ID: 1057030270

View in Genome Browser
Species Human (GRCh38)
Location 9:91769763-91769785
Sequence CAGATCATGAAGGTACTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057030270_1057030275 -9 Left 1057030270 9:91769763-91769785 CCCTCCAGTACCTTCATGATCTG 0: 1
1: 0
2: 0
3: 23
4: 205
Right 1057030275 9:91769777-91769799 CATGATCTGAGGTCCTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057030270 Original CRISPR CAGATCATGAAGGTACTGGA GGG (reversed) Intronic
901145942 1:7064720-7064742 CAGAGCATGCTGGTACTGGAGGG + Intronic
902546766 1:17195144-17195166 CAGATCATGAGGGATCAGGATGG + Intergenic
904855898 1:33498113-33498135 CAGAACATGATGGTAGTGGGTGG - Intergenic
905071621 1:35230813-35230835 CAGATCATGAATGGTCTTGAAGG + Intergenic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
907021249 1:51068599-51068621 CAGATCATGAAGGGTCTTGTGGG - Intergenic
908223787 1:62035837-62035859 CATATTAAGAAGGTCCTGGAAGG + Intronic
909934961 1:81540688-81540710 CAGATCATACAGGTACTGACAGG + Intronic
910296800 1:85655147-85655169 AATATCATGGAGGCACTGGATGG - Intronic
911160225 1:94676449-94676471 CCGGGCATGAAGGTACAGGAAGG + Intergenic
913995655 1:143650402-143650424 AAGATCAAGAAGGTCCCGGAAGG + Intergenic
919438349 1:197592547-197592569 AGGATCATGAAGGAACTAGACGG + Intronic
919733753 1:200931316-200931338 CAGATCATGAAGGGTCTTGTGGG - Intergenic
919793271 1:201305924-201305946 CAGAACATGGAGCTCCTGGAGGG + Intronic
921222610 1:212983956-212983978 GAGATAATGGAGGTACTGAAAGG - Intronic
922013615 1:221619991-221620013 AAAATTATGAAGGCACTGGAAGG - Intergenic
923061761 1:230481849-230481871 CACAACATGAAGGAACCGGAGGG + Intergenic
924377182 1:243423920-243423942 GAGATCATGAATGTAAAGGATGG + Intronic
924945841 1:248846501-248846523 CAGACCCTGAAGTTACTGAAGGG - Intronic
1063930460 10:11023508-11023530 CAGAGCATGAGGATATTGGATGG - Intronic
1064074487 10:12257956-12257978 GAGGTCCTGAGGGTACTGGATGG - Intergenic
1065412207 10:25442016-25442038 CAGACCATGAAGGAGCTAGAAGG + Intronic
1065427363 10:25619501-25619523 CTGATGATGTAGGCACTGGAGGG - Intergenic
1065690115 10:28324154-28324176 TAGGTCATGAAGGTTCTGAATGG + Intronic
1065839104 10:29685792-29685814 CAGATCATGATGGAAAGGGAGGG - Intronic
1067375372 10:45723288-45723310 CAGAGAAAGAAAGTACTGGAAGG + Intergenic
1067450460 10:46379000-46379022 CAGATGATGGAGGTGATGGAAGG + Intronic
1067586782 10:47480751-47480773 CAGATGATGGAGGTGATGGAAGG - Intronic
1067883181 10:50064915-50064937 CAGAGAAGGAAAGTACTGGAAGG + Intergenic
1069365410 10:67690222-67690244 CAGATCATGAACCCACTGGGAGG - Intronic
1071172943 10:82889011-82889033 CAGATCGGGAAGGTCCTTGAAGG + Intronic
1076162431 10:128255826-128255848 CAAATTATGAAGGTGGTGGAGGG + Intergenic
1076168396 10:128300549-128300571 CAGAGCAAGAAGGTACTGGCAGG - Intergenic
1078409543 11:11101878-11101900 AAGATCAAGAAGGTAGTGCAAGG + Intergenic
1081025243 11:38004671-38004693 AAGATCATGAACCCACTGGAAGG + Intergenic
1087286559 11:96270743-96270765 CATTACAGGAAGGTACTGGAGGG - Intronic
1088280055 11:108126432-108126454 CAGATCATGCAGGTTCTTGGAGG + Intronic
1090628462 11:128625933-128625955 CAGAGCATGAAGGCACAGAAAGG + Intergenic
1091607086 12:1962516-1962538 CAGAACATTAAGTTCCTGGAGGG + Intronic
1093547405 12:20365379-20365401 AAGATCATGAAGGTCCTTGTAGG + Intergenic
1093699125 12:22198048-22198070 AAGATCATGAAGGTAGGTGAAGG - Exonic
1095909270 12:47409372-47409394 CAGATCATGGAGGGCCTGGAAGG - Intergenic
1097400544 12:59123622-59123644 TAGATAAAGAAGGTAATGGATGG + Intergenic
1097962317 12:65544862-65544884 CAGATCATGAAGGGACTTCTAGG - Intergenic
1098573917 12:72019298-72019320 AAGGTCATGGAGGTACTGCATGG - Intronic
1099371706 12:81839858-81839880 CAAAGCATGAAGGAACTAGAAGG - Intergenic
1101085272 12:101229259-101229281 CACATAATGAAGATTCTGGAGGG - Intergenic
1101625848 12:106440448-106440470 CAGATTGTGCAGGAACTGGAAGG - Intronic
1102950834 12:117030134-117030156 CACGTCATGAAGGTTCTGGAAGG + Intronic
1104418031 12:128611635-128611657 CAGAATATGTAGATACTGGAGGG + Intronic
1104632353 12:130414114-130414136 CAGATCATCAAGGTGCGGGATGG - Exonic
1105014278 12:132776653-132776675 CAGGGCAGGAAGGAACTGGAAGG - Exonic
1105340017 13:19513884-19513906 AAGAGCATGAAGGTGGTGGAGGG - Intronic
1105874663 13:24541295-24541317 CAGAGCCTGACGGTACTGGGCGG - Intergenic
1106402465 13:29443503-29443525 CAGATGAAAAAGCTACTGGAGGG + Intronic
1106587744 13:31072038-31072060 AAGATCATGATGGTACTAGATGG - Intergenic
1107053548 13:36078425-36078447 CAGATCATCAAGGGCTTGGAGGG - Intronic
1107163733 13:37262050-37262072 TGGAATATGAAGGTACTGGAAGG - Intergenic
1108522306 13:51257575-51257597 AAGATCTGGAAGGGACTGGAAGG - Intronic
1108686867 13:52827181-52827203 GAGATCATGAAGCTACCAGAAGG + Intergenic
1109121615 13:58464838-58464860 CAGATGAGCAAGGTAATGGAAGG - Intergenic
1109700742 13:66021587-66021609 CAGATCTTGTAGGTACTTTAAGG - Intergenic
1110332815 13:74292504-74292526 CAGGTCATGTAGATTCTGGAAGG - Intergenic
1111540187 13:89659056-89659078 AAGAACATGAATGTTCTGGAGGG - Intergenic
1112340815 13:98551629-98551651 CAGTTCCTGAAGGTGCTGGTGGG - Intronic
1112437904 13:99404673-99404695 CAGGGCATGAAGGTACGAGAGGG - Intergenic
1115862350 14:37701349-37701371 CAGATCATGAAGGTGCGGCATGG - Intronic
1116715834 14:48425309-48425331 GAGATCATGAAGGAAGTGAAAGG + Intergenic
1118376961 14:65185790-65185812 CAGATCGAACAGGTACTGGATGG - Intergenic
1118850627 14:69580531-69580553 CACCTCAGGAAGGCACTGGAAGG - Intergenic
1121044685 14:90779026-90779048 CAGCTCATGACTGTGCTGGAGGG + Intronic
1121674846 14:95744099-95744121 CAGAACAAGAAGGTAGAGGAAGG + Intergenic
1123457655 15:20440511-20440533 CTGCTCATGAAGGTCGTGGAAGG - Intergenic
1123479295 15:20616153-20616175 CACATAAAGAAGGTAGTGGAGGG + Intergenic
1123638718 15:22384232-22384254 CACATAAAGAAGGTAGTGGAGGG - Intergenic
1123660416 15:22559911-22559933 CTGCTCATGAAGGTTGTGGAAGG + Intergenic
1124263802 15:28215658-28215680 CTGCTCATGAAGGTCGTGGAAGG - Exonic
1124314271 15:28654396-28654418 CTGCTCATGAAGGTCGTGGAAGG + Intergenic
1124996124 15:34724495-34724517 CAGATAATGAAGGGGCAGGATGG - Intergenic
1126903491 15:53338854-53338876 CAGATCTTCATAGTACTGGAAGG - Intergenic
1127545575 15:59992154-59992176 CAGATGCTGAAGGTACTTGAGGG - Intergenic
1128295873 15:66518986-66519008 CAGATCCTGAAGGTACTTGTTGG + Exonic
1128330607 15:66753215-66753237 CAGATCCTAAAAGTACTGGGAGG - Intronic
1128734403 15:70044630-70044652 CAGAGCAAGAGGGTCCTGGAAGG - Intergenic
1130165857 15:81457344-81457366 CAGATCATGAACCCACTGGAAGG + Intergenic
1130830132 15:87590933-87590955 GAGAAGAAGAAGGTACTGGAGGG + Intergenic
1131861089 15:96653794-96653816 CAGATGAAGGAGGTAGTGGAGGG + Intergenic
1132581048 16:684783-684805 CACATCATGAAGTGGCTGGAAGG - Exonic
1133722334 16:8506716-8506738 CAGATGATGAAGGGCCTGGCAGG + Intergenic
1134036155 16:11032830-11032852 CAGGTCATGAAGGGCCTTGAAGG + Intronic
1135550736 16:23396323-23396345 CAGAAAATGATGGTGCTGGAAGG - Intronic
1138181611 16:54944340-54944362 CAAATCATGAAAGAATTGGAAGG - Intergenic
1142748115 17:1970681-1970703 CTGATAATCAAGGGACTGGAGGG + Intronic
1142814686 17:2415866-2415888 TAGTTAATGAAGATACTGGAGGG - Intronic
1145116519 17:20215157-20215179 CAGCTTCTAAAGGTACTGGAGGG - Intronic
1146507893 17:33421357-33421379 CAGATCATCAAGGATATGGATGG - Intronic
1147988555 17:44320065-44320087 CTGATCATGATGGCACAGGAGGG + Exonic
1150032240 17:61751421-61751443 AACATCATGAATGTACTTGATGG + Intronic
1151621308 17:75246712-75246734 CAGATCAACAAGGAGCTGGAAGG - Exonic
1155442937 18:25880976-25880998 CAGATCATGTAGGGTCTAGAGGG + Intergenic
1158725507 18:59968250-59968272 CAGATCATGCAGGTTTTGCAAGG + Intergenic
1162344212 19:10110345-10110367 CAGCTCATCAAGGTCCAGGAGGG + Exonic
1162729859 19:12711746-12711768 CAGAGCATGATGGTACTGCTAGG + Intronic
1162828761 19:13270910-13270932 TAGATCATGCAGGAACTGGGAGG - Intronic
1163277536 19:16294799-16294821 CAGAACATGAAGGAACTGAGTGG + Intergenic
1165068683 19:33242930-33242952 AACATCATGGAGGAACTGGAAGG + Intergenic
927858185 2:26540415-26540437 CAGGCCAAGGAGGTACTGGAGGG + Intronic
929084389 2:38154014-38154036 TAGATCAAGCAGGTTCTGGAGGG + Intergenic
932039426 2:68283552-68283574 CAGATGATGAGAGTACAGGAGGG - Intergenic
932366240 2:71155241-71155263 CAGTTCATGAAGGTGCTGGCAGG + Intergenic
932760893 2:74438589-74438611 CAGATCATGCAGGGCCTTGAAGG - Intronic
935799439 2:106678885-106678907 CAAATCGTGAAGGACCTGGAGGG - Intergenic
936981479 2:118269207-118269229 CAGATCATGAAGCTTCTAGTAGG + Intergenic
943828312 2:192425368-192425390 CAATTTAAGAAGGTACTGGAAGG - Intergenic
944992468 2:205253659-205253681 TAGATGATGAAGGTAGTAGAAGG + Intronic
946894617 2:224310643-224310665 CAGAGCATGAAGGTCCTGGCAGG - Intergenic
947295234 2:228623656-228623678 AAGATCATGAGGGAACAGGAAGG + Intergenic
948166016 2:235863419-235863441 CAGATTTTGAAGGTTCTGTAGGG - Intronic
948247302 2:236497266-236497288 CTGATCAGGAAAGTCCTGGACGG - Exonic
949007641 2:241658728-241658750 CAGAGCGTGAAGGTGCTGGGAGG + Intronic
1169551170 20:6703006-6703028 CAGATCCTGAGGATACAGGAGGG - Intergenic
1169804588 20:9546443-9546465 CAGATCTTGATAGTACTGGGAGG - Intronic
1170202026 20:13754613-13754635 CAGATAATGAAGCTTGTGGATGG - Intronic
1172012695 20:31855475-31855497 TAGATCATGAATGTCCTTGAAGG + Intronic
1173587446 20:44193615-44193637 CAGATCATGGAGGGCCTGGTAGG - Intergenic
1176363204 21:6016038-6016060 CTGAGCATGAAGGCACAGGATGG - Intergenic
1176414954 21:6468673-6468695 TACATCATGAAGGCTCTGGAAGG + Intergenic
1176734190 21:10527879-10527901 AAGAGCATGAAGGTGGTGGAGGG + Intronic
1178942419 21:36917163-36917185 CAGATCATGTAGGAGCTGGCAGG - Intronic
1179366672 21:40765296-40765318 CAAATCATGAAGGCACTGCCTGG + Intronic
1179609475 21:42540534-42540556 GAGATCATGAAGGTGCTAGAAGG + Intronic
1179690454 21:43076995-43077017 TACATCATGAAGGCTCTGGAAGG + Intergenic
1179760314 21:43522507-43522529 CTGAGCATGAAGGCACAGGATGG + Intergenic
1180904291 22:19397747-19397769 CAGATCAGGAGGGTAATGGATGG - Intronic
1182647420 22:31821616-31821638 CATATCATGAAGCTGCTGGAAGG + Exonic
1183992335 22:41606054-41606076 CAGATCAGGTAGGTCCTGGGAGG + Intronic
1184555917 22:45233040-45233062 CAGATCAGGAAGGTGGAGGAAGG + Intronic
1184586540 22:45451978-45452000 CAGAAAAAGAAGGAACTGGACGG - Intergenic
949361306 3:3234853-3234875 CAGTTCATGCAGGTATTGCATGG + Intergenic
950080646 3:10219741-10219763 CAGACCATGCAGGTACTCGACGG - Exonic
950228077 3:11252396-11252418 AAGATCATCCATGTACTGGAGGG + Intronic
950705679 3:14778626-14778648 CAGATGATAAGGGTCCTGGAGGG + Intergenic
952932365 3:38370147-38370169 CTGAGCATGATGGTACTGGTGGG - Exonic
953349314 3:42202731-42202753 CAGATCGTGAAGCCGCTGGAAGG + Exonic
953981475 3:47415265-47415287 CAGTTCAAGAAGGCACAGGAGGG + Intronic
954114033 3:48454416-48454438 CAGGTAATGATGGTGCTGGAGGG + Exonic
954615054 3:51965246-51965268 TGGATCATGAAGGTCCTTGATGG - Intronic
955585709 3:60475529-60475551 CAGCTGATGTAGGCACTGGAGGG + Intronic
956336640 3:68171819-68171841 CAAATCAAGTAGCTACTGGAGGG + Intronic
956499292 3:69864695-69864717 CAGACCATGAAGGATCTGGTAGG - Intronic
957732393 3:84156405-84156427 CATATCATTAAAGTACTAGAAGG + Intergenic
959466611 3:106695338-106695360 CAGATGATGCAGCTACAGGATGG - Intergenic
959689431 3:109182632-109182654 CAGATCATGCAGGGCCTTGAAGG - Intergenic
959833913 3:110896302-110896324 CAGATCATCAAGGACCTGTAGGG - Intergenic
961477109 3:127153718-127153740 GAGATCAAGAAGGGACTGCAAGG + Intergenic
962637024 3:137341689-137341711 GTGATCATGAAGGCGCTGGAAGG - Intergenic
963829269 3:149989831-149989853 CACATCTTTAAGGTACTGGATGG + Intronic
964813461 3:160691372-160691394 GAGATCAAGAAGATACTGGGAGG - Intergenic
967866413 3:194193680-194193702 CAGGTCATGAAGGACCTAGACGG + Intergenic
972435643 4:39032341-39032363 CATACCATGAATGTACTGCAAGG - Exonic
977046576 4:92075709-92075731 CACATCATTAAAGTACTGAAGGG + Intergenic
977714242 4:100163384-100163406 CAGATAATGATGGAAATGGAGGG + Intergenic
979070266 4:116194866-116194888 GAGCACATGAAGGTTCTGGAAGG - Intergenic
980427284 4:132642641-132642663 CAGATAATGAGGGTCCAGGAAGG - Intergenic
980768554 4:137340851-137340873 CATATCATGAATGTAGTTGATGG - Intergenic
981544626 4:145881619-145881641 CAGAGCATAAAGGAACTGGGAGG - Intronic
982441548 4:155441893-155441915 CAGATCTGGATGGTACGGGAAGG - Intergenic
983259307 4:165438212-165438234 GAGATGATGAGGGTAGTGGATGG + Intronic
984039730 4:174716245-174716267 CAGATCATGAATATTCTAGAGGG - Intronic
985956216 5:3268139-3268161 CAGATCATGAAGGCAGAGGAAGG - Intergenic
989412658 5:41138286-41138308 CAGATCATGATGTTTCTGGTTGG - Intergenic
992180751 5:74196007-74196029 AAGATCATGAAGGTTTTGAAGGG + Intergenic
993918719 5:93773293-93773315 CAGGACATGGATGTACTGGATGG + Intronic
994267234 5:97732432-97732454 CAGATTATGTAGATACTTGAAGG + Intergenic
995154980 5:108899933-108899955 CAGAACTTGAAGGTGCCGGAAGG - Intronic
996843350 5:127872583-127872605 AAGATCAAGCAGGGACTGGATGG - Intergenic
997448797 5:133965038-133965060 CAGATCATGTAGGATCTTGAAGG - Intronic
998719008 5:144921515-144921537 TAGATCTTGAAGATACTGAAAGG + Intergenic
999569211 5:152899526-152899548 CTGATAATGATGTTACTGGAAGG - Intergenic
1001181841 5:169527403-169527425 CATATCATGGTGGTATTGGAAGG + Intergenic
1003743884 6:8977470-8977492 GAGATCCTGAAGATAATGGAAGG + Intergenic
1004867254 6:19866237-19866259 CAGATAATGAGGGTACTGATAGG - Intergenic
1005915079 6:30344692-30344714 AGGATCATGAGGGTGCTGGAGGG - Intronic
1006786613 6:36672039-36672061 CAGATCATTTAGGGACTAGAAGG - Intergenic
1006910043 6:37557784-37557806 CAGAACATGAAGTCCCTGGAGGG + Intergenic
1008145378 6:47885461-47885483 AAGATCATGAAGGTTCTTCATGG + Intronic
1010034747 6:71311850-71311872 CAGATAATGAAGGTGAAGGATGG + Intergenic
1012556254 6:100516258-100516280 CAGTTCAGGAAGGGACTCGATGG + Exonic
1013748172 6:113369778-113369800 CACATCTTGAAGCTACTAGAAGG - Intergenic
1015755399 6:136600932-136600954 CAGAGCATGAGGCTACTTGATGG + Intronic
1015911097 6:138168440-138168462 CAGATCATGAAAGTCCTTGTTGG + Intronic
1016714222 6:147204545-147204567 AACATCAGGAAGGTGCTGGACGG + Exonic
1018474813 6:164130040-164130062 CAGATCAGGAAACTCCTGGAGGG + Intergenic
1021953789 7:25803210-25803232 GTGATCAGGAAGGTACTGGGTGG + Intergenic
1022656950 7:32328446-32328468 CAGATCATGCAGGGACTTGGAGG - Intergenic
1023393398 7:39731568-39731590 CAGATCATGAAGGACTTGAATGG + Intergenic
1026523571 7:71136092-71136114 CAGAGGATGAAGGTGCTTGAGGG - Intronic
1028971738 7:96867104-96867126 CATAGCATGAAGTGACTGGAAGG + Intergenic
1030654858 7:112155736-112155758 CTGCTAATGAAGGTAATGGACGG + Intronic
1030740258 7:113101092-113101114 CAGATCATGTAGGTCATGGCAGG - Intergenic
1030978797 7:116161912-116161934 CAAACCATGTAGGTACTTGAGGG + Intergenic
1031801373 7:126250452-126250474 CAAATCATGAAGCCACTGGAAGG + Intergenic
1035160216 7:156944614-156944636 CAGATCCTGCAGCTCCTGGACGG + Intergenic
1037170793 8:15889361-15889383 CAAAGCCTGAATGTACTGGATGG - Intergenic
1038200729 8:25410386-25410408 CAGATGATGAAGGTAGAGGCAGG + Intronic
1045984624 8:108235375-108235397 CAGATCATCAAGGCACTAGCTGG + Intronic
1046814417 8:118568383-118568405 CAGATCATGCAGGATCTGGTAGG + Intronic
1050999923 9:12269234-12269256 TATATTATAAAGGTACTGGAGGG - Intergenic
1057030270 9:91769763-91769785 CAGATCATGAAGGTACTGGAGGG - Intronic
1058667286 9:107331820-107331842 CAGATAAACAAGGTACTGTATGG - Exonic
1059467407 9:114477745-114477767 CAGAGCAGGGATGTACTGGAAGG - Intronic
1061427892 9:130512126-130512148 CAGATCATGAAAGTGCTGGTAGG - Intergenic
1187206500 X:17186792-17186814 CAGAACAAGAAGGTACAGGAGGG - Intergenic
1187255412 X:17637374-17637396 CAGACCAGGAAGGGACTGGGCGG + Intronic
1187618499 X:21025319-21025341 GACATAATTAAGGTACTGGAGGG - Intergenic
1187843535 X:23513177-23513199 CAGCTCTTGAAGGTTGTGGAAGG - Intergenic
1189348355 X:40259230-40259252 CCAATAATGAAGGTGCTGGATGG + Intergenic
1190576889 X:51848638-51848660 CTGATCATAATGGTACTGTATGG + Intronic
1190653175 X:52587178-52587200 TAGCTCATGAAGGGACTGGAGGG - Intergenic
1191868523 X:65725601-65725623 CAGAGGATGAAGGTAGTGGGTGG - Intronic
1192340777 X:70261663-70261685 CAGATCATGAAGGTCCTTGGAGG + Intergenic
1196728193 X:118915901-118915923 CAGATCATGAGGGATCTGTAGGG - Intergenic
1196886319 X:120249652-120249674 AAGATAATGAAGGTAGTGAATGG + Intergenic
1198710430 X:139495661-139495683 CAGATCATGGAGGTCCTTGTAGG - Intergenic
1198789394 X:140327128-140327150 CAGATCATGAAGGGCCTCGTGGG + Intergenic
1199289549 X:146090636-146090658 CAGCTCATGAAAGTAGTGCAGGG + Intergenic
1201451307 Y:14118152-14118174 CAGATCATGAAGTCAAGGGATGG - Intergenic
1201995566 Y:20084149-20084171 AAGATCATGAACGTGCCGGAAGG - Intergenic
1202592220 Y:26497394-26497416 AAGAGCATGAAGGTGGTGGAGGG + Intergenic