ID: 1057028546

View in Genome Browser
Species Human (GRCh38)
Location 9:91755918-91755940
Sequence GGGTGGCCACGTGCTTGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057028546_1057028555 28 Left 1057028546 9:91755918-91755940 CCTAAGCAAGCACGTGGCCACCC 0: 1
1: 0
2: 2
3: 12
4: 113
Right 1057028555 9:91755969-91755991 AATTCGGCAAAGACATGAGCTGG 0: 1
1: 0
2: 0
3: 5
4: 86
1057028546_1057028553 12 Left 1057028546 9:91755918-91755940 CCTAAGCAAGCACGTGGCCACCC 0: 1
1: 0
2: 2
3: 12
4: 113
Right 1057028553 9:91755953-91755975 CAGCCAACTTCTAGCAAATTCGG 0: 1
1: 0
2: 1
3: 10
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057028546 Original CRISPR GGGTGGCCACGTGCTTGCTT AGG (reversed) Intronic
900529810 1:3147668-3147690 GGGTGCCCAGATCCTTGCTTGGG - Intronic
905295402 1:36951456-36951478 GGGTGGCCACGTGACTGCTGGGG + Intronic
907084873 1:51662206-51662228 GGCTGGCCAATTGCTTGGTTAGG + Intronic
910485258 1:87706007-87706029 GTGTGGACAGGGGCTTGCTTGGG + Intergenic
911027118 1:93447936-93447958 GGGTGACCAGGTGCCCGCTTGGG + Intergenic
913174643 1:116262785-116262807 GTGTGTCCACGTGCATGCTAGGG + Intergenic
914679236 1:149927560-149927582 GGGTGGCCGGGTGCTGGCTGAGG - Intronic
919027510 1:192196020-192196042 GGGTAGTCACATGCTTGCTTAGG + Intergenic
919619797 1:199851810-199851832 TGGTGGCCACTTGCTGGTTTTGG - Intergenic
922794773 1:228334631-228334653 GGGTGGCCATGGGCTGGCTCAGG + Intronic
922934125 1:229410731-229410753 GGGTTGACACCTGCTGGCTTAGG - Intergenic
923473283 1:234310961-234310983 TGGTGGCCACTTGATTGGTTTGG + Intronic
1067757563 10:49016464-49016486 AGGGGGCCATGTGCATGCTTAGG + Exonic
1068600153 10:58948320-58948342 GCTTGGCCACGTTTTTGCTTGGG + Intergenic
1069508578 10:69023140-69023162 GGATGGCCACGTGCATGGGTGGG - Intergenic
1070421231 10:76239185-76239207 GGGTGGCCAGCTGCTTGCTTGGG + Intronic
1076008675 10:126968997-126969019 ATGTGGCAATGTGCTTGCTTTGG + Intronic
1076578643 10:131491474-131491496 GGGAGGCCACGTGTGTGCCTGGG + Intergenic
1076611693 10:131730041-131730063 GGGTGGCCCCGTCCTTGGTCTGG + Intergenic
1076767789 10:132646132-132646154 GTGTGGCCACGAGCCTCCTTGGG + Intronic
1076809763 10:132880383-132880405 GGGTGGCCAAGGGCCTGCTGAGG + Intronic
1077112221 11:866834-866856 GGGTGGCCACGTGCTGGCTGCGG + Exonic
1077457813 11:2691565-2691587 GGGAGGCCTCGTCCTTGCTGAGG - Intronic
1077866136 11:6223351-6223373 GGGTAGGCAAATGCTTGCTTTGG - Intronic
1084118879 11:67057297-67057319 GTGTGGCCAAGTGCTGTCTTAGG - Intronic
1084750403 11:71201200-71201222 GGGAGGGCACGTGGTTGCTGTGG - Intronic
1088810059 11:113386181-113386203 GGGAGGCCCCCAGCTTGCTTTGG - Intergenic
1091118948 11:133040685-133040707 GAGGGGCCTCTTGCTTGCTTGGG + Intronic
1097262566 12:57727735-57727757 GGATGGCCACGGCCTCGCTTTGG + Exonic
1098486296 12:71025804-71025826 GGGTGTCCACATGCATGCTGGGG - Intergenic
1103515631 12:121506397-121506419 GTGTGGCCAGATGCTTGCCTGGG - Intronic
1103980947 12:124736618-124736640 GGGTGGCCGGGTGCATGCATGGG - Intergenic
1104866788 12:131960750-131960772 GGGTGCCGACGGGCTTGCTGAGG - Exonic
1105556329 13:21449556-21449578 GGCTGGCCTTGTACTTGCTTTGG - Intronic
1112333180 13:98492619-98492641 GGGTGGCCACAGGCTTCCTTAGG + Intronic
1113422268 13:110180005-110180027 TCATGGCCACCTGCTTGCTTTGG - Intronic
1113780774 13:112975912-112975934 GGGAGGCCAGGAGCTTGCTATGG - Intronic
1114183425 14:20383266-20383288 GGGTGCCCACGTGCTGGCCTTGG - Exonic
1115217331 14:31026249-31026271 GGGTGGCCCCGCGCTGGCTGCGG + Exonic
1122415959 14:101549571-101549593 GGGTGGCCAGGAGCTTTCTCAGG - Intergenic
1122829604 14:104389353-104389375 GGCTGGCCATGTGCTGGCTGAGG - Intergenic
1125427675 15:39566031-39566053 GAGTGGCCAAGAGCTTGCTTGGG - Intergenic
1125720701 15:41843833-41843855 GGGTGTCCCCGGGCTTGCTTGGG + Intronic
1128147852 15:65342562-65342584 GGGAGTCCACGACCTTGCTTCGG - Intronic
1129674338 15:77624418-77624440 GGGTGGCCGAGTGCGTGCCTAGG - Intronic
1130032427 15:80328059-80328081 GGCTGGCCTCGTGATTGCTTTGG - Intergenic
1135550598 16:23395187-23395209 AAGTGGCCACTTGCTTACTTTGG - Intronic
1138360372 16:56423253-56423275 GGGTCTCCACGTGTTTACTTTGG - Intronic
1140887055 16:79253523-79253545 GAGAGGCCACGTGCTAGCTTCGG - Intergenic
1142561430 17:811643-811665 GGCTGGCCACCGGCTTCCTTCGG - Intronic
1142712762 17:1732427-1732449 AGGTGGCCACGGGCTCGCTCAGG - Exonic
1152251965 17:79217012-79217034 GGGGGGCCCCCTGCCTGCTTTGG - Intronic
1152357638 17:79814536-79814558 TGGTGGCCACGTGCTCCCCTGGG - Intergenic
1153828172 18:8896375-8896397 GTGAGGCCAGGGGCTTGCTTGGG - Intergenic
1154218042 18:12429850-12429872 GTGTGGCCATGTACTGGCTTGGG - Intronic
1155377974 18:25182206-25182228 GGGTTGCCTCCTGCTTGCTGCGG - Intronic
1157692518 18:49695190-49695212 GGAGGGGCACATGCTTGCTTTGG + Intergenic
1159202809 18:65209149-65209171 GGGTGGCAACATTATTGCTTGGG + Intergenic
1161966296 19:7550969-7550991 GGGGGGCCGCGTGCATGATTGGG - Intronic
1163513937 19:17751705-17751727 GGGTGGCCCCATGCAGGCTTTGG - Intronic
1166669347 19:44700801-44700823 GTATGGCCACATGCTTTCTTTGG - Intronic
925405937 2:3605492-3605514 GGGCGGCCACGTGGGTGCTGAGG + Intronic
926342430 2:11914802-11914824 AGGTGGCAACGGGCTTTCTTGGG + Intergenic
928305896 2:30170166-30170188 GGGTGGCTAGGTGCTTGGCTTGG - Intergenic
931706924 2:64954141-64954163 GAGCGGCCATGTACTTGCTTTGG - Intergenic
935291989 2:101618821-101618843 GGGTGGACACGTCCTTCCTCTGG + Intergenic
940536558 2:154952849-154952871 GGATGTCCCAGTGCTTGCTTTGG - Intergenic
941388050 2:164877507-164877529 GGGTGGCCCAGTGATTGCTGGGG + Intergenic
946549566 2:220786339-220786361 GCTTGGCCTCGTGCTTGTTTGGG + Intergenic
948646712 2:239409899-239409921 TGGTGGCCATGTGGGTGCTTGGG + Intergenic
1169995799 20:11554747-11554769 CTGTGGCCACTTCCTTGCTTGGG + Intergenic
1172232715 20:33347913-33347935 GGGTGGACACCTGCCTCCTTTGG - Intergenic
1175287782 20:57849381-57849403 GTGTGGCCACGTGGTTGCCTGGG + Intergenic
1177888534 21:26776544-26776566 GAGTGGCCTCGTGCTTCCCTAGG + Intergenic
1178760099 21:35393958-35393980 GGGTGCTCACCTACTTGCTTTGG - Intronic
1179940959 21:44638694-44638716 GGGGGGCCACGTGCTGGGGTTGG - Intronic
1181019682 22:20092903-20092925 AGCTGGTAACGTGCTTGCTTGGG + Exonic
1181166384 22:20985580-20985602 TGGTGGCCACATTCATGCTTTGG + Intronic
1181640085 22:24191672-24191694 GGGTGGCCGAGTGCCTGCTGTGG + Intergenic
952732109 3:36649494-36649516 GAGTGGCCATGTTCTTGCTATGG + Intergenic
955419289 3:58720930-58720952 GTGTGTCCACATGCTTGCTTGGG + Intronic
956716909 3:72087279-72087301 GGGTGGCCTGGTTCTTGCTGAGG - Intergenic
964078392 3:152720932-152720954 GGGGGTCCACATACTTGCTTTGG + Intergenic
969663792 4:8545412-8545434 GGATGGCCATGTGCCTGGTTAGG - Intergenic
969725439 4:8915627-8915649 GGGTGACCACCTGCCTCCTTGGG - Intergenic
975023521 4:69520630-69520652 GGCTGGACATGTGCATGCTTGGG + Intronic
977370242 4:96126071-96126093 GGGTTGCCAGCTGCTGGCTTGGG + Intergenic
985906588 5:2842387-2842409 GGGTGTCCTTGTGCTTGCCTAGG - Intergenic
987257316 5:16169290-16169312 AGGTGGCCAAGTGCTTAATTTGG - Intronic
990609228 5:57441039-57441061 GGTTGGCCAGGTCCTTGCTGTGG - Intergenic
996607703 5:125343549-125343571 GGCTTGCCACGTTCCTGCTTGGG - Intergenic
999595832 5:153203137-153203159 GGGTGGTCATGTGGCTGCTTAGG - Intergenic
1000702889 5:164474812-164474834 TAGTGGCCACCTGCTTGCCTTGG - Intergenic
1002429188 5:179193183-179193205 TGGGGGCCACCTGCTTGCCTTGG - Intronic
1004650119 6:17600422-17600444 GGGTGGCCTCGGGCTTCCTCGGG - Exonic
1006446217 6:34081211-34081233 GGGTGCCCAGGAGCTTGCCTGGG - Intronic
1006742491 6:36319535-36319557 GGGTGGCTACCAGCTTGCTGAGG + Exonic
1015277109 6:131394792-131394814 AGGAGGCCACATGCATGCTTAGG - Intergenic
1019221579 6:170477674-170477696 GGGTGGACACAGGATTGCTTGGG + Intergenic
1022571929 7:31462848-31462870 GTGTGGCCATGAGATTGCTTTGG + Intergenic
1022985328 7:35648591-35648613 GAGTGGCCATGTGATTGCTTTGG + Intronic
1024604518 7:51012994-51013016 TGGTGTCCACTTGCTTGATTGGG - Intergenic
1027390540 7:77699129-77699151 GGGTGACCAAGTGTTTGTTTAGG + Intronic
1030596938 7:111551528-111551550 GTGTGGTCACTTGCTTGCTTTGG + Intronic
1031594052 7:123627108-123627130 AGGTGGTGATGTGCTTGCTTTGG + Exonic
1031669463 7:124525134-124525156 GGGTGCACACGTGTTTGCTGTGG + Intergenic
1035628684 8:1092336-1092358 TGGTGGCCACGTGGATGCGTAGG + Intergenic
1038567916 8:28635173-28635195 GGGTGGCAACGTTCCTGCCTGGG + Intronic
1043567447 8:81563023-81563045 GGGTGGCCACAGGGGTGCTTGGG + Intergenic
1044774946 8:95678167-95678189 GGGTGGCCATGGGCTGGCCTGGG + Intergenic
1047312449 8:123704103-123704125 GGTTTCCCACGTGCGTGCTTAGG - Intronic
1048165428 8:132058052-132058074 GGGTGGCCAGCTTCTTGCTAGGG + Intronic
1049386476 8:142345381-142345403 GGGTGGCAGAGTGCTTGCTGTGG - Intronic
1055455197 9:76465631-76465653 GGGTGGCCACATGATTGCACAGG - Intronic
1057028546 9:91755918-91755940 GGGTGGCCACGTGCTTGCTTAGG - Intronic
1057444464 9:95104054-95104076 TGGTGGCCAGATGGTTGCTTTGG - Intronic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic
1060175435 9:121494175-121494197 GGGTGTGCACGTGCTTCCTGGGG - Intergenic
1062443620 9:136584311-136584333 GCGTGGCCAGGGGCTTCCTTGGG + Intergenic
1062488480 9:136792631-136792653 GGGTGCCCACGTGGCTGCTGTGG - Intronic
1189640901 X:43068858-43068880 TGGTGGCCACGGGGGTGCTTGGG + Intergenic
1194325673 X:92513877-92513899 GGGTGGCCACAGTCTTTCTTGGG - Intronic
1195348689 X:103976437-103976459 GGGTGGCACCGTTCTGGCTTGGG + Intergenic
1195358753 X:104062403-104062425 GGGTGGCACCGTTCTGGCTTGGG - Intergenic
1198833479 X:140776533-140776555 GGGTGGTCACGCGCGGGCTTGGG - Intergenic
1199951579 X:152711124-152711146 TGGTGGTTCCGTGCTTGCTTTGG + Intergenic
1199958104 X:152757324-152757346 TGGTGGTTCCGTGCTTGCTTTGG - Intergenic
1200634402 Y:5633044-5633066 GGGTGGCCACAGTCTTTCTTGGG - Intronic