ID: 1057034750

View in Genome Browser
Species Human (GRCh38)
Location 9:91803766-91803788
Sequence CAAGGCCACATGCTGTCATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057034750_1057034754 9 Left 1057034750 9:91803766-91803788 CCTCATGACAGCATGTGGCCTTG 0: 1
1: 0
2: 0
3: 19
4: 177
Right 1057034754 9:91803798-91803820 CCGACAGCTTATACTTTCCAGGG No data
1057034750_1057034752 8 Left 1057034750 9:91803766-91803788 CCTCATGACAGCATGTGGCCTTG 0: 1
1: 0
2: 0
3: 19
4: 177
Right 1057034752 9:91803797-91803819 ACCGACAGCTTATACTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057034750 Original CRISPR CAAGGCCACATGCTGTCATG AGG (reversed) Intronic
900246304 1:1637691-1637713 CAGGGCCCCGTGCTGTCCTGGGG - Intronic
900257531 1:1704833-1704855 CAGGGCCCCGTGCTGTCCTGGGG - Intronic
901124440 1:6919151-6919173 CAGGGCCAGATGCTGGCAGGAGG + Intronic
901405316 1:9041262-9041284 CCAGGCCCCAGGCTGTCTTGGGG + Intronic
902646671 1:17804447-17804469 CTAGGCCACAGGCTGACATGGGG + Intronic
904366486 1:30014112-30014134 CAAGGCCACATGCAGTCCCATGG + Intergenic
905220109 1:36440155-36440177 CATGGCCACAGGCAGTCATCTGG - Intronic
907581158 1:55574022-55574044 CATGCACACAAGCTGTCATGTGG + Intergenic
907582102 1:55581741-55581763 CAAGGCCACATGATCTTAAGTGG - Intergenic
909665378 1:78126632-78126654 CAAGTTCTCATGCTGTCATCAGG + Intronic
910393417 1:86767862-86767884 CAAGGCCACATTCTTTCTAGAGG + Intergenic
917047747 1:170881590-170881612 CCAGGCAACATGCTCTCATTTGG - Intergenic
918235440 1:182575629-182575651 CAGGGCCATATGCTGTGAAGCGG - Intronic
918238272 1:182600438-182600460 CACAGCCACATGCTTTGATGCGG - Exonic
924874767 1:248090150-248090172 CAAAGTCAAATGCTGACATGGGG - Intronic
1062955301 10:1536145-1536167 CAACTCCAGATGCTGGCATGAGG + Intronic
1063251428 10:4279370-4279392 CCAGGACACCTGCTGTCCTGAGG + Intergenic
1067344021 10:45425161-45425183 CAAGGTCACAGTCTGTCAGGTGG + Intronic
1067777851 10:49176051-49176073 CAAGGCCACAGGCTGACAATGGG - Intronic
1071164404 10:82787694-82787716 CAAGGCCAGACAATGTCATGTGG - Intronic
1071753273 10:88505816-88505838 CAAGGACACATGGTGGCATCTGG - Intronic
1072632484 10:97155918-97155940 CAAGGCCAGATGCTTGCATGTGG + Intronic
1075526440 10:123190997-123191019 CAAGGCCACATGCTGCTAAGAGG - Intergenic
1075571419 10:123549151-123549173 CAAGGTCACAGGCTGAGATGGGG - Intergenic
1076006338 10:126950654-126950676 CAAGGCCACATGATGCCTGGAGG + Intronic
1076334418 10:129695916-129695938 CAAGCCCACATGCTGTCACATGG - Intronic
1077594654 11:3521539-3521561 CAAGGACACATGCAGAGATGGGG - Intergenic
1079087178 11:17454751-17454773 CAAGGTCACATGCTGGTAAGGGG + Intronic
1079403622 11:20126362-20126384 TAAGGCCACATTCTGTGCTGGGG - Intergenic
1083202678 11:61129960-61129982 CAAGGCCACAGGATGCCACGAGG - Intergenic
1083829668 11:65223551-65223573 CAAGGTCACATGCTGTCTCATGG + Intergenic
1084331088 11:68431106-68431128 CAAGGCCACCTGGAGGCATGGGG - Intronic
1084565134 11:69924280-69924302 CAAGGCCAGCTCCTGGCATGGGG + Intergenic
1084822281 11:71700535-71700557 CAAGGACACATGCAGAGATGGGG + Intergenic
1085379105 11:76096697-76096719 CCAGGCCTCTTGCTGTCATCTGG + Intronic
1088535270 11:110853513-110853535 CAAGGACTCATGCTTTCATCAGG - Intergenic
1090318953 11:125824140-125824162 CAAGGTCAAATGATGTCATAAGG - Intergenic
1091025326 11:132136300-132136322 CTAGGCCCCAGGCAGTCATGTGG + Intronic
1091763452 12:3102975-3102997 CCAGGCCACTTGCTGTTAGGTGG + Intronic
1091799176 12:3313914-3313936 CAGGGCCACGGGCTGTAATGTGG + Intergenic
1091835195 12:3580894-3580916 CATGGCCACATGCTGTCCACAGG - Intronic
1092420828 12:8330325-8330347 CAAGGACACATGCAGAGATGGGG - Intergenic
1094489446 12:30949843-30949865 CAGTGCCACATGCTGTCAAGAGG - Intronic
1094624711 12:32112720-32112742 CATGGCCACATTTTGTCTTGGGG + Intronic
1095331111 12:40965685-40965707 CATGGCAACATGCGGTCCTGTGG - Intronic
1097515088 12:60594561-60594583 CACTGCCACTTCCTGTCATGTGG + Intergenic
1102611952 12:114120083-114120105 CAAGGACACAAGCAGTCCTGTGG - Intergenic
1104273736 12:127305786-127305808 CAAGGGCACCGGCTGTCATGTGG - Intergenic
1106618247 13:31350215-31350237 CATGGGCACATGCTATTATGGGG - Intergenic
1106681867 13:32016747-32016769 TAATGCCAAATGCTGTCAAGAGG + Intergenic
1109381871 13:61572964-61572986 CAGGGCCACATGGTTTCCTGAGG + Intergenic
1110522456 13:76496820-76496842 CCAGGCCAAATGCTGTCTTCTGG - Intergenic
1116166628 14:41341964-41341986 CAAGGCCACATGCTGAACTGAGG + Intergenic
1117993018 14:61453413-61453435 TGAGGCCACATGCTCTCATTTGG - Intronic
1118255527 14:64202017-64202039 CACGTCCACATGCTGTCAAGGGG - Intronic
1119645652 14:76346537-76346559 CAAGCCCCCATGGTGTCTTGAGG - Intronic
1120944582 14:89982141-89982163 CAAAGCCACATGCTATGGTGGGG - Intronic
1123939024 15:25207847-25207869 TAAGGCCTCATGCTTCCATGTGG - Intergenic
1124149923 15:27168187-27168209 CAAAACCACTTGATGTCATGGGG + Intronic
1126252828 15:46588624-46588646 CCAGGCTACATCCTGTCCTGGGG - Intergenic
1127047650 15:55043693-55043715 CCAGACCACATTCTGTCCTGTGG - Intergenic
1127147782 15:56042770-56042792 CTAGGCCCCATCCTGTCCTGTGG + Intergenic
1127448593 15:59092759-59092781 CAAGGCCAGAGGCTCTCTTGAGG + Intronic
1129663817 15:77568128-77568150 CAAGTCCCCATGCTGGCCTGAGG + Intergenic
1129742968 15:77999021-77999043 CAAGACCAAAAGCTGTCCTGAGG + Intronic
1130651017 15:85762260-85762282 GCACGCCACATGCTGACATGTGG + Intronic
1132630850 16:916627-916649 CAAGGCCACCTGGTGTCCCGGGG - Intronic
1133191614 16:4137866-4137888 CACAGCCACTTGCTGTCCTGTGG - Intergenic
1133820965 16:9236234-9236256 CAAGGCCACATTCTGAGATTAGG + Intergenic
1134100669 16:11449422-11449444 GAAGGGCACATGCTGGCAGGTGG + Intronic
1135122831 16:19781283-19781305 CAAGACCACATGCTCCCATGTGG - Intronic
1136278329 16:29192364-29192386 CAAGGCCACATCCTGCCATCTGG + Intergenic
1138306899 16:55985743-55985765 CAACACCAAATGCTGACATGTGG - Intergenic
1142082707 16:88158398-88158420 CAAGGCGACATCCTGCCATCTGG + Intergenic
1142721983 17:1782506-1782528 CAATGCCACATGTTGTCTGGGGG + Intronic
1143538391 17:7555471-7555493 CCAGGCCACACGGTGGCATGTGG + Intronic
1145269877 17:21399162-21399184 CAAGGCCAGAAGCAGGCATGGGG - Intronic
1147911791 17:43860432-43860454 CAAGGCCACAGGCTGCCCTGGGG - Intronic
1150349202 17:64429639-64429661 CAAGTCCACATTCTATCCTGTGG + Intergenic
1151405801 17:73885349-73885371 CAAGGCCACATACCCTCTTGTGG - Intergenic
1153747723 18:8197644-8197666 TCAGGCCACATGCTGTCCTGTGG + Intronic
1156001898 18:32394604-32394626 CCAGGCCACATCCTCTCAAGAGG - Intronic
1157157086 18:45279020-45279042 CAAGGCCACATGCAGTAAATTGG + Intronic
1157465860 18:47944482-47944504 CAAGAACACGTGCTGTTATGGGG - Intergenic
1157871584 18:51234627-51234649 CAAGACCATATCCTGTGATGAGG + Intergenic
1158381251 18:56932469-56932491 CAAGGCCATTTGTTGACATGGGG + Intronic
1159696100 18:71557898-71557920 CTTGGCCACATACTGTCCTGTGG + Intergenic
1160332248 18:78004897-78004919 CAGGGCCACCCTCTGTCATGAGG - Intergenic
1164464779 19:28478275-28478297 CAAGGCCACACGCTGTTCTAAGG - Intergenic
1166675422 19:44737947-44737969 CAAGGCCACAACCTGCCCTGTGG - Intergenic
925403044 2:3589324-3589346 CAACACCAAATGCTGGCATGAGG - Intergenic
925759480 2:7170611-7170633 CTAGGCCACATGCTGTGAACTGG + Intergenic
925777250 2:7347481-7347503 CAAGGTGACCTGCTGTCCTGAGG + Intergenic
926079921 2:9976688-9976710 AAAGGCCACATGAGGTCTTGGGG + Intronic
926313803 2:11695022-11695044 CAAGGCCCCAGGTGGTCATGAGG + Intronic
926797639 2:16631952-16631974 AAAGGCCACATGGTGTCACATGG + Intronic
927922115 2:26981048-26981070 CAAGGCCACTTGCTGAGGTGGGG + Intronic
929826761 2:45314963-45314985 CAAGGTCAGATGCTGGCAGGTGG + Intergenic
930298661 2:49587119-49587141 AAAGGCCATAGGCTGTCAGGAGG - Intergenic
931452995 2:62384157-62384179 CAGGTCCAGATGGTGTCATGTGG + Intergenic
935138857 2:100333405-100333427 CAACCCTACATGCTGCCATGGGG + Intergenic
936751708 2:115650385-115650407 TAAAGGCACATGCTGGCATGGGG + Intronic
940383461 2:153043345-153043367 CAAATTCACATGGTGTCATGTGG - Intergenic
941911214 2:170766741-170766763 CAAAGCCACATGCTTACAAGAGG + Intergenic
945651635 2:212568504-212568526 CAAGGACACATGATGTAGTGGGG - Intergenic
948226120 2:236310504-236310526 CAAAGTCACTTGATGTCATGAGG + Intergenic
948329285 2:237152226-237152248 CAAAGCCAGACGCTGCCATGTGG + Intergenic
1169727394 20:8750894-8750916 CAAAGCAAGATGCTGTCATAAGG + Intronic
1169820366 20:9703442-9703464 CTGGGCCCCATCCTGTCATGTGG + Intronic
1170627865 20:18043169-18043191 CCAGGCTCCATGATGTCATGAGG - Intronic
1171008387 20:21490950-21490972 CAAGGGCACATGTAGTCATCTGG + Intergenic
1177866913 21:26523393-26523415 AAAGGCCACTTGCTGCCATGTGG - Intronic
1179023520 21:37660071-37660093 CAAAGCCACCTGAGGTCATGGGG - Intronic
1179129962 21:38626531-38626553 AAAGGTCACATGTTGTAATGTGG - Intronic
1179608893 21:42536197-42536219 CAAGGCCACATCCTAGCAGGTGG - Intronic
1183490957 22:38115423-38115445 AAAAGCCACCTGCTGTCCTGGGG + Intronic
950162759 3:10772432-10772454 CAAGGCCAGAAGCTGTCCAGGGG + Intergenic
954784745 3:53084606-53084628 CAAGGCCCCAACCTGTGATGGGG + Intronic
955129865 3:56155388-56155410 GAAGGCCACATCCAGTCATGCGG - Intronic
955820641 3:62892164-62892186 CAAGGACATATGCTGATATGAGG - Intergenic
958919852 3:100092285-100092307 CAGGGACACATGCTTTCATCAGG - Intronic
959261035 3:104080350-104080372 CAAGCCCATATGGTGACATGTGG + Intergenic
961288555 3:125826520-125826542 CAAGGACACATGCAGAGATGGGG + Intergenic
961894402 3:130155291-130155313 CATGGCCACATGTTCTCTTGGGG - Intergenic
961898503 3:130189525-130189547 CAAGGACACATGCAGAGATGGGG - Intergenic
964838643 3:160969423-160969445 AAAGGCCATTTACTGTCATGGGG + Intronic
967331084 3:188290347-188290369 CAAGGTCACATGATATTATGTGG - Intronic
967708887 3:192682952-192682974 AAGGGTGACATGCTGTCATGGGG + Intronic
967829388 3:193905734-193905756 CCAGGCCTCATGCTGGCATCAGG - Intergenic
969009486 4:4050023-4050045 CAAGGACACATGCAGAGATGGGG - Intergenic
969062249 4:4446646-4446668 CAATGCCAAATCCTGCCATGTGG + Intronic
969744864 4:9062291-9062313 CAAGGACACATGCAGAGATGGGG + Intergenic
969804281 4:9594397-9594419 CAAGGACACATGCAGAGATGGGG + Intergenic
969866454 4:10079693-10079715 CCAAGCCACCAGCTGTCATGAGG + Intronic
969980726 4:11151383-11151405 CAAGGCCACAAGCTGTGCTTGGG + Intergenic
972700155 4:41486459-41486481 CAATGGCTTATGCTGTCATGAGG + Intronic
975639854 4:76489642-76489664 CAAGGCCTCATTTTGTCATCAGG - Intronic
977594077 4:98859156-98859178 CCAGGCCAGATGAAGTCATGGGG + Intergenic
979715895 4:123837347-123837369 GGAGGCCACATTCTTTCATGTGG + Intergenic
980156241 4:129110473-129110495 GAAAGCCAGATGCTGTCCTGGGG + Intronic
981807660 4:148735351-148735373 CAAGGTCTCACTCTGTCATGAGG - Intergenic
985486455 5:154336-154358 CAAAGCCACCTGCTGTCAAAAGG + Intronic
986268609 5:6211845-6211867 CAGGGCCACCTGGAGTCATGGGG + Intergenic
987592106 5:19942996-19943018 AGAGGCATCATGCTGTCATGAGG - Intronic
991420878 5:66440360-66440382 AAAGGCCAGTTGCTGTCAGGAGG + Intergenic
993074136 5:83205874-83205896 GAAGGTGACATGCTGTCTTGGGG + Intronic
993537350 5:89103278-89103300 CAATGCCAGATGCTTCCATGAGG + Intergenic
995177176 5:109192342-109192364 CAAGGCCAGATCCTGTCCTATGG + Exonic
996048833 5:118909212-118909234 GAAGGCCACAACCTGCCATGTGG - Intronic
996642268 5:125770514-125770536 CAAGCCCACATGGATTCATGTGG - Intergenic
997593756 5:135092485-135092507 CTAGGCCACATTCTTTCAAGTGG - Intronic
999719204 5:154386251-154386273 CCTGGCCACATGCTCTCATGTGG - Intronic
999852762 5:155560545-155560567 CAATGCCGCATGGTGTCTTGTGG + Intergenic
1000275616 5:159732367-159732389 CCAGCCCACATCCTGTCCTGTGG + Intergenic
1000410413 5:160931218-160931240 CAAGAAGACATGCTGTCTTGAGG + Intergenic
1003086701 6:3065940-3065962 CAAGGTCACATGATGTCTAGAGG + Intronic
1005233483 6:23733329-23733351 CAGAGCCACACCCTGTCATGGGG - Intergenic
1005599811 6:27414929-27414951 CAGGGTCACATACTATCATGAGG - Intergenic
1006812758 6:36830692-36830714 CAGGGCCACATGTCGCCATGTGG - Intronic
1007294254 6:40809839-40809861 CAAGGCCATATGCTGGCAAATGG + Intergenic
1008717891 6:54311085-54311107 CAAGACCACATGCTGTTAAAGGG - Intronic
1008951730 6:57168482-57168504 CAAGGCCACTTGATGTTGTGTGG - Exonic
1009528234 6:64775268-64775290 CAAGGCCACATCCAGCCATTAGG + Intronic
1013607631 6:111765067-111765089 CAAGGCCATTTGCTATCCTGTGG + Intronic
1014028660 6:116677036-116677058 CAAGGATACATGCTGTTGTGTGG + Intergenic
1018511843 6:164532777-164532799 GAAGGCCAGCTGCAGTCATGGGG + Intergenic
1019038406 6:169082723-169082745 CAAGGGCACCTGCTGTCACCAGG - Intergenic
1019140404 6:169938880-169938902 CAAGGCCAGATGCTCACATGGGG + Intergenic
1019412468 7:912269-912291 CAATGCCTCATGTTGTCCTGAGG - Intronic
1021986644 7:26103517-26103539 GAAGGCCAAATGATATCATGTGG + Intergenic
1023649577 7:42354794-42354816 CAAGGTCAAATGATGTCATCAGG - Intergenic
1029068449 7:97875542-97875564 CAAGGACACATGCAGAGATGGGG - Intergenic
1031232342 7:119123911-119123933 CAACCCTACATGCTGCCATGGGG + Intergenic
1032165372 7:129540745-129540767 CAGGGCCACATGCTGTCACCAGG + Intergenic
1034498925 7:151437838-151437860 CAGAGCCACCTGCTGGCATGAGG - Intronic
1034515371 7:151573180-151573202 CAAGGTCTCATTCTGTCATCCGG + Intronic
1034702832 7:153111210-153111232 GAAGGCCAGATCCTGTGATGTGG + Intergenic
1036250771 8:7160698-7160720 CAAGGACACATGCAGAGATGGGG - Intergenic
1036366719 8:8126759-8126781 CAAGGACACATGCAGAGATGGGG + Intergenic
1036884167 8:12538903-12538925 CAAGGACACATGCAGAGATGGGG - Intergenic
1037786830 8:21908397-21908419 CAAGGACACAGGCTGACCTGTGG + Intergenic
1039456322 8:37709883-37709905 CTTGGCCAGATGCTGTCCTGTGG - Intergenic
1042056487 8:64769649-64769671 CAATGCCATCTGCTGTTATGTGG + Intronic
1042663776 8:71183956-71183978 CAATGCCATCTGCTATCATGTGG + Intergenic
1044515998 8:93139542-93139564 TAAAACCCCATGCTGTCATGAGG + Intronic
1047224499 8:122944895-122944917 CAAGGTTACATGAGGTCATGAGG + Intronic
1050349249 9:4724070-4724092 CATGGACACGGGCTGTCATGTGG + Intronic
1055398172 9:75895158-75895180 CAAGTCCACATGCTGTCAATGGG - Intronic
1057034750 9:91803766-91803788 CAAGGCCACATGCTGTCATGAGG - Intronic
1058969788 9:110070258-110070280 CAAGGTCACATGCTTGCATATGG + Intronic
1060667220 9:125439117-125439139 CAGGGCCAGGTGCTGTCGTGTGG + Intronic
1061005260 9:127925329-127925351 TAATGCCACATGCTGTCACGGGG - Intronic
1061379356 9:130244780-130244802 CAAGGACACCTGCTGCCCTGTGG - Intergenic
1062231093 9:135481581-135481603 TAAAGCCACAAGCTGTCCTGGGG + Intronic
1189372904 X:40444180-40444202 CAAGGGCCCTTGCTGTCCTGTGG - Intergenic
1189998430 X:46661614-46661636 CCCGGCCACATGGTGTTATGTGG - Intronic
1196254009 X:113494495-113494517 CAATTCCACATGCTGTCCTCTGG + Intergenic