ID: 1057026055

View in Genome Browser
Species Human (GRCh38)
Location 9:91734425-91734447
Sequence GATTGAACTGCATTCGTGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 44}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057026055_1057026061 6 Left 1057026055 9:91734425-91734447 CCACCCACGAATGCAGTTCAATC 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1057026061 9:91734454-91734476 TTACAGATTTGGCGATTATTTGG No data
1057026055_1057026063 21 Left 1057026055 9:91734425-91734447 CCACCCACGAATGCAGTTCAATC 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1057026063 9:91734469-91734491 TTATTTGGTGATTATACAGAGGG No data
1057026055_1057026062 20 Left 1057026055 9:91734425-91734447 CCACCCACGAATGCAGTTCAATC 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1057026062 9:91734468-91734490 ATTATTTGGTGATTATACAGAGG No data
1057026055_1057026058 -5 Left 1057026055 9:91734425-91734447 CCACCCACGAATGCAGTTCAATC 0: 1
1: 0
2: 0
3: 2
4: 44
Right 1057026058 9:91734443-91734465 CAATCCCATCATTACAGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057026055 Original CRISPR GATTGAACTGCATTCGTGGG TGG (reversed) Intronic
901752263 1:11417631-11417653 AACTGAACTGCATACGAGGGTGG - Intergenic
902803406 1:18845638-18845660 AACTGACCTGGATTCGTGGGTGG + Intronic
909110102 1:71464596-71464618 GACAGAACTGCATTCTTGGGAGG - Intronic
916092652 1:161319891-161319913 GATTGAAAGGAATTTGTGGGAGG + Intronic
920150043 1:203898918-203898940 GATGGAACTGGATTACTGGGAGG + Intergenic
924641520 1:245837739-245837761 GATTGAACTGAATTCCCCGGGGG - Intronic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1086156070 11:83667343-83667365 GATTGACATGCATTCCTGGAGGG + Intronic
1094578244 12:31708257-31708279 GAAAGAATTGCATTCCTGGGGGG + Intronic
1099846799 12:88037063-88037085 GATTGAGCCTCATTAGTGGGAGG - Intronic
1112043344 13:95570319-95570341 CATTGATCTCCATTCGTGTGTGG - Intronic
1112325596 13:98441044-98441066 GATATGACTGCATTTGTGGGAGG - Intronic
1116156154 14:41209060-41209082 TTTTGAACTGCATAGGTGGGAGG + Intergenic
1121190424 14:92023744-92023766 CATTCAACTGCATTCGTCTGTGG - Intronic
1147904974 17:43816719-43816741 GATGGAACAGCATTAGTGGAGGG + Intronic
1147991284 17:44335125-44335147 GATTAAAATGCATTTGTGGCCGG + Intergenic
1153132748 18:1875878-1875900 TATTGAACTGCATTACTAGGGGG + Intergenic
1162817434 19:13204550-13204572 TAGTGAACTTCATTCCTGGGAGG + Intergenic
926252477 2:11163308-11163330 GATAGAACAGAATTGGTGGGGGG + Intronic
932949596 2:76277374-76277396 GAGTCAACTGCATTCCTGGTTGG - Intergenic
1176302795 21:5106743-5106765 ACTTGAACTGCATGCGTGCGCGG - Intergenic
1179854229 21:44155180-44155202 ACTTGAACTGCATGCGTGCGCGG + Intergenic
1181536214 22:23547344-23547366 GAAAGAATTGCATTCCTGGGGGG + Intergenic
1181893790 22:26088370-26088392 GATTGAAGTGTATTCATTGGGGG + Intergenic
965823894 3:172711252-172711274 GTTTGTACTGCATGCGTGTGAGG + Intergenic
966241478 3:177759158-177759180 TATTGAGCTGCATTCCTGGGAGG + Intergenic
969639958 4:8391324-8391346 GTTAGAACTGCAGTGGTGGGCGG + Intronic
977548408 4:98413184-98413206 GAAGGAATTGCATTCCTGGGGGG - Intronic
982480145 4:155898700-155898722 GAAAGGAATGCATTCGTGGGGGG - Intronic
983991332 4:174123631-174123653 GAATGAACAGCAATCTTGGGGGG + Intergenic
987255020 5:16141916-16141938 GATATTGCTGCATTCGTGGGGGG + Intronic
992809206 5:80370095-80370117 TATTAAAATGCATTGGTGGGGGG + Intergenic
993654131 5:90557513-90557535 GATTGAACAGCTTTCCTGTGAGG - Intronic
997302476 5:132815330-132815352 GATTGGGCTGCAGTCTTGGGCGG - Exonic
1002758549 6:183906-183928 GGTTGAACTTCATGGGTGGGTGG - Intergenic
1011889469 6:92139095-92139117 GATTGAACTAAATTAGTGGTTGG - Intergenic
1023790228 7:43748225-43748247 GACTGAACTGGAGTGGTGGGTGG + Intergenic
1024484528 7:49903130-49903152 GAGTAAACTGGATTCGTGGTTGG + Intronic
1024656213 7:51453345-51453367 AAGTGGACAGCATTCGTGGGCGG - Intergenic
1033792753 7:144811743-144811765 GATTGAACTGGATGGGTGGTTGG - Intronic
1037728127 8:21500937-21500959 CTTTCAACTGCATTTGTGGGTGG - Intergenic
1041942308 8:63402264-63402286 GATTCATCTGCATTCCTGTGCGG + Intergenic
1057026055 9:91734425-91734447 GATTGAACTGCATTCGTGGGTGG - Intronic
1061722637 9:132562232-132562254 GTTCAAACTGCATTTGTGGGAGG - Intronic
1189195878 X:39152126-39152148 TATTTAACTGCAATCCTGGGGGG + Intergenic
1195009426 X:100720771-100720793 AATTGAATTGCATACGTGGCAGG + Intronic
1201616760 Y:15909037-15909059 GAAAGAAATGCATTCCTGGGGGG - Intergenic