ID: 1057038928

View in Genome Browser
Species Human (GRCh38)
Location 9:91833513-91833535
Sequence CTGGCGTGTGGCGGTGCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 288}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057038928_1057038932 -7 Left 1057038928 9:91833513-91833535 CCACCAGCACCGCCACACGCCAG 0: 1
1: 0
2: 1
3: 20
4: 288
Right 1057038932 9:91833529-91833551 ACGCCAGAGCCGTGCCCCCCAGG No data
1057038928_1057038934 0 Left 1057038928 9:91833513-91833535 CCACCAGCACCGCCACACGCCAG 0: 1
1: 0
2: 1
3: 20
4: 288
Right 1057038934 9:91833536-91833558 AGCCGTGCCCCCCAGGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057038928 Original CRISPR CTGGCGTGTGGCGGTGCTGG TGG (reversed) Intronic
900145534 1:1157427-1157449 CTGGGCTGGGGCGGAGCTGGGGG - Intergenic
900187174 1:1337916-1337938 GTGGAGTGGGGCGGAGCTGGGGG + Intronic
900532472 1:3161445-3161467 ATGGCGTGAGGAGATGCTGGGGG + Intronic
900690464 1:3977599-3977621 CTAGCGTGTGGAGGGGCTGGGGG + Intergenic
900719173 1:4164113-4164135 CTGGTGTCTGGAGGTGCTGCAGG + Intergenic
901125085 1:6923585-6923607 ATGGAGGGTGGCGGGGCTGGGGG + Intronic
901261745 1:7876295-7876317 CTGATGTGTGTGGGTGCTGGTGG - Intergenic
902308949 1:15565759-15565781 TTGGCGGGTGGAGGTGGTGGAGG - Intronic
902835661 1:19045207-19045229 CTGAGGGGTGGCGGTGATGGTGG - Intergenic
903262276 1:22137733-22137755 CTGGGGTGCTGCAGTGCTGGGGG + Intronic
904297766 1:29532808-29532830 TTGGGCTGTGGCGGAGCTGGTGG + Intergenic
904325111 1:29723269-29723291 GTGGTGTGTGACGGTGATGGTGG - Intergenic
905126055 1:35716995-35717017 TTGGCGGGGGGCGGTGGTGGAGG - Intronic
905166627 1:36086924-36086946 CTGGAGTGTGGTGGAGCTGCAGG - Exonic
905823791 1:41014505-41014527 CTGGTGAGTGGAGGGGCTGGGGG + Intergenic
906189257 1:43885431-43885453 CTCGCGTGCCGGGGTGCTGGCGG + Intronic
906306908 1:44725252-44725274 CGGGCGTGAGGCTGTGCTGGCGG - Intronic
907097977 1:51799341-51799363 TTGGGGGGTGGGGGTGCTGGGGG - Intronic
907308083 1:53524713-53524735 CTGGCCTGATGCGGTGCAGGCGG + Intronic
907440660 1:54476103-54476125 GTGGCGGGAGGTGGTGCTGGGGG + Intergenic
912466995 1:109881231-109881253 CTTGTGTGTGGCGGTGGGGGAGG + Intergenic
915342097 1:155182170-155182192 ATGGGGTGTGGGGGTCCTGGTGG + Intronic
917427386 1:174929060-174929082 CTGTCGTGGGGTGGGGCTGGGGG + Intronic
918511131 1:185316242-185316264 CGGGGGTGTGCGGGTGCTGGGGG - Intronic
919982212 1:202649171-202649193 TTGGACAGTGGCGGTGCTGGAGG + Intronic
921456794 1:215380751-215380773 GTGGCCTGTGGTGGTGGTGGTGG + Intergenic
922518138 1:226223523-226223545 CCGGCGTCTGGCGGGGCCGGGGG + Intergenic
923141345 1:231163192-231163214 CCGGCCTGCGGCGGTGCAGGCGG + Exonic
923848561 1:237765966-237765988 CTGGGATGTTGCGGGGCTGGGGG + Intronic
924465013 1:244291742-244291764 CTGGTGTGAGGACGTGCTGGTGG - Intergenic
924850586 1:247825572-247825594 CTGGCGGGCGGAAGTGCTGGCGG + Intergenic
924850590 1:247825588-247825610 CTGGCGGGCGGAAGTGCTGGCGG + Intergenic
1062848694 10:727059-727081 CTGGCCAGGGGCAGTGCTGGGGG + Intergenic
1063082626 10:2782879-2782901 CTGAAGTGTGGCGGTGAAGGGGG - Intergenic
1063115327 10:3068180-3068202 GTGGCGTGCGGCGGAGTTGGGGG - Intronic
1063620873 10:7647444-7647466 CTGGCCTGTGGTGTTGCTGGAGG - Intronic
1064950873 10:20848722-20848744 CTGGCGAGTGGTGGTGGTGTTGG - Intronic
1065322154 10:24519980-24520002 CTTTCGTGTGGTGGTGGTGGAGG - Intronic
1067165619 10:43864371-43864393 CTGTGCTGTGGCTGTGCTGGAGG + Intergenic
1067319732 10:45206078-45206100 CTGGAGTATGGCGGTGGTGCTGG + Intergenic
1069625186 10:69863408-69863430 CGGGCATGTGGCAGAGCTGGTGG + Intronic
1071209207 10:83318018-83318040 GTGGCCTGTGGTGGTGGTGGTGG + Intergenic
1074126081 10:110530117-110530139 CGGGGGTGGGGCGGGGCTGGGGG - Intergenic
1075797673 10:125132501-125132523 CTGGCGAGGGGCGGAGTTGGAGG + Intronic
1075968917 10:126636575-126636597 CTGAAGTGTGGCAGAGCTGGAGG - Intronic
1076206734 10:128609960-128609982 CTGGGGTGTGGGGGTGCAGAAGG - Intergenic
1076306299 10:129467528-129467550 CTGGCGTGTGGCGGGGGTCGTGG + Intronic
1076617196 10:131763257-131763279 CTTGCCTGTGGCGGTGGAGGGGG - Intergenic
1076743921 10:132503268-132503290 CTGGGGTGTGGCGAGCCTGGCGG - Intergenic
1076858487 10:133128760-133128782 AGGACGTGTGGCAGTGCTGGTGG + Exonic
1076935980 10:133567766-133567788 CTGGAGTGTGGCTGGGCTGTTGG + Intronic
1077137987 11:1011037-1011059 TTGGTGTGTGGCCGTCCTGGTGG + Exonic
1077319697 11:1935719-1935741 GGGGCCTCTGGCGGTGCTGGAGG - Intronic
1077470859 11:2759897-2759919 CTGGCATGTGGGAGGGCTGGAGG - Intronic
1082763152 11:57145799-57145821 CTGGCATCTGGAGCTGCTGGTGG + Intergenic
1083799128 11:65036127-65036149 CTGGCATTTGGGGATGCTGGAGG + Intronic
1083883399 11:65559008-65559030 CTTTCGTCTGGCCGTGCTGGCGG + Intergenic
1084004979 11:66317824-66317846 CCAGCGTGTGGGGGTGTTGGGGG + Intergenic
1084491372 11:69480349-69480371 CTGGCGTGGAGAGGAGCTGGGGG + Intergenic
1084832339 11:71779296-71779318 ATGGCATGTGGCGGTGGGGGTGG - Intergenic
1086888175 11:92226514-92226536 CCGGGGTGTGGGTGTGCTGGCGG + Intergenic
1088837428 11:113589728-113589750 CTGGCGTGTGTCGGGGGAGGAGG - Intergenic
1088971600 11:114779342-114779364 CTGGCCTGGGGCGGTGTGGGGGG + Intergenic
1089138979 11:116271322-116271344 GTGTGGTGTGGCGGAGCTGGAGG - Intergenic
1089498050 11:118917768-118917790 CTGGAGTTGGGCGGGGCTGGGGG - Intronic
1090472863 11:126995878-126995900 CTGGTGTGTGCCTGTGTTGGTGG - Intronic
1091771326 12:3153061-3153083 GTGGGGTGTGGTGGTGGTGGTGG + Intronic
1094201378 12:27797907-27797929 CTGGCGGGTGACGGTGTTGTAGG - Exonic
1095808094 12:46343260-46343282 TGGGCTTGTGGTGGTGCTGGTGG - Intergenic
1096485007 12:51974156-51974178 TTGGCGGGTGGAGGTGGTGGGGG - Intronic
1096593730 12:52680235-52680257 GCGGCGTGTGGAGCTGCTGGTGG + Exonic
1097707483 12:62882909-62882931 CTGGGGAGTGGCGGTGGGGGTGG - Intronic
1098425845 12:70365763-70365785 CTGGCGCGCGGTGGTGCCGGAGG - Intergenic
1099222888 12:79935152-79935174 GTGACGGGTGGCCGTGCTGGGGG - Exonic
1100391868 12:94150645-94150667 CTGGCGTGAGCCGGTGCGAGGGG + Intronic
1101252117 12:102946625-102946647 CTGGAGTGTTGGGGTGATGGGGG + Intronic
1101717171 12:107320856-107320878 CTGGCGGGGGGCAGTTCTGGAGG + Intronic
1102101189 12:110280641-110280663 CTGGCGTGCGAAGGAGCTGGCGG + Intergenic
1102150923 12:110688888-110688910 CTGGCGTGTCCCGGCGCGGGCGG - Intronic
1103447591 12:121004285-121004307 CTGGACTGTGGCCATGCTGGTGG + Exonic
1103930660 12:124449188-124449210 ATTGGGTGAGGCGGTGCTGGAGG - Intronic
1105723914 13:23142307-23142329 CGGGCAGGTGGCAGTGCTGGGGG - Intergenic
1105844788 13:24284928-24284950 CTGGCGAATGGCAGAGCTGGAGG + Intronic
1106032174 13:26013286-26013308 CTGGCGTGTGCACGTGATGGGGG - Intronic
1108721693 13:53139071-53139093 CTGGCTGGGGGCGGGGCTGGAGG + Intergenic
1113209328 13:107956941-107956963 CTGGTGTGTGGGGTTGCTGCAGG - Intergenic
1113564200 13:111308812-111308834 CTAGGATGTGGCAGTGCTGGGGG - Intergenic
1114472404 14:22972866-22972888 CTGGGGTTTGGGGGAGCTGGAGG + Exonic
1118186429 14:63542745-63542767 CGGGCGAGCCGCGGTGCTGGAGG + Intronic
1120974528 14:90237085-90237107 CTGGGGGGTGGAGGTGGTGGGGG - Intergenic
1121617864 14:95325260-95325282 TTGGCGTGTGTAGGTGTTGGTGG + Intergenic
1121794463 14:96723780-96723802 CTGGTGTGTGGTGCTGCAGGTGG + Intergenic
1122388621 14:101365321-101365343 CCGGCGAGTGGCCATGCTGGGGG + Intergenic
1122414373 14:101541856-101541878 CTGGCCTGGGGAGGGGCTGGGGG - Intergenic
1122430241 14:101635643-101635665 CCAGCGTGGGGCGGTCCTGGCGG + Intergenic
1122720282 14:103717999-103718021 CTGGCATGTGGTGATGCTGAAGG + Intronic
1122787106 14:104168849-104168871 CTGGGGTGAGGCGGGGGTGGTGG + Intronic
1122887076 14:104714873-104714895 CTGGCGTGGGACGGTGCCCGGGG - Intronic
1122898295 14:104771418-104771440 CTGGGGTGGGGCAGTGCTTGAGG - Intronic
1123109042 14:105856785-105856807 CTGGAGTGTGACTGAGCTGGGGG - Intergenic
1124955885 15:34360085-34360107 ATGGGGGGTGGCGGTGGTGGGGG - Intronic
1131021851 15:89105826-89105848 CTGGCTTGAGGTGGTGGTGGTGG + Intronic
1131030915 15:89185373-89185395 CTGCGGTGTGGGGGTGCAGGCGG - Intronic
1132088541 15:98928146-98928168 CTGAGCTGTGGCGGTGCTGGTGG - Intronic
1132374331 15:101318811-101318833 ATGGCGTGTGACGGGGCTGTCGG + Intronic
1132729860 16:1356000-1356022 GTGGCGTGTGGGGGTTGTGGAGG + Intronic
1132735564 16:1384232-1384254 CTGCCGTGTTGGGGTGGTGGGGG - Intronic
1132752969 16:1467328-1467350 CTGGCATGTGGCAAGGCTGGGGG - Intronic
1133238507 16:4401255-4401277 CTGGTGTGTGGCGTTGGGGGAGG + Intronic
1133323501 16:4929419-4929441 CTGGCGTGGGGCACAGCTGGCGG - Intronic
1133700129 16:8300891-8300913 CTGATGTGTGTGGGTGCTGGTGG - Intergenic
1134302621 16:13005130-13005152 CTGGTGTGTGGAGTTGGTGGAGG + Intronic
1137559871 16:49495679-49495701 CTAGTGTGTGGCGGTGCTTTGGG - Intronic
1138552909 16:57757055-57757077 CTGTCCTGTGGCCGTCCTGGAGG + Exonic
1140313718 16:73873021-73873043 GTGGTGAGTGGCGGTGGTGGTGG + Intergenic
1140831163 16:78752906-78752928 CTGGAGTGTGCCGTTGCTGCTGG - Intronic
1141634651 16:85307713-85307735 TTGACGTGCGGAGGTGCTGGAGG - Intergenic
1141708416 16:85682932-85682954 GTGGGTTGAGGCGGTGCTGGCGG - Intronic
1142009833 16:87708312-87708334 CTGGCGGGTGGCGCGGCTGCTGG - Intronic
1142171410 16:88624630-88624652 GTGGCCTGTGGTGGGGCTGGAGG - Exonic
1142219185 16:88844878-88844900 CTGGCTTGTGGCAGGGCTGAGGG - Intronic
1142286196 16:89172456-89172478 GTGGCGTGTGGCAGCCCTGGGGG + Intronic
1143400411 17:6639301-6639323 CTCGGCTGTGGCGGTGCTGCAGG - Intronic
1143448737 17:7023343-7023365 GAGGGGAGTGGCGGTGCTGGAGG + Intronic
1143585553 17:7848662-7848684 CTGGGGGGTGGGGGTGGTGGTGG - Exonic
1143586999 17:7855324-7855346 TTGGTGTGTGGTGATGCTGGCGG + Intronic
1146788060 17:35735196-35735218 CTACCGGGTGGCCGTGCTGGGGG + Exonic
1148063806 17:44854240-44854262 CTGGGGTGGGGGAGTGCTGGTGG + Intronic
1148125185 17:45233072-45233094 CAGGTGTGTGGAGGTGGTGGGGG + Intronic
1149577542 17:57724915-57724937 TTGGCCTGTTGCGGTGCTGTTGG + Intergenic
1151412467 17:73940470-73940492 CTGGTGGGTGGCAGAGCTGGGGG + Intergenic
1151705561 17:75765229-75765251 CGGGCGCGGGGCGGGGCTGGCGG - Exonic
1151966091 17:77432560-77432582 CTGGCCTGAGGAGGGGCTGGTGG - Intronic
1152132275 17:78484740-78484762 CTGGTGTGGGGCGGTGGGGGGGG - Intronic
1152912487 17:83013341-83013363 CTGGGGGTGGGCGGTGCTGGGGG - Intronic
1157580853 18:48773465-48773487 CTGGCTGGTGGGGGTGGTGGTGG - Intronic
1158427631 18:57353429-57353451 CGGGCCCGGGGCGGTGCTGGCGG + Intronic
1160747612 19:719406-719428 ACGGCGTGTGGCGGTGTGGGCGG - Intronic
1161297334 19:3526581-3526603 CTGGGATGTGGGGGTGCGGGAGG + Intronic
1161421243 19:4176964-4176986 CTGGGGTGTGGCCCTCCTGGGGG - Intronic
1161943243 19:7418979-7419001 CTGGGGTGAGGGGCTGCTGGGGG - Intronic
1162462035 19:10819006-10819028 CTGGCGAGTCACGGAGCTGGGGG - Intronic
1162927440 19:13937452-13937474 GTGGCGTGTGGGGTTGATGGTGG - Intronic
1163443468 19:17333456-17333478 CACGCGTGTGGCGGTGGTGGCGG + Exonic
1163850979 19:19663493-19663515 CTGCCGTGTGGCCGTACCGGCGG - Exonic
1164576591 19:29408866-29408888 CAGGCATGTGACGGTGCTTGGGG - Intergenic
1165112125 19:33508587-33508609 CTGGCGGCTGGTGCTGCTGGCGG + Intronic
1165118608 19:33544842-33544864 CTGGGGTCTGGCTGCGCTGGAGG - Intergenic
1165448230 19:35868492-35868514 CCGGCGCGGGGCGGGGCTGGCGG + Exonic
1165861222 19:38910607-38910629 CTGGCTGGTGGTGGTGGTGGTGG + Exonic
1166727445 19:45037566-45037588 CTAGCGTGTGGCGGTGCCGGGGG - Exonic
1166786597 19:45370735-45370757 CTCGGGTGAGGCGGTGCGGGAGG + Intronic
1167102759 19:47414358-47414380 CTGTCGTATGGCTGGGCTGGGGG + Intronic
1167154599 19:47730321-47730343 CAGGGGTGTGGCCGGGCTGGGGG - Intronic
1167470027 19:49670395-49670417 CCGGCGCGTGGCCGGGCTGGGGG + Exonic
1167613069 19:50516692-50516714 GTGTGGTGTGGCGGTGCTGGGGG + Intergenic
1168147955 19:54430133-54430155 CTGGCGGGTGGCGGGGCTCCAGG - Intronic
1168685622 19:58347587-58347609 GTGGAGTGGGGCGGTCCTGGCGG - Exonic
925380686 2:3423513-3423535 ATGGCGGGTGCCGGGGCTGGGGG - Intronic
925713787 2:6767036-6767058 TTGGCGGGTGGCGGGGCTAGGGG - Intergenic
926301974 2:11611198-11611220 CAGGGGTGTGGGGGTGCTGCTGG - Intronic
927845352 2:26468891-26468913 GGGGCCTGTGGTGGTGCTGGGGG + Intronic
928486545 2:31738120-31738142 CTGGCATCTGGAGGAGCTGGAGG - Intergenic
935638253 2:105267010-105267032 TTGGAGTGTGGGGGTGGTGGGGG + Exonic
937585524 2:123543291-123543313 AGGGCGTGTTGCGGTGTTGGGGG + Intergenic
937712627 2:124995620-124995642 ATAGCTTGTGGCGGTGCGGGGGG + Intergenic
938540435 2:132280324-132280346 CTCCCGTGAGGGGGTGCTGGTGG - Intergenic
943725565 2:191247823-191247845 CTGGCCTCTGGCCGTTCTGGTGG + Intronic
944271179 2:197786217-197786239 GTGGCAGGTGGCGGTGCGGGCGG + Exonic
947735077 2:232450095-232450117 CTGCCTCGTGGCGGTGCTGCTGG - Intergenic
947821663 2:233075744-233075766 CTTGTGTGTGGCGGGGCTGATGG + Intronic
947943133 2:234076110-234076132 CTGGGGTCTTGCTGTGCTGGAGG + Intronic
948465973 2:238151762-238151784 AGGGCGTGGGGCGGGGCTGGAGG + Exonic
948481554 2:238253399-238253421 CTGGCGTGGGGAGGTGCCGGGGG + Exonic
948574506 2:238941054-238941076 CTGGAGTGAGGCGAGGCTGGAGG - Intergenic
948602815 2:239116923-239116945 CTGGGGTCGGGGGGTGCTGGAGG - Intronic
1169587072 20:7096950-7096972 ATGGCCTGTGGTGGTGGTGGTGG + Intergenic
1169589156 20:7121441-7121463 CTGCCGTGTGACCCTGCTGGGGG + Intergenic
1169757826 20:9062340-9062362 CTGTGGTGTGGTGGTGGTGGTGG + Intergenic
1171416004 20:24980862-24980884 CTGGCGTGTAGAGGTGATGGAGG - Intronic
1173187882 20:40855123-40855145 CGGGGGTGGGGCGGTGGTGGTGG - Intergenic
1174553680 20:51379071-51379093 CTGCTTTGTGGCGATGCTGGTGG + Intergenic
1175404420 20:58717236-58717258 GGGGCGGCTGGCGGTGCTGGGGG + Intronic
1176187003 20:63786027-63786049 CTGGCAGGTGCCCGTGCTGGAGG - Intronic
1178580962 21:33838282-33838304 CTGTCGGGAGGCTGTGCTGGTGG + Intronic
1179812237 21:43879475-43879497 CGGGTGTCTGGCTGTGCTGGAGG + Intronic
1180845054 22:18976313-18976335 CTGGCATGTGGCGGTGGAGGGGG - Intergenic
1181766242 22:25094293-25094315 CTGGCGTGTTGTGCTGCGGGTGG + Intronic
1184017318 22:41795805-41795827 CTGGCCTGAGGAGGTGCTAGGGG - Exonic
1184178774 22:42805464-42805486 CTGACCTGTGGGGCTGCTGGAGG + Intronic
1184856508 22:47149467-47149489 CTGGCCTGTGGCCGTGGGGGTGG - Intronic
1185086230 22:48742455-48742477 GTGCTGTGTGGCGGAGCTGGCGG + Intronic
1185404825 22:50641810-50641832 CCTGTGTGTGGCGGGGCTGGGGG + Intergenic
949888385 3:8714068-8714090 CTGGCCTGTGACCCTGCTGGGGG + Intronic
952979739 3:38725084-38725106 CTGGAGGGTGGCGGTGAAGGTGG - Intronic
953374050 3:42413666-42413688 CTGAAGGGTGGGGGTGCTGGTGG - Intergenic
953796810 3:45992233-45992255 CTGGGGAGGGGAGGTGCTGGTGG + Intronic
953846446 3:46430884-46430906 CTGTTGGGAGGCGGTGCTGGGGG - Intergenic
955060699 3:55489433-55489455 CTGGGGTGTGGGGGTGGAGGTGG - Intronic
955405299 3:58622120-58622142 CTGGGCTGTGGATGTGCTGGAGG + Intronic
957236748 3:77602710-77602732 CTGGTGTGTGGTGGTGGTGGAGG - Intronic
962023835 3:131527042-131527064 CCGGCGCGTGGCCGAGCTGGGGG + Intergenic
962213161 3:133496249-133496271 CTGGCCTGTGGTGATGCTGCAGG - Intergenic
962310152 3:134320542-134320564 CTGGGGGGTGGGGGTGCTGCAGG - Intergenic
965133686 3:164734696-164734718 CTGGAGTGAGGTGGTCCTGGGGG + Intergenic
965630420 3:170726962-170726984 CTGGCTTGTGGTGGTGGTGGAGG + Intronic
967158926 3:186718143-186718165 GTGGTGGGTGGCGGTGGTGGTGG - Intronic
967159018 3:186718392-186718414 GTGGTGGGTGGCGGTGGTGGTGG - Intronic
968272801 3:197417559-197417581 CTGGCGTGTGTCGGGGCAAGGGG + Intergenic
968518356 4:1024154-1024176 CTGGCGGGCGGGGGTGCTGGTGG + Intronic
968949464 4:3683179-3683201 CTGGGGTTCGGAGGTGCTGGGGG - Intergenic
972396899 4:38664937-38664959 CTGGGTTGTGGTGGTGGTGGGGG - Intronic
972671849 4:41219988-41220010 CTGGCGTGTGGGTGTAGTGGGGG - Intergenic
972723626 4:41726342-41726364 CTGAAGTGTGGCGGTATTGGTGG + Intergenic
974003209 4:56531030-56531052 CACGGGTGTGGCGGAGCTGGCGG - Exonic
975035741 4:69678328-69678350 CTGGGGTTTGTCGGTGTTGGGGG - Intergenic
975870839 4:78776595-78776617 GCGGCGGGTGGCGGGGCTGGCGG + Exonic
978793480 4:112686396-112686418 CTGGTGTGGGGTGGGGCTGGGGG + Intergenic
984668011 4:182448860-182448882 CTGGCGGGAGGCGGCGGTGGCGG + Intronic
986966901 5:13284523-13284545 CTGTGGTGTGGCTGTGCTGGAGG + Intergenic
987707680 5:21476293-21476315 CTGCCTTGTGGAGGTACTGGTGG + Intergenic
989102364 5:37834925-37834947 CTGGCCTGCAGCGGTGCCGGAGG - Intronic
989774019 5:45181093-45181115 CTGGTGTGTGTCAGTGGTGGGGG + Intergenic
990287812 5:54317534-54317556 CTGGCCTGTGGGGGTGAGGGTGG - Intergenic
991972396 5:72153596-72153618 GTGGCGTGTGGTGGTGGTGGTGG + Intronic
993290547 5:86062578-86062600 CTGGCGTGGGGGAGGGCTGGGGG + Intergenic
994419742 5:99517260-99517282 CTGCCTTGTGGAGGTACTGGTGG + Intergenic
994487468 5:100397881-100397903 CTGCCTTGTGGAGGTACTGGTGG - Intergenic
998005525 5:138654492-138654514 CTGTCTTGTGGCGGTGGGGGGGG - Intronic
998554707 5:143112045-143112067 CTGGCGTGTGGCAGTGAGGGAGG + Intronic
998969300 5:147574210-147574232 CTGGCTTGTGTCAGTCCTGGAGG + Intergenic
999322634 5:150624794-150624816 CTGGCGCGGGGCGGGGGTGGCGG + Intronic
999322812 5:150625427-150625449 CTGGGGTCTGGCTGTGCCGGTGG + Intronic
999568382 5:152891714-152891736 CTGCCGTGTGACCCTGCTGGGGG + Intergenic
999715437 5:154356408-154356430 CTGAGGTGTGGCAGGGCTGGGGG + Intronic
1001290720 5:170457319-170457341 CTGACATGTGGTGGTGGTGGTGG - Intronic
1001304392 5:170561057-170561079 CTGGTGCGTGGCTGTGCTGTGGG + Intronic
1002051951 5:176576266-176576288 GTGCTGGGTGGCGGTGCTGGTGG + Intronic
1002644019 5:180644332-180644354 CGGGCGTGTGGTGGACCTGGGGG + Intronic
1004435293 6:15586737-15586759 TTTGTGTGTGGGGGTGCTGGGGG - Intronic
1005915173 6:30345156-30345178 CTGGAGCGCGGCGGTGATGGCGG + Exonic
1006058630 6:31403700-31403722 CTGGTGAGTGGCGTTCCTGGCGG + Exonic
1006715922 6:36120513-36120535 GTGGGGGGTGGCGGTGGTGGTGG - Intergenic
1007411480 6:41664585-41664607 TTGGCGTGTGGTGGTGGTGGGGG - Intergenic
1007742558 6:44021760-44021782 GAGGGGTGTGGTGGTGCTGGGGG - Intergenic
1007743129 6:44024979-44025001 GAGGGGTGTGGTGGTGCTGGGGG - Intergenic
1008752259 6:54749938-54749960 CAGGAGTGTGGAGTTGCTGGAGG + Intergenic
1009020532 6:57944242-57944264 CTGCCTTGTGGAGGTACTGGTGG - Intergenic
1010661216 6:78572624-78572646 GTGGGGGGTGGGGGTGCTGGGGG + Intergenic
1011462909 6:87624838-87624860 TTGGTGGGTGGGGGTGCTGGGGG - Intronic
1011520263 6:88196942-88196964 CTGGAGTGTGGCTGTGATTGTGG + Intergenic
1012392011 6:98752449-98752471 TTGGCGGGTGGGGGTGCTAGGGG - Intergenic
1013375256 6:109508662-109508684 ATGGCCCGTGGCTGTGCTGGAGG + Intronic
1013853938 6:114548926-114548948 TTGGAGTGTGGCAGTGCTGAGGG + Intergenic
1014001443 6:116370661-116370683 CTGGCGGGCGGGGGTGCGGGTGG + Intronic
1014122358 6:117740058-117740080 CTGGCTGGTGGCGGCGGTGGGGG - Intergenic
1016451472 6:144187311-144187333 CTTGCAGATGGCGGTGCTGGTGG + Exonic
1018176100 6:161180703-161180725 CTTCCCTGTAGCGGTGCTGGAGG + Intronic
1019318173 7:401136-401158 TTGGAGTGTGGCTGGGCTGGAGG - Intergenic
1019571334 7:1713859-1713881 CGGGCGTGCGGCAGTGCTGGGGG - Intronic
1020125856 7:5532219-5532241 CTTGCGTGGGGTGGTGATGGAGG - Intronic
1020210459 7:6154521-6154543 CCGGGGCGTGGCGGTCCTGGCGG - Exonic
1021774895 7:24043907-24043929 CTAGTATGTGGCAGTGCTGGGGG - Intergenic
1021884491 7:25125335-25125357 CTGACGTGCGGCCGAGCTGGCGG + Exonic
1022104709 7:27189543-27189565 CTGGAGTGTGGAGGTGCTCCCGG - Intergenic
1023037319 7:36143533-36143555 CTGGCCTGTGGTGGGGCTGAAGG + Intergenic
1024896325 7:54266010-54266032 CTGCTGTGTGGGGGTGGTGGAGG - Intergenic
1025057993 7:55780480-55780502 CTGGCGTTTGGCTTTGCTGTTGG - Intergenic
1025828451 7:65029993-65030015 CTGGCGTTTGGCTTTGCTGATGG + Intergenic
1028563861 7:92206004-92206026 CTGGAGTTTGCAGGTGCTGGTGG - Intronic
1030937805 7:115607301-115607323 ATGGTGTGTGGTGGTGATGGTGG - Intergenic
1033199940 7:139359956-139359978 CTGGCGGGTGGCGGTGTTGAAGG + Exonic
1034273203 7:149813123-149813145 CTTGGGTGTGGAGGTGCTGAGGG + Intergenic
1034414639 7:150958064-150958086 CTGGCGTGGCGCGGTGGCGGGGG + Exonic
1035240054 7:157523589-157523611 CTGGGATGTGCAGGTGCTGGGGG + Intergenic
1036578818 8:10054373-10054395 CGGGCGCGGGGCGCTGCTGGCGG - Exonic
1036583321 8:10099262-10099284 CAGGCGTGAGGCAGAGCTGGTGG + Intronic
1036643207 8:10596900-10596922 CAGGCGTGTGGCCCTCCTGGTGG + Intergenic
1036726293 8:11223946-11223968 CGGGCGTGGGGTGGTGGTGGGGG - Intergenic
1037133409 8:15433592-15433614 CTGGCATGTGGTGGTGGCGGTGG - Intronic
1037986134 8:23291771-23291793 CAGGCGTGTGGCCATGCAGGGGG - Intronic
1039878607 8:41609064-41609086 CTGCCGTGCGGCAGTGCAGGAGG + Intronic
1039896423 8:41719641-41719663 CTGGTGAGTGGGGGTGCTGCTGG - Exonic
1042816389 8:72882176-72882198 CCCCCGTGTGGAGGTGCTGGTGG - Intronic
1047262617 8:123275340-123275362 CCGGCGTGTGGAGCAGCTGGAGG - Intronic
1047719066 8:127621763-127621785 CTGGTGGGTGCCGGGGCTGGGGG + Intergenic
1048190223 8:132281694-132281716 TTGGGGTGTGGGGGTGCCGGTGG - Intronic
1048643256 8:136388172-136388194 GTGGAGTGTGGAGGGGCTGGAGG - Intergenic
1049183335 8:141234822-141234844 CTGGAGCCTGGCTGTGCTGGGGG - Intronic
1049671064 8:143870070-143870092 CTGGCATGGGGAGGTGGTGGTGG + Exonic
1049777640 8:144413913-144413935 CCGGCGGGTGGGTGTGCTGGGGG - Intronic
1053166237 9:35846099-35846121 CTGCAGTGTGGGGGTGGTGGTGG + Intronic
1053307507 9:36994925-36994947 CTGGGGTGTGGTCGTGGTGGGGG - Intronic
1053410634 9:37914263-37914285 GTGGTGGGTGGCGGTGGTGGCGG - Intronic
1057038928 9:91833513-91833535 CTGGCGTGTGGCGGTGCTGGTGG - Intronic
1057276106 9:93676745-93676767 CTGGCTGCTGGCCGTGCTGGTGG - Exonic
1060548305 9:124473580-124473602 CTGGCATGGGGAGGTGCTAGGGG - Intronic
1060816991 9:126640235-126640257 CTGAGGTGTGGGGGTGCTGGTGG + Intronic
1061570837 9:131476617-131476639 CCGCCGTGTGTCGGGGCTGGGGG + Intronic
1061674565 9:132208449-132208471 GTTGGGGGTGGCGGTGCTGGAGG + Intronic
1061839400 9:133348763-133348785 CTGTCGAGGGGTGGTGCTGGGGG + Intronic
1061896892 9:133652880-133652902 CTGGCGTTGGCAGGTGCTGGAGG - Intronic
1062646399 9:137550697-137550719 CTGGGGTGTGGGGGTGCCGCTGG + Intergenic
1062646439 9:137550803-137550825 CTGGGGTGTGGGGGTACTGCTGG + Intergenic
1062646476 9:137550909-137550931 CTGGGGTGTGGGGGTGCCGCTGG + Intergenic
1190008136 X:46759212-46759234 CGGGCGGGGGGCGGTGCTTGGGG - Intergenic
1197709440 X:129655070-129655092 CTGGAGGGGGGCGGTGCGGGAGG - Intergenic
1199156180 X:144551394-144551416 ATGGCCTGTGGTGGTGGTGGTGG + Intergenic
1199720800 X:150541680-150541702 CAGCCTTGTGGCGGTGCTTGGGG - Intergenic
1200122551 X:153798007-153798029 CTGGCGTGTGGGGGTGGGGAGGG - Intronic