ID: 1057049653

View in Genome Browser
Species Human (GRCh38)
Location 9:91914110-91914132
Sequence CAGCAAGCACACGGGGGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 169}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057049653_1057049660 -3 Left 1057049653 9:91914110-91914132 CCAATGCCCCCGTGTGCTTGCTG 0: 1
1: 0
2: 0
3: 9
4: 169
Right 1057049660 9:91914130-91914152 CTGGGCCACGCTCCACTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057049653 Original CRISPR CAGCAAGCACACGGGGGCAT TGG (reversed) Intronic
900284709 1:1893553-1893575 CACCAGGCACACGGGGTCATCGG + Intergenic
900345721 1:2209444-2209466 CAGCAAGCACACGGACACAGCGG - Intronic
900548507 1:3241882-3241904 CAGCAGGCCCAGGGTGGCATCGG + Intronic
901057713 1:6456427-6456449 CAGCAAGGCCACGGGGCCAGAGG - Intronic
901817585 1:11803620-11803642 CAGCCAGCACAAGGGGGCGGGGG + Intronic
901907717 1:12428685-12428707 ATGGAAGCACACGGGGCCATGGG - Intronic
902476640 1:16692025-16692047 CAGCAAGACCACGGGGCCAGAGG + Intergenic
902756884 1:18554827-18554849 CAGGAAGCACCCGTGGGGATTGG - Intergenic
902881514 1:19374745-19374767 AAGCCAGCAGACGGGAGCATTGG + Intronic
902965228 1:19996109-19996131 CAGGAAGCACAAGGGGTCAGGGG + Intergenic
903047314 1:20574589-20574611 CTGCAGGCACAGTGGGGCATGGG + Intergenic
903179500 1:21598111-21598133 CACCAGGGAGACGGGGGCATAGG + Intronic
903671517 1:25038560-25038582 CACCTAGCACACAGGTGCATAGG - Intergenic
904335593 1:29795559-29795581 CTAGAAGCAAACGGGGGCATTGG - Intergenic
905314631 1:37074097-37074119 GAGCAAGCGCACGGAGGCAGGGG + Intergenic
910801928 1:91155703-91155725 CCAGCAGCACACGGGGGCATAGG + Intergenic
911079727 1:93916581-93916603 CAGGAAGCACAAGGGGTCAGTGG - Intergenic
912463185 1:109851244-109851266 CAGGAAGCACAAGGGGTCAGAGG + Intergenic
912869492 1:113291093-113291115 CTGCATGCACAGGGGGGTATGGG - Intergenic
913473615 1:119215347-119215369 CAGGAAGCACAAGGGGTCAGGGG - Intergenic
916379631 1:164195484-164195506 CAGGAAGCACAAGGGGTCAGGGG + Intergenic
917122411 1:171656022-171656044 CTGCAAGCACCCGGGGTCCTGGG - Intergenic
920377220 1:205515588-205515610 CAGCAAGGAAACTGAGGCATGGG + Intronic
921524760 1:216202882-216202904 AAGGAAGCACACGGTGGCTTGGG - Intronic
922710087 1:227822081-227822103 GAGCAAGCACAAGAGAGCATAGG - Intronic
923194489 1:231652024-231652046 CAGGAAGCACAAGGGGTCAGGGG - Intronic
1067704621 10:48597698-48597720 CAGCAAGCACCTGGGGTCCTGGG - Intronic
1068239614 10:54288571-54288593 CAGGAAGCACAAGGGGTCAAGGG + Intronic
1069724142 10:70566708-70566730 CAGCAAGTCCTCGGGGGCAGAGG - Exonic
1073132312 10:101197490-101197512 CAGGAAGCACACTGGGGCTCAGG - Intergenic
1074017109 10:109545520-109545542 CAGGAAGCACAAGGGGTCAGGGG + Intergenic
1074290839 10:112137084-112137106 CAGCATGCACACAGGTGCAGTGG + Intergenic
1076582014 10:131518056-131518078 TAGCAAGCGCATGGGGGCAGGGG + Intergenic
1076644650 10:131944609-131944631 CAGCCAGCAGCCGGGAGCATGGG + Intronic
1077411330 11:2405249-2405271 CAGCAAGCAAACGGGCCCCTCGG - Intronic
1082802939 11:57427445-57427467 CAGACAGCACATGAGGGCATAGG + Intronic
1083606455 11:63981758-63981780 CAGCAAGAACATGGGGACCTTGG + Intronic
1083656179 11:64230768-64230790 CTTCAAGCACCCGGGGGCAGAGG - Exonic
1084949120 11:72654967-72654989 CAGCAGGCACACAGGTGCCTGGG + Intronic
1086323878 11:85678844-85678866 CAGTAAGCAAAAGGGTGCATTGG - Intronic
1086732969 11:90271489-90271511 CAGGAAGCACAAGGGGTCAGGGG - Intergenic
1087484827 11:98748065-98748087 CAGGAAGCACAAGGGGTCAGGGG + Intergenic
1090297894 11:125606011-125606033 CAGCAACCACAAGGGAGCAGGGG + Intronic
1091875738 12:3931553-3931575 CAGCAAGCAGAAAGGGGCCTGGG - Intergenic
1094311795 12:29092555-29092577 CAGGAAGCACAAGGGGTCAGGGG + Intergenic
1095793828 12:46195887-46195909 CAGGAAGCACAAGGGGTCAGGGG - Exonic
1097070190 12:56349012-56349034 CAGCAAGCTCCAGGGGGCCTTGG + Exonic
1097912194 12:64982296-64982318 CAGGAAGCACAAGGGGTCAGGGG - Intergenic
1098293898 12:68984792-68984814 CAGCAAGCTTATGGGGGCCTAGG - Intergenic
1098683880 12:73395168-73395190 CAGCAAGACCCCGTGGGCATAGG - Intergenic
1102062834 12:109947068-109947090 CCACAAGCACACAGGGCCATGGG - Intronic
1104476511 12:129074729-129074751 CAGCAGACACACAGGGGCAGGGG - Exonic
1105789048 13:23779671-23779693 CAGGAAGCACAAGGGGTCAGGGG + Intronic
1107314268 13:39114192-39114214 CAACAAGAACACGTGGGCACAGG - Intergenic
1108752744 13:53464904-53464926 AAGCAAGCACACAGGGCAATGGG + Intergenic
1108988731 13:56628883-56628905 CAGGAAGCACAAGGGGTCAGAGG + Intergenic
1109358553 13:61266848-61266870 CAGGAAGCACAAGGGGTCAGGGG + Intergenic
1110642456 13:77841397-77841419 CAGTGAGAACACGTGGGCATAGG + Intergenic
1113762284 13:112857899-112857921 CTGGAAGCGCACGTGGGCATAGG + Exonic
1113950599 13:114069412-114069434 GAGGAAGCACACGGGGGGCTGGG + Intronic
1114603754 14:23978606-23978628 CAGGAAGCACAAGGGGTCAGAGG + Intronic
1114608766 14:24021380-24021402 CAGGAAGCACAAGGGGTCAGAGG + Intergenic
1119877692 14:78074730-78074752 CACCAAGCACACTGGGCCACAGG - Intergenic
1121019611 14:90571449-90571471 CAACAAGCACATGGACGCATTGG + Intronic
1124687941 15:31798377-31798399 CAGCAAGCATGAGGGGGCATCGG - Intronic
1127339517 15:58026576-58026598 CAGGAAGCACAAGGGGTCAGGGG + Intronic
1129411354 15:75352233-75352255 CAGCAAGCAGGCATGGGCATGGG + Intronic
1130997104 15:88910050-88910072 CATCCAGCACACGGGGGAAGAGG - Intronic
1131460703 15:92615674-92615696 CAGCAGGCACTGGGGGGCACAGG + Intergenic
1132206948 15:99992878-99992900 GAGGAAGCACACGGGGTCTTGGG + Intronic
1132287970 15:100679493-100679515 CAGGAAGCACAAGGGGTCAGGGG - Intergenic
1133453598 16:5923424-5923446 CAGCAAGGACAGGGGCACATGGG + Intergenic
1139546889 16:67653661-67653683 CTGCAAGCCCGCGGGGGCAGCGG + Intronic
1146616815 17:34363126-34363148 CAGCAAGCACACCAGGGCTGTGG + Exonic
1152205823 17:78973955-78973977 CGGGGAGCACACGGGGCCATGGG - Intronic
1152550108 17:81025273-81025295 CAGCTAGGACACGGCGTCATTGG - Intergenic
1152746540 17:82042759-82042781 CAGCATGCACATGGGGACACAGG + Intergenic
1152746544 17:82042807-82042829 CAGCATGCACACGGGGACACAGG + Intergenic
1153479859 18:5536318-5536340 CAGCAAGCAGAAGGAGGCAGAGG + Intronic
1155006613 18:21735249-21735271 CAGGAAGCACAAGGGGTCAGTGG + Intronic
1156881765 18:42088473-42088495 CAGCAAGCACCCGGGGCCTCAGG - Intergenic
1157025286 18:43835677-43835699 CAGGAAGCACAAGGGGTCAGGGG + Intergenic
1158543916 18:58379617-58379639 CAGCAAGGACTCTGGGGCATCGG + Intronic
1160685956 19:436693-436715 CAGGAGGCACACGCGGTCATGGG + Intronic
1161038579 19:2098356-2098378 CAGCAAGCTCACCTGGGCCTGGG + Intronic
1164152417 19:22566411-22566433 CAGGAAGCACAAGGGGTCAGGGG - Intergenic
1165602380 19:37065553-37065575 CAGCAAGCAAATGGAGACATTGG + Intronic
1166961510 19:46499151-46499173 CAGCAGCCACACAGGGCCATTGG + Intronic
1167062925 19:47162051-47162073 CAGTAAGCACATGTGGCCATTGG + Intronic
1167333189 19:48868834-48868856 CAGCAAACCCACGGGGGCCCTGG - Intergenic
1202710661 1_KI270714v1_random:17866-17888 CAGCAAGACCACGGGGCCAGAGG + Intergenic
925463170 2:4082710-4082732 CAGAAAGCACATGGGGGTGTGGG - Intergenic
925599222 2:5590896-5590918 CAGCAGGCACACATGGGCAGTGG + Intergenic
926234633 2:11029995-11030017 CGGGAGGCAGACGGGGGCATGGG - Intergenic
928900812 2:36315809-36315831 CAGGAAGCACAAGGGGTCAGGGG - Intergenic
930274789 2:49298651-49298673 CAGGAAGCACAAGGGGTCAAGGG + Intergenic
931306527 2:61034515-61034537 CAGGAAGCACAAGGGGTCAGGGG + Intronic
934686399 2:96325193-96325215 CAGCAAACCCACGGGGGCCTCGG + Intergenic
935837378 2:107069673-107069695 GAGCAAGGACACGGGGACTTTGG + Intergenic
937094764 2:119228329-119228351 CAGCAAGCCCACTGTGGCAATGG - Intronic
940437286 2:153669728-153669750 CAGGAAGCACAAGGGGACAGGGG + Intergenic
943292742 2:186095579-186095601 CTGAAACCACACGGGAGCATGGG - Intergenic
946213404 2:218165056-218165078 CAGCAGGAACACTAGGGCATAGG + Exonic
947748507 2:232521444-232521466 CAGCAAGCTCACTGGGGCACGGG - Intronic
947864676 2:233388080-233388102 CAGCACGCTGCCGGGGGCATGGG - Intronic
1169508589 20:6240067-6240089 CAGGAAGCACAAGGGAGCAGTGG - Intergenic
1169795801 20:9461465-9461487 CAGGAAGCACAAGGGGTCAGGGG + Intronic
1170399177 20:15961182-15961204 AAGTAAGCACATGGGGGAATGGG + Intronic
1173647811 20:44644464-44644486 CAGAACCCACACGGGGGCAGAGG + Intronic
1184369598 22:44074196-44074218 CAGCAGAGAGACGGGGGCATGGG + Intronic
950299907 3:11867932-11867954 CAGGAAGCACAAGGGGGCGGAGG - Intergenic
952890936 3:38040194-38040216 CAGGAAGCACACCGGGGTAAAGG - Intronic
953502116 3:43446929-43446951 CAGGAGGCACAGTGGGGCATTGG - Intronic
964746694 3:160019287-160019309 CCGCAAGCACATGGGAGAATGGG + Intronic
966088846 3:176105458-176105480 CAGCAATAACAGTGGGGCATCGG + Intergenic
966910935 3:184559638-184559660 CAGCCAGCACTCCGGGGCATGGG + Intronic
967813055 3:193776403-193776425 CAGCAGGCACACTGAGGGATGGG + Intergenic
969619159 4:8270255-8270277 CAGCGCGCACACGTTGGCATAGG - Exonic
973732220 4:53833531-53833553 CAGGAAGCACAAGGGGTCAGGGG + Intronic
974871725 4:67652733-67652755 CAGGAAGCACAAGGGGTCAGGGG + Intronic
979315416 4:119255684-119255706 CAGGAAGCACAAGGGGTCAGGGG - Intronic
980557645 4:134430501-134430523 CAGCAACCACACGGGGTCACTGG + Intergenic
981097201 4:140793695-140793717 CAGCAAGGAAGCGGGGGCAGGGG + Intergenic
985723944 5:1505966-1505988 GAGCAGGCACAAGGGTGCATGGG - Intronic
989139481 5:38189033-38189055 CAGCTAGCACAGGGGGGTCTGGG + Intergenic
990134808 5:52632246-52632268 CAGCAAGGAAACGGGGACCTTGG - Intergenic
990239163 5:53799556-53799578 CTGGAAGCACAAGGGGTCATGGG + Intergenic
990721386 5:58699899-58699921 CAGGAAGCACACGGGGTCAGGGG - Intronic
997470890 5:134116051-134116073 CTGCAAGCACAGGGCGGCACTGG - Intronic
1002195046 5:177496979-177497001 GAGGGAGCACACGGGGGCTTGGG + Intronic
1002419874 5:179139857-179139879 CAGCAAGGCCAGGGGGACATGGG + Intronic
1004056030 6:12139544-12139566 CAGGAAGCACAAGGGGTCAGGGG + Intronic
1004812953 6:19279459-19279481 CAACTTGCACACAGGGGCATTGG + Intergenic
1007710979 6:43824142-43824164 CAGCAGGCACACACAGGCATGGG - Intergenic
1007838532 6:44696812-44696834 CATCCAGCACAGGGAGGCATGGG + Intergenic
1010282267 6:74035630-74035652 CAGGAAGGACAAGGGGTCATGGG - Intergenic
1010729053 6:79368654-79368676 CAGCAAGCCTCCGTGGGCATGGG + Intergenic
1013376959 6:109526794-109526816 CAGCAAGCAAAAGTGTGCATGGG - Intronic
1016523906 6:144977667-144977689 CAGGAAGCACAAGGGGTCAGGGG - Intergenic
1016628407 6:146199371-146199393 CAGCAAGAACACTGGGGGACAGG - Intronic
1018689707 6:166334737-166334759 CACCAAGCACTCTGGGGCTTTGG + Intronic
1019406337 7:886068-886090 GAGCAAGCACACGGAGGCCCGGG + Exonic
1023509417 7:40934871-40934893 CAGGAAGCACAAGGGGTCAGGGG - Intergenic
1024231510 7:47367285-47367307 CAGCAGGCAGAGAGGGGCATTGG - Intronic
1027149606 7:75723561-75723583 CAGCAAGGAGACGGGGACCTCGG - Intronic
1030181040 7:106709587-106709609 CAGGAAGCACAAGGGGTCAGGGG + Intergenic
1032429002 7:131845721-131845743 ACGCATGCACACGGGGCCATGGG - Intergenic
1035370731 7:158377279-158377301 CATCAAGCACGCGGGGTCAGGGG + Intronic
1035824625 8:2631313-2631335 TAGCATGCACACTGGGGCTTTGG - Intergenic
1035824638 8:2631394-2631416 TAGCATGCACACTGGGGCTTTGG - Intergenic
1042645311 8:70980196-70980218 CAGGAAGCACAAGGGGTCAGGGG - Intergenic
1045071190 8:98506334-98506356 CAGGAAGCACAAGGGGTCAGGGG - Intronic
1048284400 8:133130563-133130585 CAGCAGGAAAACGGGGGCCTGGG + Intronic
1049376314 8:142290991-142291013 CAGCAGGCTCACCGGGGCACTGG - Intronic
1050386970 9:5101089-5101111 CAGGAAGCACAAGGGGTCAGGGG + Intronic
1050678713 9:8085415-8085437 CAGGAAGCACAAGGGGTCAGGGG - Intergenic
1050700227 9:8330134-8330156 CAGGAAGCACAAGGGGTCAGGGG - Intronic
1053473900 9:38367739-38367761 GAGCAAGAACACGGAGGCCTGGG + Intergenic
1055918487 9:81432653-81432675 CAGCAAGACCCCGTGGGCATAGG - Intergenic
1056417398 9:86390147-86390169 CAGGAAGCACAAGGGGTCAGGGG + Intergenic
1057049653 9:91914110-91914132 CAGCAAGCACACGGGGGCATTGG - Intronic
1058081992 9:100710376-100710398 CAGGAAGCACAAGGGGCCAAGGG - Intergenic
1058866787 9:109167908-109167930 CAGCAAGCACGCGCAGGCCTTGG + Intergenic
1061895719 9:133646351-133646373 CACCATGCATCCGGGGGCATGGG + Intronic
1203448918 Un_GL000219v1:91879-91901 CAGCCATGACACGGGTGCATCGG - Intergenic
1186523080 X:10222767-10222789 TAGCAAGCACACAGGGGGACAGG + Intronic
1191002402 X:55674314-55674336 CAGGAAGCACAAGGGGTCAAGGG - Intergenic
1192371881 X:70521071-70521093 CAGGAAGCACAAGGGGTCAGGGG - Intergenic
1192637227 X:72831209-72831231 CAGGAAGCACAAGGGGTCAGGGG - Intronic
1192644487 X:72889605-72889627 CAGGAAGCACAAGGGGTCAGGGG + Intronic
1194098520 X:89673999-89674021 CAGGAAGCACAAGGGGTCAGGGG + Intergenic
1194272226 X:91830479-91830501 CAGCAAGCAGAGGCGGGCAAGGG - Intronic
1194828399 X:98591680-98591702 CAGCAAGCTTATGGGGGCCTAGG + Intergenic
1198293725 X:135263751-135263773 CAGGAAGCACAAGGGGTCAGGGG - Intronic
1200060443 X:153481472-153481494 CAGGAAGCACACATGGGCACAGG + Intronic
1200231534 X:154446203-154446225 CAGCAAGCACAGAGGGCCACAGG - Intronic
1200451542 Y:3335374-3335396 CAGGAAGCACAAGGGGTCAGGGG + Intergenic
1200589472 Y:5051901-5051923 CAGCAAGCAGAGGCGGGCAAGGG - Intronic
1202040191 Y:20674701-20674723 CAGGAAGCACAAGGGGTCAGTGG + Intergenic