ID: 1057035986

View in Genome Browser
Species Human (GRCh38)
Location 9:91811889-91811911
Sequence GAGTGTGTGGGGAGCTCCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 244}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057035986_1057035991 4 Left 1057035986 9:91811889-91811911 CCAGGGGAGCTCCCCACACACTC 0: 1
1: 0
2: 2
3: 16
4: 244
Right 1057035991 9:91811916-91811938 TGCCTGCCTCCTTTTTACTCTGG No data
1057035986_1057035996 20 Left 1057035986 9:91811889-91811911 CCAGGGGAGCTCCCCACACACTC 0: 1
1: 0
2: 2
3: 16
4: 244
Right 1057035996 9:91811932-91811954 ACTCTGGTTTGGTCTTAGTCAGG No data
1057035986_1057035993 9 Left 1057035986 9:91811889-91811911 CCAGGGGAGCTCCCCACACACTC 0: 1
1: 0
2: 2
3: 16
4: 244
Right 1057035993 9:91811921-91811943 GCCTCCTTTTTACTCTGGTTTGG No data
1057035986_1057035997 21 Left 1057035986 9:91811889-91811911 CCAGGGGAGCTCCCCACACACTC 0: 1
1: 0
2: 2
3: 16
4: 244
Right 1057035997 9:91811933-91811955 CTCTGGTTTGGTCTTAGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057035986 Original CRISPR GAGTGTGTGGGGAGCTCCCC TGG (reversed) Intronic
900087120 1:904053-904075 GCATGTGGAGGGAGCTCCCCGGG - Intergenic
900213249 1:1467706-1467728 GAGGGTGTGGGGACCCCCACTGG - Intronic
900622140 1:3592362-3592384 GAGTGTCTGGGGGGCTGCCTGGG - Intronic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
900759542 1:4461765-4461787 GTGTGTGTGGGCAGCTGGCCAGG + Intergenic
900898983 1:5504111-5504133 GAGACTGTGGGGAGCTGCCTGGG + Intergenic
901051776 1:6429027-6429049 GAGTGGGCTGGGAGCTCCCCTGG + Intronic
901611787 1:10504522-10504544 GAGTGTGTGGGGCGGTGCTCTGG + Intronic
902482548 1:16719334-16719356 GAGTGGTCTGGGAGCTCCCCCGG - Intergenic
906125845 1:43426535-43426557 GAGGATGTGGGGAACTCACCTGG - Intronic
906218337 1:44057839-44057861 GAGGGTATGGGCAGCTCCCTGGG - Intergenic
906493501 1:46286265-46286287 GAGTGTGCAGGGAGCTGGCCAGG + Exonic
907421868 1:54353114-54353136 GGGTGTGTGGGGACCTGTCCAGG - Intronic
910757498 1:90708009-90708031 GAGTGAGTGGGGGCCTCTCCAGG - Intergenic
911053789 1:93694194-93694216 CACAGGGTGGGGAGCTCCCCTGG + Intronic
912325165 1:108751024-108751046 GAGAGTTTGGAGAGCTCCCAAGG - Intronic
912658495 1:111508207-111508229 GAGTGTGTCAGGAGGTCTCCAGG + Intronic
913074072 1:115326286-115326308 GAGTAGTTGGGGAGCTCCTCAGG + Intronic
915472780 1:156135864-156135886 GAGGGTTTGGTGAGCTCCCAAGG - Intronic
919480659 1:198084833-198084855 GACTGTGAAGGGAGCTGCCCAGG + Intergenic
919779771 1:201214224-201214246 GAGAGTGTGGCGGCCTCCCCCGG - Exonic
919829614 1:201531374-201531396 GAGTGTGTGCAGCGCTCCCACGG + Intergenic
920192712 1:204203690-204203712 GAGTGTGTGGGGGGCCCGCAAGG - Intronic
920559742 1:206930683-206930705 GACTGTGTGGGCAGCTTCCGGGG - Intronic
921045881 1:211477872-211477894 GAGTGTGTGGGAAGGCCTCCTGG + Exonic
922707048 1:227795397-227795419 GAGGGTGGGGGGAGCTCCCGTGG - Intergenic
922707072 1:227795455-227795477 GGGGGTTGGGGGAGCTCCCCTGG - Intergenic
922707106 1:227795545-227795567 GTGGGTGGGGGGAGCTCCCGTGG - Intergenic
922707167 1:227795694-227795716 GGGAGTGGGGGGAGCTCCCGTGG - Intergenic
922707191 1:227795755-227795777 GGGAGTGGGGGGAGCTCCCGTGG - Intergenic
1064115900 10:12577195-12577217 GTGTGTCCGGGGACCTCCCCTGG - Intronic
1067439128 10:46298577-46298599 GAGTGTGTGGGAAGGTTGCCTGG + Intronic
1070288618 10:75100607-75100629 GAGTGGGAGGGGAGCTCGGCCGG - Intronic
1071493367 10:86151825-86151847 GAATGTGTGTGGGGCTGCCCTGG + Intronic
1072446255 10:95501284-95501306 GACTGGCTGGGGAGGTCCCCAGG - Intronic
1075438579 10:122462140-122462162 GAGAGAGTGGGGAGCTGCCCAGG - Intronic
1075700885 10:124468821-124468843 GAGGGTGTACGGAGCTTCCCGGG - Intronic
1076673515 10:132136079-132136101 GAGGGGGTGGGGGGCTCCACGGG + Intronic
1076850793 10:133091740-133091762 GTGTGTGTAGGGAGCTCCTTGGG + Intronic
1076898803 10:133327037-133327059 GTCTTTGTGGGGAGCTCCTCAGG + Intronic
1077058743 11:608563-608585 CAGTGGGTGAGGAGCGCCCCAGG + Exonic
1077322545 11:1948741-1948763 GAGTGCTTGGGGTGCTCCCTGGG + Intronic
1079443419 11:20537767-20537789 GAGTGTGGAAGGATCTCCCCAGG + Intergenic
1080796312 11:35567110-35567132 GAATGTTTAAGGAGCTCCCCAGG - Intergenic
1080871705 11:36242267-36242289 GAATGTGTTGGGAGCTCAGCAGG - Intergenic
1083471655 11:62888284-62888306 AAGCGTGTGAGGGGCTCCCCTGG - Intronic
1083782834 11:64926846-64926868 GAGTGTGTGGGGAGCACCCGGGG + Exonic
1083816000 11:65132815-65132837 GAGGGTGTGGGGTGAGCCCCAGG - Intronic
1084680726 11:70664724-70664746 AAGTGTCTGGGCAGCCCCCCTGG - Intronic
1086004859 11:82026372-82026394 AAGGGTGTGGGGAGCAGCCCTGG - Intergenic
1089339301 11:117746713-117746735 GTGTGTTTGGGGAGCACCCTAGG - Intronic
1089396112 11:118137094-118137116 GAGTGTCTCGTGAGCTCCTCGGG - Exonic
1089479038 11:118790798-118790820 GGGGCTGTGGGGAGCCCCCCGGG - Intronic
1090443854 11:126746830-126746852 GAGTGTGTGAGGAGCTCCGCAGG - Intronic
1091078177 11:132640858-132640880 GAGAGGGTGGGGATCGCCCCAGG + Intronic
1202805562 11_KI270721v1_random:4054-4076 GAGTGCTTGGGGTGCTCCCTGGG + Intergenic
1095983473 12:47985484-47985506 GAGGGTGGGGGGATCTCCCTGGG - Intronic
1097187185 12:57202202-57202224 GTGTGTGTGGGCAGCTGCCTTGG - Intronic
1098336646 12:69411814-69411836 GTGTGTCTGGGGAGTACCCCAGG + Intergenic
1100984770 12:100193298-100193320 GAGTGAGTGGGAAGCTCCTGAGG + Intergenic
1102414570 12:112749337-112749359 CAGGGTGTGGGGTGCTTCCCTGG + Intronic
1103595816 12:122023672-122023694 CGGTGTCTCGGGAGCTCCCCTGG + Intronic
1103908855 12:124340827-124340849 GAGTGTGTGCCGTGCTCTCCAGG - Intronic
1103943952 12:124516150-124516172 GAGCCAGTGGGGAGTTCCCCGGG - Intronic
1104577775 12:129983597-129983619 CTGAGTGTGGGCAGCTCCCCTGG + Intergenic
1104763742 12:131313500-131313522 GAGAGAATGGGGAGCTCCCTGGG - Intergenic
1104815748 12:131644555-131644577 GAGAGGATGGGGAGCTCCCTGGG + Intergenic
1105448758 13:20479983-20480005 GAGTGGATGGGGAGGTCACCTGG - Intronic
1105869971 13:24495966-24495988 GAGTCTGTGTAGAGCACCCCTGG - Intronic
1106763446 13:32890763-32890785 AAGTGTCTGTGGAGCTCCACTGG - Intergenic
1109119395 13:58435128-58435150 GAGTGTGCAGGGAGCTGGCCAGG - Intergenic
1110839670 13:80127602-80127624 GAGTGTCTTTGGAGCTCACCAGG + Intergenic
1113619512 13:111703615-111703637 GAGTGTGTGTGCAAGTCCCCAGG + Intergenic
1113625041 13:111788876-111788898 GAGTGTGTGTGCAAGTCCCCAGG + Intergenic
1113957184 13:114105166-114105188 GGGTGGGTGGGGCTCTCCCCAGG + Intronic
1116221769 14:42096471-42096493 GTGTGAGTGGGGAGCTTTCCAGG + Intergenic
1116941962 14:50799308-50799330 GAGTGTGGCTGGAGCTCCCTGGG - Intronic
1119032380 14:71202881-71202903 GAGTCTGTTGAGTGCTCCCCGGG + Intergenic
1119202416 14:72766383-72766405 GGGTGGGTGGTGAGCTCCCTGGG + Intronic
1119857075 14:77908823-77908845 GAGGGTGTGAGGAGAACCCCAGG + Intronic
1120410766 14:84152569-84152591 GAGGCTGTGGGGAGCTACCAGGG + Intergenic
1122287161 14:100658796-100658818 GAGTGTGTGGGCAGCTCTGCGGG + Intergenic
1122787029 14:104168581-104168603 GAGTGTGTGGTGAGACCACCAGG + Intronic
1123989993 15:25676059-25676081 CTGAGTGTGGGAAGCTCCCCTGG + Intergenic
1124686272 15:31785489-31785511 GAAGGTGTGGGGAGCTCCAGAGG - Intronic
1125746337 15:42000026-42000048 GAGGGGCTGGGGAGCTCCTCTGG + Intronic
1126853004 15:52809718-52809740 GAGAGGGTGGGGAGCTGCCAGGG + Intergenic
1128537905 15:68504452-68504474 GAGTGTGTGGGGCACTTTCCTGG - Intergenic
1128730082 15:70015022-70015044 AAGGGTGTGGGGAGCTCAGCAGG + Intergenic
1128756584 15:70187547-70187569 ACGTGTGTGGGCAGCTCCCTTGG + Intergenic
1128785617 15:70394833-70394855 GCGTGTTTGGGAAGCTCTCCTGG + Intergenic
1129853656 15:78810158-78810180 GAGGGAGTGGGGCCCTCCCCTGG - Intronic
1130720603 15:86382407-86382429 GAGTGTGTGGGGAGCAGGTCTGG - Intronic
1130981361 15:88813906-88813928 GAGGGTCAGGGGAGGTCCCCAGG - Intronic
1131183667 15:90257461-90257483 GAGTGTGTGCTGGGCTCCTCCGG - Intronic
1131542329 15:93284952-93284974 GAGTGTATGATGAGCTCCCGCGG - Intergenic
1132571333 16:645684-645706 GAGGGTGTGGGGACCGCCACAGG + Intronic
1132854836 16:2040106-2040128 GAGTATGTGGGGGGCTTCCTAGG - Intronic
1135227620 16:20675091-20675113 GGGTGTGTGCGGACCTACCCAGG + Intronic
1137542747 16:49376395-49376417 GGCTGTGTGGGGAGCTACTCAGG + Intronic
1137873438 16:51972543-51972565 GAGTGTGTGGGCAGCAGACCAGG + Intergenic
1139009769 16:62617422-62617444 GAGTGTGGCAGGAGTTCCCCTGG + Intergenic
1139251962 16:65505288-65505310 AAGAGGGTGTGGAGCTCCCCTGG - Intergenic
1140485670 16:75291160-75291182 GAGAGTGTGGGCAGTCCCCCAGG + Intergenic
1141507799 16:84490394-84490416 GAGAGTGTGGGCCGCTGCCCTGG - Intronic
1142145935 16:88492993-88493015 CAGGGTGTGGGGAGCTGTCCCGG + Intronic
1142173785 16:88635698-88635720 GAGTCTCTGGGGGCCTCCCCTGG - Intergenic
1142365358 16:89647137-89647159 GCGTGTGTGGGCAGCTCATCGGG - Intronic
1142535535 17:615408-615430 GAGAGTGTGGCCAGCTCGCCCGG - Intronic
1146375130 17:32288728-32288750 AAGTGGGTGGGGAGCTCCGCTGG + Intronic
1146423096 17:32707850-32707872 GAGTCTCTAAGGAGCTCCCCTGG + Intronic
1147324942 17:39665639-39665661 GGCTGGGTGGGGGGCTCCCCTGG - Intronic
1147569067 17:41556520-41556542 GCGTGTGTGGGGACCACTCCAGG - Intergenic
1147670711 17:42175372-42175394 GATTGTGAGCTGAGCTCCCCAGG + Intronic
1150809728 17:68347045-68347067 GAGTGTGTGATCAGCTCCTCAGG + Intronic
1151200679 17:72465677-72465699 GAATGTGTGAGTTGCTCCCCTGG + Intergenic
1151539617 17:74758352-74758374 GGGTGTGGGGGCAGCTCTCCGGG + Intronic
1152700139 17:81814571-81814593 GCGTGTGTGTGGCGCACCCCGGG - Intergenic
1157700909 18:49761223-49761245 GAGTGTGTGGGGAGCCTGTCTGG - Intergenic
1158606390 18:58900121-58900143 GAGGCTGTGGAGAGCTGCCCGGG + Intronic
1159500133 18:69258057-69258079 CACTGTGTGTGGAGCTGCCCTGG - Intergenic
1159655689 18:71028556-71028578 GAGTGCGAGGGCAGCTCTCCCGG - Intergenic
1160319577 18:77877587-77877609 ATGTGTGTGGGGAGCTGCCTGGG - Intergenic
1160505800 18:79426378-79426400 GACTGTGTGGCCGGCTCCCCAGG + Intronic
1160732812 19:648992-649014 GAGAGTGCCGGGAGCTCCTCGGG + Intronic
1160831736 19:1107568-1107590 GGGTGTGTGGGCATCCCCCCAGG - Intergenic
1161218985 19:3109293-3109315 GAATGTGTGGGGGGCTCATCTGG + Intronic
1161221902 19:3121788-3121810 GAGGGGGTGGGGGGCTCCCTCGG + Exonic
1161949253 19:7458701-7458723 CAGTGGGTGGGGAGACCCCCAGG - Intronic
1161995716 19:7710184-7710206 GGGAGTGTGGGGAAGTCCCCAGG - Intergenic
1162020275 19:7865075-7865097 GAGACTGTGGGGAGCTCCTAAGG - Intergenic
1162172768 19:8804473-8804495 GTGTGTGTGGGGTGCTACACAGG + Intergenic
1162952725 19:14081562-14081584 GAGTGGGTGGGGCAATCCCCCGG + Intergenic
1163063610 19:14776965-14776987 GTGTGTGTGTGCAGCGCCCCTGG - Intronic
1164829945 19:31312654-31312676 GAGTGTGGGAGGAGTTCCACCGG + Intronic
1165155132 19:33782252-33782274 GAAGGGGTGAGGAGCTCCCCAGG + Intergenic
1165225577 19:34352529-34352551 GAGTGAGTGGGGCTCTCACCCGG + Intronic
1165974046 19:39658662-39658684 GAGTATGAGGTGAGCACCCCAGG + Exonic
1168136861 19:54357559-54357581 GAGTGTGTGGGGCACCGCCCAGG + Intronic
926291108 2:11531071-11531093 GAGGGTGTGGGCAGGTGCCCTGG + Intergenic
929967614 2:46547497-46547519 GAGTGTGCTGGGATGTCCCCAGG - Intronic
930430058 2:51264515-51264537 GAGTGTGTTGGAAACTCCCTGGG + Intergenic
932090718 2:68803867-68803889 GAATGGGTGGGGAGCTCAACAGG + Intronic
932407929 2:71526345-71526367 GAGTGCGTGGGGCGCGCCCTTGG + Exonic
932455054 2:71844228-71844250 GGGTCTGTGGGGAGGTCCCTAGG - Intergenic
933780126 2:85795491-85795513 GAGAGTGTGGTCATCTCCCCAGG + Intergenic
934553944 2:95277708-95277730 CAGTGGGTGGAGTGCTCCCCAGG + Intronic
934762660 2:96865061-96865083 GAGAGTGTGGGCAGCTTCACGGG - Exonic
935226278 2:101055721-101055743 GATTTTGTGGTGAGCTCCCAGGG - Intronic
935943618 2:108267277-108267299 CAGTGTGTGGGGAGCTAGCCAGG - Intergenic
936112780 2:109678410-109678432 AGGGGTGTGGGGAGCACCCCAGG - Intergenic
936613613 2:114026354-114026376 GAGTGTGTGGGGAGCAGACCAGG + Intergenic
937202020 2:120209887-120209909 GAGTGTGTAGGGGGCTGGCCTGG + Intergenic
939876995 2:147588654-147588676 GACTGTGTGAGGAGCTGGCCAGG - Intergenic
941692823 2:168518982-168519004 GACTTTGTCAGGAGCTCCCCGGG - Intronic
942498026 2:176559955-176559977 GTGTGTGTGGGCAGCTCCGGAGG + Intergenic
946482938 2:220074138-220074160 GAGCTTGTGGGCAGCTCCCAGGG + Intergenic
947511516 2:230758731-230758753 GTGTGTGTGGGGAGCACCTTGGG + Intronic
948031510 2:234821525-234821547 GGGTGTGTAGGGAGCTGCGCTGG - Intergenic
948169320 2:235888442-235888464 GACTGGTTGGGGAGCTCGCCTGG - Intronic
948477085 2:238227189-238227211 CAGTGTGTGGGCGCCTCCCCTGG - Intronic
948588821 2:239036876-239036898 GAGTGTTTGGGGTACTCCCGAGG - Intergenic
948720715 2:239898405-239898427 GTGTGTGTAGGCAGCTCCCTCGG - Intronic
1172644889 20:36462812-36462834 GAGTGTGTGGAGGGCACCACGGG + Intronic
1172843651 20:37916611-37916633 GAGTGGGTGGGGACTTGCCCAGG - Intronic
1173331799 20:42081445-42081467 GAGTGTGTGGGCAGAGCCCCGGG - Intronic
1174172938 20:48628273-48628295 GAGTGAGTGGGGGACTCCCTGGG + Intronic
1177143739 21:17384939-17384961 GTGTTTGTGGGGAGGTCTCCTGG + Intergenic
1178198047 21:30371248-30371270 TAGTGTGTGGGGAGATTCTCCGG - Intronic
1179422565 21:41248363-41248385 GAATCTGAGGTGAGCTCCCCAGG + Intronic
1179609385 21:42540059-42540081 GATGGTTTGGGGCGCTCCCCTGG - Intronic
1179731930 21:43372909-43372931 GAGTGTGTCTGGGCCTCCCCCGG + Intergenic
1182422300 22:30254425-30254447 GACTCTGTGGGGACCCCCCCTGG - Intergenic
1184648706 22:45909890-45909912 GAGTGTGCGGAGAGCCTCCCTGG + Intergenic
1185343893 22:50303113-50303135 GAGTGTGGGGGGGTCTCTCCTGG - Intronic
953399463 3:42600521-42600543 GCGTGTCTGGGGAGCTCTCGAGG - Intronic
954637483 3:52079084-52079106 GGGTGTGTGGGGAGTACCCCTGG + Intronic
959401338 3:105905704-105905726 AAGTATGTGGGGAGATGCCCAGG + Intergenic
960960484 3:123067291-123067313 GAACGTGCGGGGAGCTGCCCCGG + Intronic
961380985 3:126496435-126496457 GACTGTGTTGAGGGCTCCCCAGG + Intronic
962213896 3:133503124-133503146 GAGTTCGTGGGGGGCTCCTCTGG - Intergenic
962929525 3:140023711-140023733 GAGTCTGCTCGGAGCTCCCCTGG - Intronic
967112924 3:186311099-186311121 CAGTGTGTATAGAGCTCCCCAGG - Intronic
967164980 3:186772563-186772585 CAGTGTGTCCGGAGCGCCCCCGG + Intergenic
968072011 3:195789934-195789956 GAGTATGTGGTGGGCTCTCCTGG + Exonic
968431359 4:561054-561076 GAGTCTGTGGGGGCCTGCCCAGG - Intergenic
968808152 4:2788234-2788256 GGGGGTCTGGGGAGGTCCCCTGG + Intergenic
968872186 4:3247735-3247757 AAGTGTATGGGGAGGGCCCCAGG - Exonic
969448209 4:7257376-7257398 GTGGGGGTGGGGAACTCCCCGGG + Intronic
969621572 4:8281376-8281398 GGGTGGGTGGGTAGCCCCCCGGG + Intronic
970433809 4:16013739-16013761 GATTGTGTGGGGAGATGCCAGGG + Intronic
972497709 4:39649193-39649215 GAGTGGCTGTGGAGCTGCCCTGG + Intergenic
975613548 4:76224016-76224038 GTGTTTGTGGGGAGGTCTCCTGG - Intronic
979419226 4:120482971-120482993 GTGTGTGTGGTGAGATCACCTGG - Intergenic
982331590 4:154187100-154187122 GAGTGTCTGTGGCTCTCCCCAGG - Intergenic
984850972 4:184152272-184152294 GGGTGTGTGGGGAGCTGCTGGGG - Intronic
986170184 5:5308527-5308549 GAGGGTGTGAGGTGCTCCCTGGG - Intronic
989176943 5:38537256-38537278 GAGTGTTTGGGGAGCTGCTGCGG - Intronic
990889331 5:60631938-60631960 TAGTGTATGGGGAGATTCCCAGG - Intronic
993774031 5:91968759-91968781 GAGTCTGTGTGGAGCACCACAGG + Intergenic
999323697 5:150630311-150630333 GAGTGTTTAGGGAGCAGCCCAGG + Intronic
999432263 5:151534624-151534646 GTGAGTGTGGTCAGCTCCCCTGG + Exonic
1001043407 5:168353178-168353200 GGGAGTGTGGGGACCTTCCCAGG - Intronic
1001305183 5:170567267-170567289 TAGTTGGTGGGGAGGTCCCCAGG - Intronic
1001333257 5:170777274-170777296 GAGTGGGTGGAGACCTCCCCTGG + Intronic
1001933700 5:175690166-175690188 GACTGTGGGGTGAGCTGCCCTGG - Intergenic
1002086459 5:176778849-176778871 GAGTGTGGGAGGAGCAACCCAGG - Intergenic
1002107700 5:176888331-176888353 GAGTGTGTGAGCGGCACCCCAGG - Exonic
1002442736 5:179272833-179272855 GAGTCTCTGGGATGCTCCCCTGG + Intronic
1002447831 5:179300951-179300973 CAGTGTGTGGGGACATCCTCCGG - Intronic
1002698420 5:181105390-181105412 GGGTGGCTGGGGAGGTCCCCTGG - Intergenic
1002708479 5:181179518-181179540 GGGTGGCTGGGGAGATCCCCTGG + Intergenic
1002724564 5:181286134-181286156 GAGGGTGTGGGCAGCCCGCCAGG - Intergenic
1003106920 6:3224686-3224708 GAGGGGGTGGGGGGCTTCCCGGG - Exonic
1003302001 6:4892382-4892404 GAGTGTCTAGGGAGCTGCTCAGG + Intronic
1004640531 6:17510930-17510952 GGGTGTGAGGGGTTCTCCCCAGG + Intronic
1005483097 6:26273285-26273307 GCGTGTTTGGCCAGCTCCCCGGG - Exonic
1006711701 6:36078960-36078982 GAGTCTTTGGGGTGGTCCCCAGG - Intronic
1006741086 6:36309439-36309461 GTGGGTGTGGGGAGCCTCCCTGG + Intergenic
1014754869 6:125291912-125291934 GAGTGTGAGGGGAAGTGCCCAGG - Intronic
1016014483 6:139169939-139169961 GAGTTTGTAGGGAGCTCGCAGGG - Intronic
1019492224 7:1320966-1320988 CAGGGGGTGGGGAGCTCCTCAGG - Intergenic
1020012990 7:4816535-4816557 GCGTGGGTGGGGAGCTCGCTGGG - Intronic
1020189860 7:5987191-5987213 GAGTATGCGGCCAGCTCCCCAGG - Exonic
1020293063 7:6737483-6737505 GAGTGTGTGGCCAGCACCCCAGG + Intergenic
1026441330 7:70446863-70446885 GACTCTGTGGGGAGCCACCCAGG + Intronic
1026912792 7:74101282-74101304 GACTCTGTGGGGACCTCCCTTGG - Intronic
1028650706 7:93147595-93147617 GAGGGTGTGGGTAGCTCTCCTGG - Intronic
1028689166 7:93631881-93631903 AAGTGTGTGGGGAGCTAGACTGG - Intronic
1031027814 7:116699604-116699626 GACTGTGTGGTGAGCGCCCTGGG + Exonic
1032197964 7:129800056-129800078 GTGTGGGTGGGGAGCTCTGCGGG + Intergenic
1032402020 7:131630205-131630227 GAGTGGGTGGGGTTCCCCCCTGG + Intergenic
1032709308 7:134448368-134448390 GAGCCTGTGGGAAGCTCACCAGG + Exonic
1034290398 7:149926536-149926558 GAGTCTCTGAGGAGCTTCCCTGG + Intergenic
1034425357 7:151011002-151011024 GACTTGGTGGGGAGCTGCCCAGG + Intronic
1035821157 8:2593479-2593501 GAATGTGTGGGGAGTGCCACAGG + Intergenic
1039908575 8:41806118-41806140 GGGTCTTTGGGGAGCTCCCTGGG + Intronic
1041020330 8:53632307-53632329 GAGTGTCTAGTGAGCTTCCCTGG + Intergenic
1046100081 8:109603870-109603892 GAGTGTGCAGGCAGCTTCCCTGG + Intronic
1046407740 8:113796655-113796677 GTGTGTGTGGTGTGCTCCCCGGG + Intergenic
1048338734 8:133522844-133522866 GAGGGTGTTGGGAGCACACCAGG - Intronic
1049023610 8:139973892-139973914 GGGTGTGTGGGGAGGTTCGCAGG - Intronic
1049222848 8:141435783-141435805 GAGAGTTGGGGGAGCTCCCACGG - Intergenic
1049238855 8:141526341-141526363 GAGGGAGTGGGGAGCTCCCTGGG - Intergenic
1049694704 8:143977486-143977508 AAGTGTCTGGGGAGCGGCCCGGG + Exonic
1049804360 8:144532286-144532308 GCGTGTGTGGGGGACTCACCAGG + Exonic
1050354069 9:4766711-4766733 TGGTGTGTGGGGAGCACCCTGGG + Intergenic
1054815040 9:69466554-69466576 GAGTGTGTGGGGTGTGCCCAAGG - Intronic
1056381848 9:86063102-86063124 CAGTGTGTGGGGTGCTCCTCTGG - Intronic
1057035986 9:91811889-91811911 GAGTGTGTGGGGAGCTCCCCTGG - Intronic
1058850392 9:109006427-109006449 AAGAGTGTAGGTAGCTCCCCTGG - Intronic
1059412429 9:114140964-114140986 GAGGATGGGGGGAGCTCCCTAGG + Intergenic
1062172083 9:135140449-135140471 GAGTTGGTGGAGAGGTCCCCAGG - Intergenic
1062502379 9:136857066-136857088 GAGCCTGTGGGGAGGCCCCCGGG + Intronic
1062550853 9:137085955-137085977 GCGTGTCTGGAGAGCTCCCCCGG - Intergenic
1062558984 9:137130646-137130668 GGGTGTTTGGAGGGCTCCCCCGG + Intergenic
1062700688 9:137900200-137900222 GGGTGTGTGAGGTGCCCCCCTGG + Intronic
1187936597 X:24342235-24342257 GAGTGTCTGGGGGTCTCCCTGGG + Intergenic
1189155477 X:38752146-38752168 GAGAGGGTGGGGAGATCACCTGG + Intergenic
1190342510 X:49308761-49308783 GTGTGTGTGTGGACCTACCCAGG + Intronic
1190681641 X:52831213-52831235 TGGTGGGTTGGGAGCTCCCCAGG + Intergenic
1194922210 X:99780250-99780272 GTGTGAGTGGTGGGCTCCCCAGG + Intergenic
1201357388 Y:13112038-13112060 GGGTGTGTGTGGACCTACCCAGG + Intergenic