:74212562-74212584 GTGGAGCAGCTTGCAGCTCTGGG + Intronic
1086903573 11:92394331-92394353 GGGTGGTGGCATGCACCTGTAGG + Intronic
1087654253 11:100903557-100903579 GTGGAGTGGCTAGAAGCTGATGG - Intronic
1088781351 11:113136871-113136893 ATGGAGTGGAATGGCGCTGTGGG + Intronic
1088924133 11:114283321-114283343 ATGCAGTGGCATGAAGCAGTGGG + Intronic
1089723970 11:120456857-120456879 GTGTGGTGGCACGCAACTGTAGG + Intronic
1090396174 11:126420084-126420106 ATGGAGTGGCAGGCAGATATTGG + Intronic
1090826513 11:130390928-130390950 ATGTGGTGGCATGCACCTGTAGG - Intergenic
1091706739 12:2698987-2699009 GTGGAGGGGCTTGCAGCAGTGGG - Intergenic
1091730873 12:2879140-2879162 GTGTAGTGGCATGTGCCTGTAGG - Intronic
1092194283 12:6540045-6540067 GTGGAATAGAATGCAGCTGGAGG - Exonic
1096625250 12:52891348-52891370 CTGGTGTGGGATGCAGGTGTAGG + Intergenic
1096915469 12:55027266-55027288 GTAATGTGGCATGAAGCTGTAGG - Exonic
1097172311 12:57123461-57123483 CTGTGGTGGCATGCATCTGTAGG - Intronic
1097932620 12:65206099-65206121 GTGCAGTGTTTTGCAGCTGTTGG + Intronic
1102360585 12:112284351-112284373 CAGGACTGGCCTGCAGCTGTGGG + Intronic
1102808939 12:115807140-115807162 GTGTGGTGGCATGCATCTGTGGG - Intergenic
1104071494 12:125349902-125349924 GGGAAGTGGCAGCCAGCTGTCGG + Exonic
1104894968 12:132159556-132159578 GTGGAGGGGCATGGAGGTGTGGG + Intergenic
1107175251 13:37392201-37392223 CTGGAGTGGGAAGAAGCTGTTGG + Intergenic
1108102441 13:46970917-46970939 GTGTGGTGGCATGCACCTGTAGG + Intergenic
1108796938 13:54043678-54043700 GTGTAGTGGTGTGCACCTGTAGG + Intergenic
1112334109 13:98499790-98499812 GGAGTGTGGAATGCAGCTGTGGG - Intronic
1112672067 13:101652278-101652300 GTGTGGTGGCATGCACCTGCAGG - Intronic
1112893643 13:104270194-104270216 GTGTAGTGGCATGCACCTGTAGG - Intergenic
1113263619 13:108592659-108592681 GTGGAGTGGGGTGGGGCTGTGGG + Intergenic
1113856069 13:113446110-113446132 GAGGGGGGGCCTGCAGCTGTGGG - Intronic
1114444988 14:22781537-22781559 CTGGGGTGGCCTGGAGCTGTGGG - Intronic
1114788554 14:25629247-25629269 GTGGAGTGGCAGGAAGCAGATGG + Intergenic
1118738656 14:68721993-68722015 GGGGACTGGCATGGAGGTGTTGG - Intronic
1120490008 14:85165329-85165351 GTTCAGTGTCTTGCAGCTGTAGG - Intergenic
1120595663 14:86432175-86432197 GTGGAGTGGCTTGGAAATGTTGG + Intergenic
1121329454 14:93040782-93040804 GTGGGGCCGTATGCAGCTGTAGG + Intronic
1121780618 14:96619557-96619579 GTGTGGTGGCGTGCACCTGTGGG + Intergenic
1122158709 14:99767461-99767483 GTGTGGTGGCACGCACCTGTAGG + Intronic
1126127653 15:45310393-45310415 GTGTGGTGGCATGCATCTGTGGG + Intergenic
1127334119 15:57966880-57966902 GTGGAGTCGCATCCTGTTGTAGG - Intronic
1129338442 15:74868679-74868701 GTGTGGTGGCATGCACCTGTGGG - Intronic
1130942475 15:88523019-88523041 GTGTGGTGGCATGCGCCTGTCGG - Intronic
1131666791 15:94579507-94579529 CTGGAGTGGCAGGCAGATGGAGG + Intergenic
1131869685 15:96749892-96749914 GTGCAGTGGCATGATGATGTCGG + Intergenic
1132472506 16:113556-113578 GGGTGGAGGCATGCAGCTGTGGG + Intronic
1132525848 16:414274-414296 GTGTGGTGGCATGCACCTGTAGG - Intergenic
1132923982 16:2417703-2417725 GTGTAGTGGCCTGCTCCTGTAGG + Intergenic
1133472934 16:6093298-6093320 GTGCAGTGGCTCGCACCTGTAGG + Intronic
1133971202 16:10569455-10569477 GTATGGTGGCATGCACCTGTAGG - Intronic
1134454679 16:14386363-14386385 ATGGTGTGGCATGCACTTGTGGG - Intergenic
1135332867 16:21575589-21575611 GTGTGGTGGCATGCATCTGTAGG + Intergenic
1135625425 16:23990684-23990706 GTGTGGTGGCATGCACTTGTAGG - Intronic
1135637768 16:24093595-24093617 GTGGAGTGGGATTCAGCTTCTGG + Intronic
1136342490 16:29654090-29654112 GTGCAGTGGCATACGCCTGTGGG - Intergenic
1137450266 16:48567366-48567388 GTGCAGTGGCACGCAGATCTTGG + Intronic
1140272649 16:73480547-73480569 ATGGAGTGGCAGGCAGCAGAGGG + Intergenic
1141149815 16:81556215-81556237 GTGGGGTGGAAGGCAGATGTTGG + Intronic
1141680880 16:85543085-85543107 GTGCAGTGGCAGGCGCCTGTAGG + Intergenic
1141891126 16:86927036-86927058 GTGGACAGGGGTGCAGCTGTGGG + Intergenic
1142145730 16:88492276-88492298 GTGGGGTGGGGAGCAGCTGTGGG - Intronic
1203119865 16_KI270728v1_random:1527649-1527671 GTGGAGTGACGGGCACCTGTGGG - Intergenic
1142543556 17:681273-681295 GTGTGGTGGCATGCACCTGTAGG - Intronic
1150534449 17:66021346-66021368 GTGGTGTGCAATCCAGCTGTGGG + Intronic
1151195864 17:72430795-72430817 CGGGCGTGGCATGCTGCTGTTGG - Intergenic
1151741685 17:75987218-75987240 TGGGAGTGGCATCCAGATGTTGG + Intronic
1152359560 17:79825154-79825176 GTGGAGAGGAAGGCTGCTGTGGG - Intergenic
1152483968 17:80577414-80577436 GTGTGGTGGCATGCACCTGTAGG - Intronic
1152697846 17:81805410-81805432 GTGGCCCGGCAGGCAGCTGTGGG + Intronic
1153034256 18:744526-744548 GCGTGGTGGCATGCACCTGTAGG - Intronic
1155125074 18:22866249-22866271 GTGTGGTGGCACGCACCTGTAGG + Intronic
1156045140 18:32869706-32869728 GTGAAGCGGCATGCCACTGTTGG + Intergenic
1156213190 18:34969493-34969515 GTATGGTGGCATGCACCTGTAGG - Intergenic
1156240001 18:35243966-35243988 GTGCAGTGGGATGCAGTTGAAGG + Intronic
1156388222 18:36625804-36625826 GGAGAGTGGCAGGCACCTGTGGG - Intronic
1157767032 18:50307229-50307251 GTGGAATGTGATGGAGCTGTGGG - Intergenic
1157878271 18:51294117-51294139 GTGGAGTGGACTGCAGAGGTCGG + Intergenic
1159685366 18:71412085-71412107 GTGCAGTGGCACACACCTGTAGG + Intergenic
1161066600 19:2241608-2241630 TTGGCGTGGCCTGCAGCTGACGG + Intronic
1161220920 19:3117795-3117817 GTGCTGTGGGATGCAGCTGGAGG + Intronic
1161569264 19:5021454-5021476 GTGTGGTGGCATGTACCTGTGGG + Intronic
1162065028 19:8120306-8120328 GTGTGGTGGCGTGCACCTGTAGG - Intronic
1162849803 19:13422180-13422202 GTGTAATGGCATGCACCTGTGGG + Intronic
1162860108 19:13499992-13500014 TTGGAGTGGGAGGCATCTGTTGG - Intronic
1163285340 19:16343471-16343493 ATGCAGTGGCATGCACCTGTAGG + Intergenic
1163808110 19:19412491-19412513 GTGTGGTGGCATGCATCTGTAGG + Intronic
1164458133 19:28426218-28426240 GCATAGTGGCATGCACCTGTAGG + Intergenic
1166041321 19:40204669-40204691 TTGGAGTGGCAGGGACCTGTGGG + Intronic
1166230335 19:41422764-41422786 GGGGAGCGGCAGGCACCTGTAGG - Exonic
1167449945 19:49561190-49561212 GTGGACTGGCAGGCAGCGATTGG - Intronic
1167528586 19:50000839-50000861 GTGGAGGTGGGTGCAGCTGTGGG + Exonic
1168000639 19:53443323-53443345 ATGGATTGGCATGGAACTGTTGG + Intronic
1168291504 19:55359750-55359772 GTGGAGAGGCAGGCAGCCGGGGG + Exonic
925122816 2:1432505-1432527 GTGGAGAGGCCTGCAGGTGAGGG + Intronic
925278320 2:2665912-2665934 GGGGAGTGGCAGCCAGCAGTCGG - Intergenic
925587051 2:5474870-5474892 GTGGAGAGGCAGGCATGTGTGGG - Intergenic
927191229 2:20518395-20518417 GTGGAGTGGCAGGGTTCTGTTGG + Intergenic
927996150 2:27488119-27488141 GTGTGGTGGCAAGCACCTGTAGG - Intronic
928207329 2:29295411-29295433 GTGGAGCTGCATGCAGTTGGTGG - Intronic
929557502 2:42934680-42934702 GTGGAGTGGCACAAAGCTGTTGG - Intergenic
929666970 2:43840778-43840800 ATGGAGTGGGATGGAGCTGAGGG - Intronic
930415209 2:51082121-51082143 GTGTAATTGCATGAAGCTGTTGG + Intergenic
930563840 2:52995004-52995026 CTGGAGAGGCTTGCAGCTGGGGG - Intergenic
930633186 2:53776678-53776700 GTGTAGTGGCATGCACCTGTAGG + Intronic
931398345 2:61908059-61908081 GTGGAGTGGCATGGCTCTCTTGG + Intronic
931455095 2:62403610-62403632 GGTGAGTGGCATACACCTGTAGG - Intergenic
932592802 2:73077195-73077217 GGGGAGTGGGATGCACCTGAGGG - Intronic
932732567 2:74231540-74231562 GTGTAGTGGCTTGTAGCTGGGGG + Intronic
932803123 2:74760455-74760477 GTTGAGTGGCATGAAGATATGGG + Intergenic
932843281 2:75105380-75105402 GTGGAGGGGAATGGAGATGTTGG + Intronic
932884172 2:75533002-75533024 GTATGGTGGCATGCACCTGTGGG + Intronic
935024319 2:99261634-99261656 GTGGAGGAGCAGGCAGGTGTGGG + Intronic
935773506 2:106449876-106449898 GTGTGGTGGCAGGCACCTGTAGG + Intronic
935973927 2:108558807-108558829 GTGTGGTGGCATACAACTGTAGG - Intronic
937518066 2:122678437-122678459 TTGGGGTGTCATGCAGTTGTAGG + Intergenic
938267602 2:129939629-129939651 GTGTAGTGGCACACACCTGTAGG + Intergenic
938894734 2:135738757-135738779 GTGGTGTGGAATGCTGCTGTTGG - Intergenic
940944913 2:159605164-159605186 GTGTGGTGGCATGCACCCGTAGG - Intronic
941568305 2:167137176-167137198 TTGGAGTGGGAGGCAGGTGTAGG + Intronic
941689340 2:168482687-168482709 GTGCAGTGGCACGGAGCTGAAGG + Intronic
941952536 2:171171389-171171411 GTGCAGTGGTATGCACCTGTAGG + Intronic
942190385 2:173463511-173463533 GTGGAGGGGCAGGCACCTATTGG - Intergenic
943085131 2:183301571-183301593 GTGGAGAGGCATGGAGAAGTGGG - Intergenic
943406931 2:187500798-187500820 GTGAAGTGGCATGGCACTGTGGG - Intronic
943676122 2:190717873-190717895 GTGAAGTGGGAGGCATCTGTGGG + Intergenic
944536744 2:200717710-200717732 GTGTAGTGGCTTGCGTCTGTGGG + Intergenic
946618386 2:221533962-221533984 ATGGAGTGTCACGCAGATGTGGG - Intronic
947153580 2:227138177-227138199 GTGTAGTGGCATGTACCTGTAGG + Intronic
947398244 2:229707554-229707576 GTTTAGTGGGGTGCAGCTGTGGG - Intronic
1169220116 20:3817487-3817509 CTGGAGAGGCATGGAGCTTTAGG - Intergenic
1169456938 20:5760299-5760321 GTGAAGTGGAGTGCAGGTGTGGG + Intronic
1172586234 20:36087071-36087093 GTCAAGTGGCCTGCATCTGTGGG - Intergenic
1173731949 20:45335317-45335339 ATGTGGTGGCATGCACCTGTAGG - Intronic
1174251603 20:49224015-49224037 GCGCAGGGGCATGCACCTGTAGG - Intronic
1174356425 20:50001303-50001325 GTGTAGTGGCATGCACCTGTAGG - Intergenic
1175412182 20:58777617-58777639 GTGGAGAAGCAGACAGCTGTTGG - Intergenic
1175527811 20:59647538-59647560 TTGGAGTGACATGCAGGTGGGGG + Intronic
1175811111 20:61857702-61857724 GTAGAGTCACATGCAGTTGTAGG + Intronic
1175980960 20:62738365-62738387 GGGGAGAAGCCTGCAGCTGTGGG + Intronic
1176530961 21:7957537-7957559 GTGGAGTGGAATGCAGTGGAGGG - Intergenic
1178847178 21:36183548-36183570 ATGCAGTGTCTTGCAGCTGTTGG + Intronic
1179025991 21:37678790-37678812 GTGGTGAAGCATGTAGCTGTTGG + Intronic
1180948627 22:19710338-19710360 GTGCAGGGGCATGAAGCTGCAGG + Intergenic
1181746990 22:24962386-24962408 GAGGATTGGCATGGAGCTGAGGG + Intronic
1181767830 22:25104438-25104460 GAGGAGGGGAAGGCAGCTGTAGG + Intronic
1182786551 22:32912580-32912602 GGGTGGTGGCATGCACCTGTAGG + Intronic
1183047216 22:35229702-35229724 CTTGAGTGGCAAGAAGCTGTGGG + Intergenic
1183511691 22:38239168-38239190 GTGGAGGGGCAGGCAGATGGGGG - Intronic
1183820312 22:40340733-40340755 GTGTAGTGGTGTGCACCTGTAGG + Intergenic
1184074825 22:42169676-42169698 GTGGAGGGGCATGATGCTGAAGG - Intronic
1184499553 22:44863533-44863555 GAGGAGTGGCAGGCCGCTGCAGG + Intergenic
1184554291 22:45224948-45224970 GTGGGGTGGCCTGCAGATGCTGG + Intronic
1185219778 22:49623516-49623538 GTGGCCTGGCTGGCAGCTGTGGG - Intronic
1185402605 22:50626663-50626685 ATGGAGCTGGATGCAGCTGTGGG - Exonic
1203306935 22_KI270736v1_random:115775-115797 GTGGAGTGGAATGGAGAGGTTGG + Intergenic
1203309473 22_KI270736v1_random:132547-132569 GTGGAGTGGAGTGGAGCTGAGGG + Intergenic
949376062 3:3391727-3391749 GTGGCCTGCCAGGCAGCTGTGGG + Intergenic
950240834 3:11368643-11368665 GTGTGGTGGCACGCACCTGTGGG + Intronic
950396351 3:12737015-12737037 GTGTGGTGGCATGCACTTGTAGG - Intronic
950935509 3:16835081-16835103 GTGACGTGGTATGCATCTGTAGG - Intronic
951017783 3:17748522-17748544 GTGTGGTGGCAGGCACCTGTAGG - Intronic
952105324 3:30064055-30064077 GTGGGGAGCCATGCAGCTATTGG + Intergenic
953032288 3:39186658-39186680 GAGGAGCAGCGTGCAGCTGTTGG - Exonic
953860760 3:46542355-46542377 GTGTGGTGGCATGCACCTGTTGG + Intronic
954506170 3:51076321-51076343 ATGTGGTGGCATGCACCTGTAGG + Intronic
954920103 3:54183320-54183342 TTGGAGTGGTAAGCAGCTGTGGG + Intronic
955910992 3:63860109-63860131 GTGGAGTGGAACACACCTGTAGG - Intronic
956879103 3:73492263-73492285 GTGGATGTGCAGGCAGCTGTGGG + Intronic
957368554 3:79259269-79259291 ATGGTGTTGCATGCAGCTGCTGG - Intronic
959766259 3:110033185-110033207 GTGTGGTGGCAGGCACCTGTGGG - Intergenic
960466421 3:118001434-118001456 TTGGAGTGGAAGGCAGCTGTAGG - Intergenic
960821722 3:121740346-121740368 GTAGAGTCACATGCAGTTGTAGG - Intronic
961313155 3:126016615-126016637 ATGGAGTGAAATGTAGCTGTGGG - Intronic
961738757 3:129018975-129018997 CTGGAGTGGCAGGCAGTTGGAGG - Intronic
962319221 3:134377046-134377068 GTGCAGTGGGATGCAGCTGCAGG - Intergenic
962578598 3:136777008-136777030 GTGTGGTGGCATGTACCTGTAGG + Intergenic
965270988 3:166617291-166617313 GTGGGGTGGCATGCATCTGTAGG + Intergenic
967784161 3:193471878-193471900 GTGGGGTGGCAGGCTGCTCTGGG + Intronic
970463887 4:16304113-16304135 GTGGAGAGGCCTGTAGCTGCAGG + Intergenic
971348545 4:25835219-25835241 GTCGAGTGGCCTCCAGCTCTCGG + Exonic
972495423 4:39629760-39629782 GTGTGATGGCATGCACCTGTGGG - Intronic
972694654 4:41433844-41433866 GTGGAGTGGCATGTCCCTATAGG + Intronic
976780930 4:88758358-88758380 GGCGACTGGCATGCAGCAGTGGG + Intronic
979010889 4:115366524-115366546 GTGGAGGGGCAGGCAGCTCCAGG - Intergenic
979067480 4:116156596-116156618 GTAGACTGTCATGGAGCTGTGGG + Intergenic
984632989 4:182079955-182079977 GTGAAGTTGCGTGAAGCTGTGGG - Intergenic
985671294 5:1208319-1208341 CAGGAGTGGCACGCTGCTGTTGG + Intronic
986603894 5:9502515-9502537 CTGGAGTCGCTTTCAGCTGTGGG + Intronic
989845113 5:46131401-46131423 GTGGAGTGCAATGCAGCTCAAGG + Intergenic
990739527 5:58898022-58898044 GTGGAGTGGCATGGTGAGGTTGG + Intergenic
991189809 5:63857018-63857040 GTGGTGTGGGGTGCAGCTGGAGG + Intergenic
992354431 5:75966650-75966672 GAGTAGTGGCATGTGGCTGTTGG - Intergenic
992819769 5:80484737-80484759 GTGCAGTGGCACGCACTTGTAGG - Intergenic
996295041 5:121903138-121903160 GGAGAGTGGCATCCTGCTGTAGG + Intergenic
997271314 5:132540656-132540678 TGGGTGTGGGATGCAGCTGTGGG - Intergenic
999748776 5:154610923-154610945 GTGGTGGAGCAGGCAGCTGTGGG - Intergenic
1000052037 5:157571769-157571791 GTGGAGAGGAATGAAGCGGTGGG + Intronic
1000726875 5:164782851-164782873 GTGCAGTGGCATGATGATGTTGG + Intergenic
1000961229 5:167603540-167603562 GTGTAGTGGCATACACCTGTGGG + Intronic
1002117482 5:176974671-176974693 GTGTAGTGGCATGTGCCTGTAGG + Intronic
1002529264 5:179834217-179834239 ATGGTGTGGCAGGCAGCAGTGGG + Intronic
1005979135 6:30822967-30822989 GTGAAGTGGGATGCAGCTCCTGG + Intergenic
1006713769 6:36100032-36100054 GTACTGTAGCATGCAGCTGTGGG + Intronic
1006719239 6:36139352-36139374 CCGGAGTGGCATGAAGCTGTAGG + Exonic
1008738935 6:54581226-54581248 GTGTGGTGGCTTGCACCTGTAGG - Intergenic
1010107499 6:72186990-72187012 GTGTGGTGGCATGCGCCTGTAGG + Intronic
1010182179 6:73099859-73099881 GTGGAGTATTCTGCAGCTGTTGG - Intronic
1012335648 6:98053293-98053315 GTGTGGTGGTATGCACCTGTAGG - Intergenic
1012433109 6:99186794-99186816 GAGGGATGGCATGCACCTGTTGG - Intergenic
1012943784 6:105444549-105444571 GTGGAATGGTCTGCTGCTGTGGG + Intergenic
1013053745 6:106562964-106562986 GTATAGTGGCATGCACTTGTGGG - Intronic
1015996522 6:139000207-139000229 CTGGAGAGGGATTCAGCTGTGGG - Intergenic
1016395516 6:143619690-143619712 GTGCAGAGGCATGCAGCAGGTGG - Intronic
1016971046 6:149764599-149764621 GTGTGGTGGCATGCACATGTAGG + Intronic
1017404176 6:154099144-154099166 GCGCGGTGGCATGCACCTGTAGG + Intronic
1018943932 6:168332133-168332155 GTTCTGTTGCATGCAGCTGTTGG + Intergenic
1019196217 6:170284603-170284625 CTGGAGTGGCCGGCACCTGTGGG + Intronic
1019312528 7:369681-369703 GGGGCTTGGCACGCAGCTGTGGG - Intergenic
1019538411 7:1540559-1540581 GTGGACCGGCGTGCAGCTCTGGG - Exonic
1020271173 7:6597121-6597143 GTGGAATGGGAGGCAGGTGTTGG + Intronic
1022825783 7:34011956-34011978 GTTGAATGTCATGCAGCAGTTGG + Intronic
1023510433 7:40946488-40946510 GGGGAGTAGCAAGCAGCAGTAGG + Intergenic
1023927493 7:44680429-44680451 ATGGAGTGTCTTGCAGTTGTAGG + Intronic
1024104479 7:46068250-46068272 GTGAATTCCCATGCAGCTGTAGG + Intergenic
1024192971 7:47031277-47031299 GTGGAGGGGCTTGGAGCTGTGGG + Intergenic
1026524680 7:71143736-71143758 GTGGGTTGGAATGCAGCAGTAGG + Intronic
1028313745 7:89373432-89373454 GTGGAGTGACCTGCAGTGGTTGG + Intergenic
1029233741 7:99094861-99094883 GGGGAGTGGGACCCAGCTGTAGG - Intronic
1030524312 7:110635215-110635237 TGTGAGTGGCAGGCAGCTGTGGG - Intergenic
1031227076 7:119052960-119052982 GGGGAGTGGATTCCAGCTGTAGG + Intergenic
1031237549 7:119196452-119196474 GTGGAGAGGCTTGGAGGTGTGGG + Intergenic
1032829162 7:135605161-135605183 GCGTGGTGGCATGCACCTGTAGG - Intronic
1032846364 7:135755020-135755042 CTGCTGTGGCCTGCAGCTGTGGG + Intergenic
1033279508 7:139995748-139995770 GTGCTGTGCCATGCAGTTGTGGG - Intronic
1034503376 7:151466529-151466551 GCGCAGTGGCCTGCAGATGTTGG - Exonic
1034855689 7:154544586-154544608 GTGGAGGGGCATTCAGCACTGGG + Intronic
1035004200 7:155643544-155643566 GTGGAGAGGCATGAAACTGGAGG - Exonic
1035125620 7:156606798-156606820 GTGGGGTGGTGTGCAGGTGTGGG - Intergenic
1035236913 7:157503226-157503248 TTGGAGGGGCACGCAGCAGTTGG + Intergenic
1035555547 8:564711-564733 GTGGAGGGGCACCTAGCTGTGGG - Intergenic
1036194722 8:6704193-6704215 GTGAAATGGTATGCAGCAGTTGG - Intergenic
1038767085 8:30438910-30438932 GTGTGGTGGCATGCGCCTGTAGG - Intronic
1040444468 8:47479534-47479556 GGGGAGTGGAATTCCGCTGTGGG - Intronic
1040551777 8:48443597-48443619 GTGTAGTGGAAGGCAGCTGGTGG + Intergenic
1044887814 8:96798266-96798288 GTGTGGTGGCATGCACCTGTGGG - Intronic
1047051155 8:121115014-121115036 GTGTGGTGGCATGCACCTGTAGG - Intergenic
1047231606 8:123002344-123002366 GGGGAGAGGCAGGCAGCTGGAGG - Intergenic
1048445304 8:134488752-134488774 GTGGGGTGGGAAGCAGCTGGTGG + Intronic
1049149490 8:141025428-141025450 GTGCAGTGACATGCAGAGGTTGG - Intergenic
1049728730 8:144164541-144164563 GCATAGTGGCATGCACCTGTAGG - Intronic
1050987113 9:12096265-12096287 GCGGAGTGGGAGGCAACTGTGGG - Intergenic
1051417090 9:16853269-16853291 CCGTGGTGGCATGCAGCTGTAGG + Intronic
1051472099 9:17455718-17455740 GGGGAGTGGCAGGCAGGTTTGGG + Intronic
1051472123 9:17455798-17455820 GGGGAGTGGCAGGCAGGTTTGGG + Intronic
1056988702 9:91389579-91389601 GTGTGGTGGCATGCACCTATGGG - Intergenic
1057025093 9:91728850-91728872 GTGGAGTGGCATGCAGCTGTGGG - Intronic
1057194818 9:93111081-93111103 TAGGAGCGCCATGCAGCTGTGGG - Intronic
1057526534 9:95808023-95808045 GTGGTCTGCCCTGCAGCTGTTGG - Intergenic
1058782121 9:108348428-108348450 GTGGAGTGGAAACCAGCTCTGGG + Intergenic
1060346924 9:122825298-122825320 GTGTGGGGGCATGCGGCTGTAGG - Intronic
1061191201 9:129083722-129083744 ATTGAGTCTCATGCAGCTGTAGG + Intronic
1202800663 9_KI270719v1_random:171744-171766 GTGCACTGACATCCAGCTGTTGG + Intergenic
1203610304 Un_KI270748v1:90232-90254 GTGCAGTGGCATACACCTGTAGG + Intergenic
1185855626 X:3532215-3532237 GTAGAGTGGCATCCAGTTGGTGG - Intergenic
1186812708 X:13205968-13205990 ATGGAGCTGCATGGAGCTGTGGG + Intergenic
1187314141 X:18176538-18176560 GTATGGTGGCATGCACCTGTGGG + Intronic
1187342432 X:18433087-18433109 GTGCAGTGGTGTGCACCTGTAGG + Intronic
1190575519 X:51832731-51832753 GTGGGGAGGCATGCAGAAGTAGG - Intronic
1193221317 X:78929772-78929794 GTAGAGTGGGGTGCTGCTGTAGG - Intergenic
1195425203 X:104721331-104721353 ATGGAGTGCTATGCAGCTATAGG + Intronic
1197641178 X:128969972-128969994 GTGGAGTGGGAGGTATCTGTTGG - Intergenic
1197940720 X:131786009-131786031 GCGTGGTGGCATGCACCTGTGGG + Intergenic
1199608615 X:149595399-149595421 GCGGTGGGGCATGCAGCTGTTGG + Intergenic
1199630507 X:149773961-149773983 GCGGTGGGGCATGCAGCTGTTGG - Intergenic
1201106614 Y:10768046-10768068 GTGGAGTGGAATGGAGTTGAAGG - Intergenic
1201106929 Y:10770266-10770288 GTGGAATGGAATGCAGATGAGGG - Intergenic
1201135240 Y:10985449-10985471 GTGGAGTGGAATGGAGTTGAGGG - Intergenic
1201506754 Y:14710377-14710399 GTGCAGTGGCACACACCTGTAGG + Intronic