ID: 1057048378

View in Genome Browser
Species Human (GRCh38)
Location 9:91903311-91903333
Sequence CAGGGGAAGCCAGCGGGTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 262
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 239}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057048378_1057048393 25 Left 1057048378 9:91903311-91903333 CCCCAACCCGCTGGCTTCCCCTG 0: 1
1: 0
2: 0
3: 22
4: 239
Right 1057048393 9:91903359-91903381 CTGCTCCAGTTCTTCCCATCGGG No data
1057048378_1057048384 -7 Left 1057048378 9:91903311-91903333 CCCCAACCCGCTGGCTTCCCCTG 0: 1
1: 0
2: 0
3: 22
4: 239
Right 1057048384 9:91903327-91903349 TCCCCTGCCCAAGAAAGTCTGGG No data
1057048378_1057048383 -8 Left 1057048378 9:91903311-91903333 CCCCAACCCGCTGGCTTCCCCTG 0: 1
1: 0
2: 0
3: 22
4: 239
Right 1057048383 9:91903326-91903348 TTCCCCTGCCCAAGAAAGTCTGG No data
1057048378_1057048389 -2 Left 1057048378 9:91903311-91903333 CCCCAACCCGCTGGCTTCCCCTG 0: 1
1: 0
2: 0
3: 22
4: 239
Right 1057048389 9:91903332-91903354 TGCCCAAGAAAGTCTGGGAAGGG No data
1057048378_1057048392 24 Left 1057048378 9:91903311-91903333 CCCCAACCCGCTGGCTTCCCCTG 0: 1
1: 0
2: 0
3: 22
4: 239
Right 1057048392 9:91903358-91903380 TCTGCTCCAGTTCTTCCCATCGG No data
1057048378_1057048388 -3 Left 1057048378 9:91903311-91903333 CCCCAACCCGCTGGCTTCCCCTG 0: 1
1: 0
2: 0
3: 22
4: 239
Right 1057048388 9:91903331-91903353 CTGCCCAAGAAAGTCTGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057048378 Original CRISPR CAGGGGAAGCCAGCGGGTTG GGG (reversed) Intronic
900124102 1:1061992-1062014 CTGGGGAAGACAGAGGGCTGGGG + Intergenic
900300849 1:1976382-1976404 GAGGGGAAGCAAGAGGGTGGAGG - Intronic
900407062 1:2497412-2497434 CAGGGGAGGCTAGCGTGTGGTGG + Intronic
901081332 1:6585892-6585914 CAGGAGAAGCCACAGGGGTGGGG - Intronic
901796103 1:11680661-11680683 CGGTGGAAGCGAGCGGGTTCTGG - Intronic
902048224 1:13541929-13541951 CAGGGGAAGCCTGGGGGCTCAGG - Intergenic
906143449 1:43546736-43546758 CACGGGAAGACAGCAGGCTGGGG - Intronic
906326095 1:44846988-44847010 CAGGGGAAACCACTGAGTTGGGG + Intergenic
907385795 1:54124706-54124728 CAGGGGAATCCCGAGGGATGGGG + Intergenic
913404655 1:118476207-118476229 TAGGGGACCCCAGTGGGTTGCGG - Intergenic
915526649 1:156480246-156480268 AAGGGGAAGGCAGCGAGGTGGGG - Intronic
915914780 1:159934380-159934402 CAGGGGAAGGGAGCAGGCTGAGG + Intronic
915940259 1:160114377-160114399 GAGGGGAAGCCAGCGGAGTGGGG - Intergenic
916935631 1:169625324-169625346 CAAGGGAAGGCAGAGGATTGAGG - Intronic
919896360 1:202011954-202011976 CAGAGAAGGCCAGCTGGTTGGGG + Exonic
924741008 1:246794156-246794178 CAGGGGAAGGCAGGAGGGTGGGG + Intergenic
1065348083 10:24768123-24768145 CAGTGGAAGCTAGAGTGTTGAGG - Intergenic
1068216836 10:53991946-53991968 AAGGGGACCCGAGCGGGTTGCGG - Intronic
1069664609 10:70146209-70146231 CAGGGGACGCCCGCGGGACGGGG + Exonic
1069892172 10:71658781-71658803 GAGGGGAAGCCAGGGGCTTTGGG - Intronic
1073154575 10:101336252-101336274 CTGGGGAAGCCAGCGAGGGGTGG + Intergenic
1073258574 10:102171612-102171634 TAGGGGAAGCTAGAGGGTTGGGG + Intergenic
1073425101 10:103451433-103451455 CAGAGGAAGCCAGGGAGTGGAGG + Intronic
1073480405 10:103783091-103783113 CAGGTGAAGCGAGCGAGCTGGGG + Intronic
1074416502 10:113271953-113271975 CAGTGGTGGCCAGGGGGTTGTGG + Intergenic
1074706936 10:116141506-116141528 CAGGGAAACCGAGGGGGTTGGGG + Intronic
1076239312 10:128891933-128891955 CAGGGGAAACTTGGGGGTTGGGG + Intergenic
1076302386 10:129438025-129438047 CAGGGGGTGCCAGTGGGATGGGG - Intergenic
1077383242 11:2257252-2257274 GAAGGGAAGCCAGAGGGTGGGGG + Intergenic
1078238600 11:9509293-9509315 CAGGGGCAGCCAGCCTGTTTGGG + Intronic
1079242345 11:18729599-18729621 CAGGGCAGCCCAGCGGGTGGGGG + Intronic
1080902530 11:36509847-36509869 CGTGGGAAGCAAGCGGGTAGGGG + Intronic
1083266919 11:61551047-61551069 CCAGGGAAGCCGGCGGGTGGTGG + Intronic
1083770412 11:64863949-64863971 CAGGGGAAGCCAGGGCTCTGTGG + Intronic
1083876537 11:65526913-65526935 CAGGGGTAGCCAGCTGGCAGAGG - Intronic
1084189064 11:67490762-67490784 CAGGGGAGGCCAGTGGGCAGTGG - Intronic
1085794077 11:79520681-79520703 CAGGGGAAGCCAGGAGGCTGGGG - Intergenic
1085887478 11:80537124-80537146 AAGGAGAAGCCAGCTGGGTGTGG - Intergenic
1086696978 11:89858903-89858925 CAGGGGAAGCCAGAGAGAAGAGG + Intergenic
1086709180 11:89985584-89985606 CAGGGGAAGCCAGAGAGAAGAGG - Intergenic
1087014684 11:93543455-93543477 CGGGGGCAGCCAGCGAGTTAGGG - Exonic
1088899212 11:114102544-114102566 CAGGGGCAGCCGGGGGGTGGGGG - Intronic
1090626779 11:128615139-128615161 CTGGGGCAGCCAGCGGCTTCTGG - Intergenic
1091804043 12:3343292-3343314 CAGGGGCAGCCAGCAGGTGCGGG + Intergenic
1092056536 12:5512387-5512409 GAGGGGAAGCCAGAGGGAAGTGG + Intronic
1096109386 12:49020159-49020181 CAGGGGGAGCCAGAGGGTGATGG - Exonic
1100189065 12:92171219-92171241 CAGGGGAAGGCTGCGGGTGACGG - Intergenic
1100888401 12:99098252-99098274 TATGGGAAGCCAGTGGGGTGAGG - Intronic
1102361834 12:112294892-112294914 CCGGGGAAGGCAACTGGTTGGGG - Intronic
1102562072 12:113769440-113769462 TAGGGGTGGCCAGCGGGCTGGGG + Intergenic
1103923830 12:124413057-124413079 GAGGGGAAGCCTGTGGGCTGGGG - Intronic
1103948621 12:124540390-124540412 CTGGGGCAGCCAGAGGGCTGGGG + Intronic
1106141476 13:27015334-27015356 CAGGGGGAGCCTGCGGGAAGAGG + Intergenic
1107854979 13:44606003-44606025 CAGGGGAAGTCAGTGGGGGGAGG + Intergenic
1107935358 13:45341372-45341394 CTGGGCACGCCAGCGGGTAGGGG + Intergenic
1110736388 13:78941994-78942016 TAGGGCAAGCCAGCAGGCTGGGG + Intergenic
1111338000 13:86847133-86847155 AAGGGGACCCCAGTGGGTTGCGG - Intergenic
1112435890 13:99390884-99390906 CAGGGGAAGGCAGAGGATGGCGG - Intergenic
1112439899 13:99417726-99417748 CAGGGAAAGGCTGCGGGCTGAGG + Intergenic
1113078583 13:106492707-106492729 CAAGGGAAGACAGTGGTTTGTGG - Exonic
1113808571 13:113123814-113123836 CTGGGGAGGGCAGGGGGTTGAGG - Intronic
1114648252 14:24267606-24267628 GTGGGGAGGCCAGCGGGATGAGG + Intronic
1114816764 14:25968229-25968251 ATGGGGAAGGCAGCAGGTTGGGG + Intergenic
1115472140 14:33779009-33779031 GAGGGGAAGCCAGGGAGATGGGG + Intronic
1118779017 14:68993761-68993783 GAAGGGAAGCCAGCTGGTGGAGG + Intergenic
1120204013 14:81568083-81568105 CAGGCGAATCCAGCAGCTTGGGG + Intergenic
1121990565 14:98552901-98552923 CAGGGGATGCCCGAGAGTTGGGG - Intergenic
1122557614 14:102590170-102590192 GAGGGGAGGGCAGCGGGATGGGG + Intergenic
1122967090 14:105136456-105136478 CGGGGGAGGCCACCGGGCTGTGG - Intergenic
1124247362 15:28082291-28082313 TAGGGGAGTCCAGCGTGTTGGGG - Intronic
1126837194 15:52679227-52679249 CGGGGGAAGCCCGGGGGTCGCGG - Intronic
1127822579 15:62672455-62672477 CAGGGGAGGTCAGTGGGATGGGG + Intronic
1128765833 15:70250664-70250686 CGGGGGAGGCCTGCGGGCTGTGG - Intergenic
1129266114 15:74394099-74394121 CTGGGGAAGGCAGCGAGTTTGGG - Intergenic
1129271652 15:74422249-74422271 CAGGGGGAGCCAGGAGGTGGGGG - Intronic
1129740009 15:77985550-77985572 CAGGGGAAGCCAGGGTGAGGGGG - Intronic
1131311591 15:91295628-91295650 CTGGGGAAGCCTGCAGTTTGGGG + Exonic
1134042079 16:11076515-11076537 CAGGGGAACCCAGCAGCTTCAGG - Intronic
1134236735 16:12472231-12472253 CAGGGGAAGGCTGGGGGTGGTGG + Intronic
1134333609 16:13273083-13273105 CAGGTGAAGCCAGTGGAATGGGG - Intergenic
1135551732 16:23403795-23403817 GAGGTGCAGCCAGCAGGTTGTGG + Exonic
1136412501 16:30085525-30085547 CTGGGGAAGCCAGCAGGCAGCGG - Intergenic
1136420706 16:30130956-30130978 CAACGGAAGCCAGCAGGTGGTGG - Intergenic
1136456254 16:30381461-30381483 CACCGGAAGCCAGCTGGGTGTGG + Exonic
1138553198 16:57758346-57758368 CAGAGGCAGCCAGCGGGTGGGGG - Exonic
1139909970 16:70391681-70391703 CAGGGGTAGGCAGGGGGTAGAGG + Intronic
1140026286 16:71293191-71293213 TAGGTGAAGCCAGGGGGATGTGG - Intergenic
1140774956 16:78241016-78241038 CAGGGGCAGCCAGCCAGGTGAGG - Intronic
1141438662 16:84015302-84015324 AAGGGGAAGCCAGCAAGGTGGGG - Intronic
1141912670 16:87070736-87070758 AAGGGGATGCCACCGGGTGGTGG + Intergenic
1142924192 17:3218757-3218779 CAGGGCCTGTCAGCGGGTTGGGG + Intergenic
1143001281 17:3796755-3796777 CTGGGGGAGACAGAGGGTTGAGG - Intronic
1143425235 17:6831163-6831185 CAGGGGAAGCCAGCTGGCAGAGG + Intronic
1143610875 17:8016669-8016691 CAGGGGAAGCCCCGGGGTTTAGG - Intronic
1144850362 17:18241059-18241081 CAGGGGAACTCAGCAGGCTGAGG - Intronic
1144872723 17:18380827-18380849 CAGGGGACGCCACCTGGATGGGG + Intronic
1146472790 17:33138058-33138080 CAGAGGAATCCAGCAGTTTGGGG + Intronic
1147573641 17:41586637-41586659 CTGGGGGAGCCTGCGGGCTGGGG - Exonic
1147577760 17:41612494-41612516 CTGGGGGAGCCTGCGGGCTGGGG - Exonic
1149453702 17:56770311-56770333 CTGAGGAAGGCAGCGGGATGAGG + Intergenic
1150542645 17:66119191-66119213 CAGGGGAGGCTAGAGGGTTGTGG + Intronic
1151331075 17:73409050-73409072 AAGGGAAAGGCAGAGGGTTGGGG + Intronic
1151748527 17:76024172-76024194 CAGGGGATGCCACCTGGATGGGG - Intronic
1152147481 17:78577031-78577053 CAGGAGAAGCCAGGGGGCTGAGG + Intronic
1152903583 17:82958551-82958573 CAGGGGGTGCCACAGGGTTGGGG - Intronic
1156764463 18:40634986-40635008 AAGGGGACCCCAGCAGGTTGAGG + Intergenic
1157802170 18:50629695-50629717 CTGGAGAAGGCAGGGGGTTGGGG + Intronic
1160304337 18:77717805-77717827 AAGGGGAAGCCATCGGCTTGAGG + Intergenic
1161004856 19:1930059-1930081 AAGCTGAAGCCAGAGGGTTGAGG - Intergenic
1161332008 19:3692924-3692946 CAGGGGAAGTGAGGGGGTTGTGG - Intronic
1161596216 19:5152279-5152301 CAGGGGAAGCCCGGGGGTCTGGG + Exonic
1161949322 19:7459016-7459038 GAGGGGAAGCCAGCTGGTTCTGG - Intronic
1162094808 19:8304034-8304056 CAGGGGAGGCCAGGGGGCGGTGG + Exonic
1162509885 19:11111645-11111667 CACGGGAAGGCGGCGGGTGGGGG + Intronic
1163124406 19:15237045-15237067 CAGGAGCGGCCAGCTGGTTGGGG + Exonic
1164729120 19:30488676-30488698 CAGGGGCAGAGGGCGGGTTGAGG + Intronic
1164832664 19:31334552-31334574 CAGGCAAAGCCAGCAGGGTGGGG + Intronic
1165714453 19:38035413-38035435 TAGGGGAAGCCACGGGGCTGTGG + Intronic
1165953122 19:39485815-39485837 CCGGGAAACCCAGTGGGTTGGGG + Intronic
1166298415 19:41900752-41900774 AAGGGAAAGGCAGTGGGTTGAGG + Intronic
1166301119 19:41912800-41912822 CTGGGGAAGCCTGAGGGGTGGGG + Intronic
1166643367 19:44513047-44513069 CTGGGGAATTCAGAGGGTTGTGG - Intronic
1168311564 19:55463488-55463510 CAGGGGATCCCCGAGGGTTGGGG - Intergenic
1168348802 19:55664007-55664029 CTGGGGAAGCGAGGGGCTTGTGG + Intronic
925310199 2:2876430-2876452 CAGGGGAGGCCAGCGGCCTCTGG - Intergenic
926136901 2:10342884-10342906 CGGGGGAAGGCAGCGGGGAGAGG - Intronic
926330043 2:11816919-11816941 CAGGGCCAGTCAGGGGGTTGGGG - Intronic
927171661 2:20375369-20375391 CAGGGGATGCCGGTGGGGTGCGG + Intergenic
927177306 2:20419705-20419727 CAGGGGATGCCGGTGGGGTGCGG + Intergenic
932238996 2:70142573-70142595 GAGGGGAAACCAGCGGGACGGGG - Intergenic
932340722 2:70961235-70961257 GAGGGGAAGCCAGGGGATTGGGG + Intronic
932593667 2:73081308-73081330 CAGGGGAGGCCAGGGGGGTGGGG + Intronic
935449876 2:103197116-103197138 CTGGGGAAGACAGCTGGATGTGG + Intergenic
935736700 2:106112016-106112038 CAAGGGAGGCCAGAGGGCTGTGG + Intronic
937039183 2:118807854-118807876 CAGGAGAGCCCAGCGGGCTGCGG + Intergenic
937985941 2:127638152-127638174 CAGGGCATGCCAGCGAGGTGGGG - Intergenic
937996801 2:127700545-127700567 CAGGGGAAGCCAAGGTGGTGAGG + Intergenic
938109183 2:128552743-128552765 CAGGGGCAGCCAGCGCCCTGTGG - Intergenic
938943768 2:136192129-136192151 AAGGGGAAGCCTGGGGGTAGGGG + Intergenic
942359318 2:175155364-175155386 CAGGGAAAGCCAGAAGCTTGAGG - Intronic
943539701 2:189197270-189197292 CGGGGCCAGCCAGGGGGTTGGGG + Intergenic
944342980 2:198625155-198625177 CAGGGAATGTCAGGGGGTTGGGG - Intergenic
944661224 2:201923542-201923564 CTGGGGAAGGCAGTGGGATGAGG + Intergenic
944666461 2:201963175-201963197 GAGTGGGAGCCAGCGGGGTGTGG + Intergenic
947852652 2:233300794-233300816 CAGGGTAAGCCCTCGGTTTGTGG + Intergenic
949080008 2:242088944-242088966 CAGGGGAAGACATGGGGTCGCGG + Intergenic
1168904491 20:1392659-1392681 CAGGGGCAGCCTGGGGCTTGCGG - Intronic
1172250289 20:33474736-33474758 CAGGGGATGCCAGAGGGAGGAGG + Intergenic
1172629321 20:36367512-36367534 GAGGGGAAGCCACCTGCTTGGGG + Intronic
1173243358 20:41317337-41317359 CAGGGGCAGCCGGCGGGAGGGGG + Intronic
1173370020 20:42426876-42426898 CAGGGGAAGCCAGCAGGTGATGG + Intronic
1174177616 20:48655069-48655091 CAGTGGAAGACAGTGGGTAGTGG - Intronic
1174849067 20:53974222-53974244 AAGGGGACCCAAGCGGGTTGTGG - Intronic
1175742686 20:61431139-61431161 CAGGGGAAGCACGTGGGTAGAGG + Intronic
1175756687 20:61534800-61534822 CAAGGGAGGCCGTCGGGTTGAGG - Intronic
1175756704 20:61534880-61534902 CAAGGGAGGCCATCGGGTTGAGG - Intronic
1176408949 21:6437383-6437405 CAGGGCAGGCCAGCGGGTAGAGG - Intergenic
1179684442 21:43045705-43045727 CAGGGCAGGCCAGCGGGTAGAGG - Intergenic
1180203682 21:46243706-46243728 CACGGGGAGCCAGGGGGCTGGGG + Exonic
1181310744 22:21943576-21943598 CAGGGGAGGGCAGTGGGTTTTGG - Intronic
1181859422 22:25806521-25806543 CTGGGGAAGGCAGCGGGAGGGGG + Intronic
1181894446 22:26094478-26094500 AAGGGGACCCCAGCAGGTTGAGG + Intergenic
1182370901 22:29810067-29810089 GAGAGGAAGCCAGAGGGCTGTGG - Intronic
1182653953 22:31874708-31874730 CAGGGGAAACTGGCGGCTTGAGG - Intronic
1183952014 22:41357503-41357525 CAGGGCAGGCCAGGGGGGTGGGG + Exonic
1184572798 22:45337176-45337198 ACGGGGAAGCCAGCGGGCTAGGG - Intronic
1184838017 22:47035545-47035567 CAGGGGATGCCTGCAGGATGAGG - Intronic
1184996191 22:48209304-48209326 CAGGGGAAGGAAGCAGGGTGTGG + Intergenic
950127425 3:10518559-10518581 CAGGTGAAGCCAGAGAGCTGAGG - Intronic
950517141 3:13474765-13474787 CAGGAGAAGGCAGCAGGATGAGG + Intergenic
953535420 3:43773594-43773616 CTGGGGAAGCCAGCGTGTGACGG - Intergenic
954315451 3:49798964-49798986 CAGGGGCAGCCGGCAGGGTGGGG - Intronic
954324655 3:49856807-49856829 CAGGGCAAGGCAGCGCATTGTGG + Intergenic
954626112 3:52022828-52022850 CAAGAGAAGCCACTGGGTTGTGG + Intergenic
954630976 3:52047481-52047503 CTGGGGAAGCCCGCGGGTGCTGG - Intergenic
955093258 3:55772856-55772878 CAGGGGCAGGGAGCAGGTTGTGG - Intronic
955325865 3:58009009-58009031 CAGGGGAAGACACCGGGGAGGGG - Intronic
959521542 3:107327630-107327652 CAGGGGAAGGGAGCTGGTTAGGG + Intergenic
961599311 3:128046872-128046894 TTGGGGAAGACAGCGGGTTGGGG - Intergenic
961823034 3:129584971-129584993 CAGGGGTGGGGAGCGGGTTGTGG - Intronic
962210221 3:133471468-133471490 TAGGGGGAGCCAGCAGGTTCAGG + Intronic
963082205 3:141404372-141404394 CAGGGTTACCCAGTGGGTTGGGG + Intronic
963525407 3:146409378-146409400 CAGGGGGAGCGAGCCGGCTGAGG + Intronic
966905555 3:184522403-184522425 CAGCGGAAGCCTGCTGGTGGGGG + Intronic
967279257 3:187806303-187806325 CAGGGGAAGCCAGCTGATGTGGG + Intergenic
967851839 3:194088271-194088293 CAGGGGAGGCCAGCGGCGTGAGG + Intergenic
968375470 4:36793-36815 CAGAGCAAGCCAGCGTGGTGAGG - Intergenic
969582341 4:8072605-8072627 CAGGAGAAGACAAAGGGTTGGGG + Intronic
971394601 4:26216512-26216534 AAGGTGAAGCCAGAGGGGTGGGG + Intronic
976497359 4:85745914-85745936 CAGGGGAAGGCACTGGGTTTTGG - Intronic
977640959 4:99357923-99357945 CAGTGAAAACCAGAGGGTTGAGG + Intergenic
978382471 4:108144063-108144085 TGGGGGAAGCAAGCCGGTTGAGG + Intronic
978754046 4:112284600-112284622 CTGGGGAGGCGAGGGGGTTGGGG - Intronic
984864788 4:184272196-184272218 AGAGGGAAGCCAGAGGGTTGAGG - Intergenic
985525655 5:400146-400168 GAGGGGCAGCCAGGGGGATGTGG + Intronic
986068238 5:4256593-4256615 CAGGGGAACCCAGAGGCTTTTGG - Intergenic
986875120 5:12098041-12098063 CAGAGGAAGACAGGGGGTTGGGG - Intergenic
988868328 5:35360247-35360269 CATGGAAAGCCTGCGGGGTGGGG - Intergenic
990156177 5:52880080-52880102 CAGCAGAAGCTAGCAGGTTGAGG + Intronic
990614198 5:57490421-57490443 CAGGTGAAGCCAGCAGGTAGCGG + Intergenic
991553548 5:67870048-67870070 CAGGGGATGCCTGCTGATTGAGG - Intergenic
992390340 5:76325460-76325482 CAGTAGAAGCCAGCAGGATGGGG - Exonic
997531787 5:134586053-134586075 CAAGGGAAGGCAGGAGGTTGAGG + Intergenic
997781362 5:136661928-136661950 CAGGGTGAACCAGCGGGGTGAGG + Intergenic
997799165 5:136842657-136842679 CAGGAGAAGCCGACGAGTTGAGG + Intergenic
999122305 5:149218801-149218823 CAGGGGCAGACAGAGGGCTGTGG - Intronic
1003618083 6:7673228-7673250 CAGGGGCAGTCAGCAGGGTGGGG - Intergenic
1004412365 6:15392490-15392512 CAGGGGACGACAGAGGGATGAGG + Intronic
1006255538 6:32829504-32829526 GAAGGGAAGCCAGCTGGCTGCGG - Exonic
1006442101 6:34059285-34059307 CAGGTGAGGGCAGCGGGTAGGGG - Intronic
1009865774 6:69395912-69395934 CAGGGCAAGCCAGCAGCTGGAGG - Intergenic
1014749955 6:125244765-125244787 CAGGGGATGCCTGCCGTTTGGGG + Intronic
1015423829 6:133041270-133041292 CAGGGTAGGCCAGGGGGTGGGGG - Intergenic
1016534752 6:145097714-145097736 CAGGGGAAGGGAAGGGGTTGAGG - Intergenic
1016940064 6:149476035-149476057 TAGGGGAAGCAAGTGGGTTTGGG - Intronic
1017553767 6:155541120-155541142 GAGGGGAAGCAAGCGGAATGGGG - Intergenic
1017956299 6:159180625-159180647 CAGGGGAGGACAGGGGGTTGGGG - Intronic
1018637213 6:165873097-165873119 CAGGGGAAGCCAGAATGTTCGGG + Intronic
1019164550 6:170089275-170089297 CAGGGGAAGCCAGCAGCAGGAGG - Intergenic
1021313224 7:19117379-19117401 CGGGGGAAGCTGGCGGGCTGAGG - Exonic
1023861895 7:44221597-44221619 CAGGTGGAGCCAGCCGGATGCGG - Intronic
1024046541 7:45589356-45589378 CAGGAGTGGCCAGCGGGCTGTGG + Intronic
1024878741 7:54059694-54059716 TAGGGGAAGCCATGGGGTTAAGG + Intergenic
1025018836 7:55464704-55464726 CAGGGGATGTCAGAGGGATGTGG + Intronic
1025106248 7:56174392-56174414 CTGGGAAGGCCAGCGTGTTGGGG + Intergenic
1025912387 7:65839215-65839237 CTGGAGAAGCCACCGGGATGCGG - Intergenic
1029505734 7:100963060-100963082 CAGGAGGAGCCTGTGGGTTGGGG + Intronic
1031834667 7:126668439-126668461 CTGGGGGAGACAGGGGGTTGGGG - Intronic
1034227985 7:149497660-149497682 CAGGGGCAGCCAGCGAGGAGCGG - Exonic
1035290448 7:157834689-157834711 GAGGGGAAGCCACGGGGCTGCGG + Intronic
1035354772 7:158270496-158270518 CAGAGGGAGCCAGGGGGTCGGGG - Intronic
1035705319 8:1670409-1670431 CAGGGGAAGCTGGGGGGATGAGG - Intronic
1036985653 8:13526760-13526782 CAGGGCCTGCCAGGGGGTTGGGG + Intergenic
1037577175 8:20218420-20218442 GAGGAGAAGCCAGAGGGTTAAGG - Intronic
1037695643 8:21221679-21221701 AGGGGGAAGCCAGCAAGTTGAGG - Intergenic
1037916339 8:22775518-22775540 TGGGGGAAGCCAGCTGGCTGTGG + Intronic
1038132381 8:24747224-24747246 CAAGGGCAGCCAGCAGGTGGTGG + Intergenic
1038291208 8:26251410-26251432 CAGGGGCAGCTAGCAGTTTGTGG + Intergenic
1038524716 8:28263017-28263039 AAGGGGAAGCCAACAGGTGGAGG + Intergenic
1039834795 8:41247889-41247911 CAGGGGAAGCCGCAGGGTTGGGG - Intergenic
1047113026 8:121811975-121811997 CAGGGGAAGCCAACAGAATGAGG - Intergenic
1049071406 8:140358599-140358621 CAGGGGAAAGCAGTGGGTGGAGG + Intronic
1049373267 8:142277714-142277736 CAGGGGAGCCCAGCGGCCTGGGG + Intronic
1051102676 9:13539710-13539732 CAGGGACTGTCAGCGGGTTGAGG - Intergenic
1051604364 9:18906024-18906046 CTGGGGAGGCCAGTGGCTTGCGG - Intronic
1052473302 9:28926886-28926908 CAGTGGAAGCCTGAGGGATGAGG - Intergenic
1054812211 9:69443989-69444011 GTGGGGAAGCCAGGGGGTGGGGG - Intronic
1056581597 9:87890761-87890783 AAGGGTCTGCCAGCGGGTTGGGG - Intergenic
1057048378 9:91903311-91903333 CAGGGGAAGCCAGCGGGTTGGGG - Intronic
1057261332 9:93586474-93586496 CAGGAGAAGCCAGCTGGGGGAGG + Intronic
1057275778 9:93675376-93675398 CTGGGGCAGCCAGTGGGGTGAGG + Intronic
1057437273 9:95053237-95053259 GAGGGGAAGCCAGAGAGTTCAGG + Intronic
1059026634 9:110641081-110641103 CAGGGTAAGTGAGTGGGTTGGGG - Intergenic
1060481256 9:124017894-124017916 GAGGGGCTGCCAGCGGGCTGGGG + Intronic
1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG + Exonic
1061802956 9:133121984-133122006 GAGGGGAAGCCAGGGAGGTGGGG + Intronic
1062289874 9:135789675-135789697 CAGGGTTAGGAAGCGGGTTGGGG + Intronic
1062726310 9:138076020-138076042 GAGGGGAAGCCAGTGGGGTCGGG - Intronic
1203573756 Un_KI270744v1:157351-157373 CAGAGCAAGCCAGCGTGGTGAGG + Intergenic
1187141853 X:16601559-16601581 CAAGGGAAGCCATCGGGGGGGGG + Intronic
1187490646 X:19748243-19748265 CAGAGAAAGTCAGTGGGTTGAGG + Intronic
1188009816 X:25043672-25043694 CAGGGGCAGCCAAGGGGCTGGGG + Intergenic