ID: 1057035343

View in Genome Browser
Species Human (GRCh38)
Location 9:91807940-91807962
Sequence GGGTGAGCACAAGTCTTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057035343_1057035346 -10 Left 1057035343 9:91807940-91807962 CCAGCTAAGACTTGTGCTCACCC 0: 1
1: 0
2: 0
3: 5
4: 79
Right 1057035346 9:91807953-91807975 GTGCTCACCCAGGGCTAGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057035343 Original CRISPR GGGTGAGCACAAGTCTTAGC TGG (reversed) Intronic
900674098 1:3873179-3873201 GCATGAGCAGAAGTCTCAGCAGG + Intronic
900985296 1:6069668-6069690 TGGGGAGCACACGTCTCAGCCGG - Intronic
902814035 1:18905938-18905960 GGGGCAGCACCAGTCCTAGCTGG - Exonic
919728186 1:200897092-200897114 GGGTGGGCACAGGTGTTATCTGG + Intronic
919766849 1:201132946-201132968 GGGTGAGCACACTGCTTGGCTGG - Intergenic
921007062 1:211104452-211104474 TGGTGAGAACTAGTGTTAGCAGG - Intronic
1064152305 10:12875066-12875088 AGGTGGGCACAGGGCTTAGCAGG + Intergenic
1073441654 10:103555897-103555919 GGGTGCCCACATGTCTTTGCGGG - Intronic
1075569093 10:123526329-123526351 TTGTGAGCAAAAGTCTTAGGTGG + Intergenic
1077186972 11:1239764-1239786 GGGTGAGCAGAAGACTCACCAGG - Intronic
1081654579 11:44849030-44849052 GGGAGAACACATCTCTTAGCTGG + Intronic
1083672403 11:64306580-64306602 GTGTGAGCACAAGTGTGAGCAGG + Intronic
1092779363 12:11970918-11970940 GGGTGACTATTAGTCTTAGCAGG + Intergenic
1095627163 12:44329369-44329391 AGGTGAGCACTAGTCTGAACTGG + Intronic
1097721298 12:63024438-63024460 GGGTGAGCTCAAGTTTATGCTGG - Intergenic
1100126373 12:91431292-91431314 GGGTGAGTATAATTCTTAGTGGG - Intergenic
1102677490 12:114668534-114668556 GGCTGGACACAAGTCTGAGCAGG + Intergenic
1112258433 13:97856190-97856212 CGGGTTGCACAAGTCTTAGCTGG - Intergenic
1116994458 14:51308044-51308066 GGGAGAACACAACTCTTAGTAGG - Intergenic
1118312251 14:64703011-64703033 GGGTGACCACAAGTCCTGGAAGG + Intergenic
1118350821 14:64971787-64971809 GGGTGAGCATAGGTTTTGGCAGG - Intronic
1128571415 15:68736165-68736187 GGTAGAGCACAAGTCATTGCTGG + Intergenic
1130396106 15:83502823-83502845 GGGTGTGAACAAGTCATAACAGG - Intronic
1131965749 15:97840614-97840636 GGGTCACCACAAGTCTTTGCTGG + Intergenic
1132205523 15:99983695-99983717 GGGTGAGCACAAGCCCAAGATGG + Intronic
1136377465 16:29873711-29873733 GGGTCAGCACAAGTCATGACTGG + Exonic
1136566504 16:31073658-31073680 GAGTCAGCACAAGTCTCATCAGG - Intronic
1144468472 17:15516013-15516035 GGGGGAGCACGCGTCTTACCTGG - Intronic
1148468297 17:47877904-47877926 GGCTGAGCCCCAGTCTTAGGAGG - Intergenic
1151024607 17:70662822-70662844 GGGTGTGCACATGTCCTAGAAGG + Intergenic
1160418428 18:78727834-78727856 GGGAGAGCACATTTCTCAGCTGG - Intergenic
1160538321 18:79607151-79607173 GTGTGTGCACAAGAGTTAGCTGG - Intergenic
1161479738 19:4504548-4504570 GGGTGTGCACCAGGCTTGGCAGG - Exonic
1162095027 19:8305131-8305153 GGGTGGGCACGAGCCTGAGCTGG + Exonic
1167293965 19:48638846-48638868 GGGTTAGCCCAAGACTTAGAGGG + Intronic
925905515 2:8537621-8537643 GGGAGAGCACGAGTCTGGGCTGG + Intergenic
927262157 2:21102500-21102522 GGGGGAGCACAAATGTGAGCAGG + Intergenic
933732507 2:85468133-85468155 GGGTGACCACCAGCCTGAGCAGG - Intergenic
935597800 2:104893296-104893318 GGGTGAGCACAAGAGGAAGCTGG - Intergenic
947479481 2:230485247-230485269 GGGAGGGGAAAAGTCTTAGCTGG - Intronic
1168895743 20:1322250-1322272 GGGGGAGCACAAATCAAAGCAGG - Intronic
1169942564 20:10952899-10952921 GGGTGTGCACAAGACATAGGTGG - Intergenic
1174710623 20:52701175-52701197 AGGTTAGCACAGGTCCTAGCTGG + Intergenic
1175032544 20:55970193-55970215 GAGGGAGGACAAGTCTTTGCTGG - Intergenic
1175647409 20:60686395-60686417 AGGTGAGCTGAAGTCTTTGCAGG - Intergenic
1179008907 21:37538151-37538173 GGGTGAGCACCAGGCTTTGTAGG - Intergenic
1180229012 21:46415041-46415063 GGGTGAGCCCAGGTCTCAGCAGG - Intronic
1180600388 22:17011667-17011689 AGCTGAGGACAAGTCTGAGCGGG + Intergenic
1182702924 22:32255147-32255169 GGGTGGGCACAAGGTTTAGGAGG - Intronic
949199529 3:1358291-1358313 AAGTGAGCACAAGTGTTTGCAGG - Intronic
953234662 3:41095655-41095677 GTGTGAGCCCAAGTTTCAGCTGG - Intergenic
953512354 3:43554985-43555007 GGCTGAGATGAAGTCTTAGCTGG + Intronic
959253634 3:103981264-103981286 GCGTGAGCACAATTCTTAAATGG - Intergenic
961651061 3:128416867-128416889 GGGTGAGCTCCAGGCATAGCTGG - Intergenic
965923689 3:173951326-173951348 GGTTGAACACAGGTCTTAACCGG - Intronic
980034688 4:127870500-127870522 GGGTGGGTACAAGTCTTACAAGG - Intergenic
980322928 4:131302829-131302851 GGGTTGGCAGAATTCTTAGCTGG - Intergenic
980522160 4:133948945-133948967 GGGTGAGCTCAAGTTTGAGTTGG + Intergenic
982754386 4:159201566-159201588 TTGAGAGCACAAGTCTAAGCTGG + Intronic
984627709 4:182026136-182026158 GGATGAGCTCATGTCTTTGCAGG - Intergenic
985142116 4:186851535-186851557 GGCTCAGCACAAGTCCTAGAGGG + Intergenic
989313921 5:40054544-40054566 GAGTGAGCACAAGTTTTAGTCGG + Intergenic
992888773 5:81185099-81185121 GGGTGATCACAATTGCTAGCAGG - Intronic
995747615 5:115420029-115420051 GTGTGAGCAGAAATGTTAGCTGG - Intergenic
1000113063 5:158127628-158127650 GGGCAAGCACAGGGCTTAGCAGG - Intergenic
1001210437 5:169805925-169805947 GGGTGAGCAACTGTCTTTGCTGG + Intronic
1001544111 5:172559242-172559264 GGCTGAGCTCAGCTCTTAGCTGG + Intergenic
1002643341 5:180640893-180640915 GGGTGAGCGCTGGCCTTAGCTGG + Intronic
1014295576 6:119613257-119613279 AGGTGAGCACAGGGCATAGCTGG + Intergenic
1018662714 6:166103060-166103082 GTGTGAGCACAAGTCTCACATGG + Intergenic
1020359921 7:7316995-7317017 GGGTGAGGAAAGCTCTTAGCTGG - Intergenic
1025100421 7:56130251-56130273 GGGTGAGCAGGAGACTTAACTGG - Intergenic
1028570223 7:92278562-92278584 GGGTGAGAACAAGAGATAGCTGG - Intronic
1032947082 7:136866744-136866766 GGCTGAGAACAAGACTTAGCAGG + Intergenic
1034979052 7:155464373-155464395 GGGTGTGCACACGGCTGAGCTGG + Exonic
1038269985 8:26067275-26067297 GGGTGAACCAATGTCTTAGCAGG - Intergenic
1042732253 8:71948871-71948893 GAGTGAACACAGGTCTTATCAGG + Intronic
1043251940 8:78086090-78086112 GGATGACCAGAAGTATTAGCGGG - Intergenic
1050659777 9:7871722-7871744 TGGTGAGCACATGTATAAGCTGG + Intronic
1056632357 9:88304369-88304391 TGGTGACCACAGGTCTTAGAGGG + Intergenic
1057035343 9:91807940-91807962 GGGTGAGCACAAGTCTTAGCTGG - Intronic
1061803869 9:133127587-133127609 GGGTGAGCACACACCTTGGCAGG + Intronic
1062562735 9:137148981-137149003 GTGTGAGCAAGAGTGTTAGCAGG - Intronic
1192285862 X:69735604-69735626 GGCTGAGCACAAGACTTATGTGG + Intronic
1197521483 X:127503723-127503745 AGTTCAACACAAGTCTTAGCAGG + Intergenic