ID: 1057025973

View in Genome Browser
Species Human (GRCh38)
Location 9:91734009-91734031
Sequence CTCTGGAAGGTTCTGTGATA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057025966_1057025973 22 Left 1057025966 9:91733964-91733986 CCAAGAGGGTGAGAGCAGCAAAG 0: 1
1: 0
2: 2
3: 23
4: 304
Right 1057025973 9:91734009-91734031 CTCTGGAAGGTTCTGTGATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057025973 Original CRISPR CTCTGGAAGGTTCTGTGATA AGG Intronic
No off target data available for this crispr