ID: 1057054047

View in Genome Browser
Species Human (GRCh38)
Location 9:91948570-91948592
Sequence AAGGCTGCACAGTCTTTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 246}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057054047_1057054052 1 Left 1057054047 9:91948570-91948592 CCCAGGAAAGACTGTGCAGCCTT 0: 1
1: 0
2: 4
3: 26
4: 246
Right 1057054052 9:91948594-91948616 CTGACTCGCGTACCTTGGGCCGG 0: 1
1: 0
2: 0
3: 1
4: 54
1057054047_1057054060 27 Left 1057054047 9:91948570-91948592 CCCAGGAAAGACTGTGCAGCCTT 0: 1
1: 0
2: 4
3: 26
4: 246
Right 1057054060 9:91948620-91948642 GGGCGGCAGGCCAGGATACCTGG 0: 1
1: 0
2: 0
3: 16
4: 178
1057054047_1057054057 14 Left 1057054047 9:91948570-91948592 CCCAGGAAAGACTGTGCAGCCTT 0: 1
1: 0
2: 4
3: 26
4: 246
Right 1057054057 9:91948607-91948629 CTTGGGCCGGCTAGGGCGGCAGG 0: 1
1: 0
2: 1
3: 10
4: 180
1057054047_1057054051 -3 Left 1057054047 9:91948570-91948592 CCCAGGAAAGACTGTGCAGCCTT 0: 1
1: 0
2: 4
3: 26
4: 246
Right 1057054051 9:91948590-91948612 CTTTCTGACTCGCGTACCTTGGG 0: 1
1: 0
2: 0
3: 2
4: 34
1057054047_1057054053 6 Left 1057054047 9:91948570-91948592 CCCAGGAAAGACTGTGCAGCCTT 0: 1
1: 0
2: 4
3: 26
4: 246
Right 1057054053 9:91948599-91948621 TCGCGTACCTTGGGCCGGCTAGG 0: 1
1: 0
2: 0
3: 0
4: 12
1057054047_1057054055 10 Left 1057054047 9:91948570-91948592 CCCAGGAAAGACTGTGCAGCCTT 0: 1
1: 0
2: 4
3: 26
4: 246
Right 1057054055 9:91948603-91948625 GTACCTTGGGCCGGCTAGGGCGG 0: 1
1: 0
2: 0
3: 4
4: 77
1057054047_1057054050 -4 Left 1057054047 9:91948570-91948592 CCCAGGAAAGACTGTGCAGCCTT 0: 1
1: 0
2: 4
3: 26
4: 246
Right 1057054050 9:91948589-91948611 CCTTTCTGACTCGCGTACCTTGG 0: 1
1: 0
2: 0
3: 2
4: 50
1057054047_1057054058 19 Left 1057054047 9:91948570-91948592 CCCAGGAAAGACTGTGCAGCCTT 0: 1
1: 0
2: 4
3: 26
4: 246
Right 1057054058 9:91948612-91948634 GCCGGCTAGGGCGGCAGGCCAGG 0: 1
1: 0
2: 0
3: 28
4: 1625
1057054047_1057054054 7 Left 1057054047 9:91948570-91948592 CCCAGGAAAGACTGTGCAGCCTT 0: 1
1: 0
2: 4
3: 26
4: 246
Right 1057054054 9:91948600-91948622 CGCGTACCTTGGGCCGGCTAGGG 0: 1
1: 0
2: 0
3: 0
4: 13

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057054047 Original CRISPR AAGGCTGCACAGTCTTTCCT GGG (reversed) Intronic
901755352 1:11438325-11438347 AAGGCTGTACTTTCTTTCCAGGG - Intergenic
904273523 1:29365860-29365882 AGGGCTGCAGGGACTTTCCTAGG - Intergenic
904646613 1:31972266-31972288 AAGGCTGCACTATGTTGCCTAGG - Intergenic
905593836 1:39188509-39188531 GAGACTGGCCAGTCTTTCCTGGG - Intronic
906124913 1:43421870-43421892 AGGGCTACACAGTCTGTCCCTGG + Intronic
907554148 1:55330263-55330285 AATGCTGAACCATCTTTCCTAGG - Intergenic
908603019 1:65762030-65762052 AAAGATGCCCAGTCTATCCTAGG + Intergenic
909252631 1:73378533-73378555 AAGGCTGCACACATTTTACTTGG - Intergenic
910054701 1:83018786-83018808 TAGGCTGCACTGTATTTACTAGG + Intergenic
910173299 1:84400968-84400990 AAAGCTGCACACTCTTCACTTGG - Intronic
910451335 1:87349048-87349070 AGGGCAGGACAGCCTTTCCTAGG + Intergenic
911364230 1:96917246-96917268 AAGGCTGAACAGTATTCCATTGG - Intergenic
912226288 1:107738005-107738027 ATGGCTGCACAGTTATTCCATGG - Intronic
912707980 1:111929013-111929035 AAACCTGAACAGTTTTTCCTGGG + Intronic
912739997 1:112185873-112185895 AAGGGTGCACAGGCTTTGCCAGG + Intergenic
912763490 1:112388604-112388626 ATGGCTGCACCGTCATTTCTAGG - Intergenic
914455808 1:147835266-147835288 TCGGCTGCCCAGTCTTTCTTGGG - Intergenic
920143584 1:203839234-203839256 AAGGTTTCACAGTGTTGCCTAGG + Intronic
920500965 1:206485237-206485259 CAGGCTGCTCAGGCTCTCCTGGG - Exonic
921072649 1:211675251-211675273 AAGACTAAACCGTCTTTCCTGGG - Intronic
922146277 1:222948449-222948471 AAGTCTGCACAGGATGTCCTTGG + Intronic
923493879 1:234508000-234508022 AAGGAGGCAAAGTCTTGCCTGGG + Intergenic
923517722 1:234711516-234711538 AAGGCTGAAGAATCTTTCCTTGG + Intergenic
923558833 1:235023029-235023051 AAGGCTACACAGCCTTGCCTGGG + Intergenic
923867351 1:237954119-237954141 AAGGCTGTACAGTCTTTCCAGGG + Intergenic
1064216940 10:13408466-13408488 AAGGCTGCCCAGTGGTTCCTTGG + Intergenic
1064365566 10:14704523-14704545 AAGGCTGCCCAGTCTTGGCTGGG - Intronic
1064912315 10:20416156-20416178 AAGGCTTTACAGTCTTACCATGG - Intergenic
1065385945 10:25133383-25133405 AAGGAGGCCCACTCTTTCCTTGG - Intergenic
1067443166 10:46323818-46323840 AAGCCTGGACTGTCTTTCCGAGG + Intronic
1067809571 10:49416910-49416932 AGAGCTGCACAGACTTTGCTAGG - Intergenic
1068289728 10:54987207-54987229 AAGGCTGCATAGTATTCCATGGG + Intronic
1068728600 10:60330915-60330937 ATGGCTGCACAGTATTCCATGGG - Intronic
1069952193 10:72026767-72026789 CAGGGTCCACAGTCTTGCCTTGG - Intergenic
1070991753 10:80739393-80739415 AAGGCGACAAAGTATTTCCTTGG + Intergenic
1071598399 10:86944012-86944034 AAGCCTGCACAGCCTTACCCAGG - Exonic
1073172983 10:101528314-101528336 AAGGCTCCACAGTTTTGCTTGGG + Intronic
1074293804 10:112163063-112163085 AAGGCAGCACAGTGGTTCTTTGG - Intronic
1074447796 10:113534514-113534536 AAAGCTGCAGAGTCTTTCTCTGG + Intergenic
1074579596 10:114706267-114706289 AATGCTACAAAGTCTGTCCTAGG - Intergenic
1076177986 10:128383276-128383298 AAGGGTGAACAGTCCTTCCCTGG + Intergenic
1076242693 10:128921653-128921675 AATGCTGCCCAGTCCTGCCTGGG - Intergenic
1076833640 10:133009240-133009262 GAGGCAGCACCATCTTTCCTAGG + Intergenic
1077515683 11:3000664-3000686 AAGGCCGCTCAGTCTGCCCTCGG - Intergenic
1078409483 11:11100905-11100927 ATGTCTACACAGTCTTTCCAGGG - Intergenic
1081390222 11:42520435-42520457 AAGGCTGCATAGTATTCCATGGG - Intergenic
1081667677 11:44926120-44926142 AAGGCTGGGCTGTGTTTCCTTGG + Intronic
1082111722 11:48284074-48284096 ATGGCTGCATAGTATTTGCTGGG + Intergenic
1082729665 11:56779885-56779907 AAGGCTACAGAATGTTTCCTGGG - Intergenic
1084267115 11:68010727-68010749 AGGGGCGCACAGTCCTTCCTGGG - Intronic
1084757170 11:71246935-71246957 AAAGCTGTACAGTCATTGCTGGG - Intronic
1086986924 11:93261140-93261162 AAAGCGGCAAAGTATTTCCTTGG + Intergenic
1090844060 11:130516482-130516504 GAGGCTGCACTTCCTTTCCTTGG + Intergenic
1091407697 12:219668-219690 AAGGGTGCACAGGCTTCCCTGGG - Intergenic
1091605207 12:1945682-1945704 ATGGCTGCATAGTATTCCCTGGG - Intergenic
1093517471 12:20006009-20006031 AAGGCTGAAGAGGCTTTCCAAGG + Intergenic
1094622193 12:32090512-32090534 AACTCTGAACTGTCTTTCCTAGG - Intergenic
1095988203 12:48014845-48014867 ATAGCTGCTCTGTCTTTCCTTGG - Intergenic
1097682062 12:62658266-62658288 AAGCCTGCACAGTTTTGCCTGGG + Intronic
1098134984 12:67392509-67392531 AAGGCTTTACTGCCTTTCCTTGG + Intergenic
1098591292 12:72216190-72216212 AAATCTACCCAGTCTTTCCTTGG - Intronic
1101684064 12:106999671-106999693 AAGGCCGGACAGGCTTTCCATGG - Exonic
1102738433 12:115184107-115184129 AAGGCTGAATAGTATTTCATTGG - Intergenic
1103852609 12:123943156-123943178 AAAGCTGCAAAGCCTTTTCTTGG - Intronic
1104389724 12:128381575-128381597 AAGCCTGCTCAGTCCTTCCTAGG + Intronic
1104733311 12:131121016-131121038 AAGGATGCAGCGTCGTTCCTCGG + Intronic
1107552237 13:41487840-41487862 AAGGCTGCAGATTCTCTTCTGGG + Intergenic
1109102012 13:58197682-58197704 AAGGCTGCATTCTCATTCCTCGG + Intergenic
1109258216 13:60110105-60110127 AAGTCAGCACAGTCTTTCAAAGG + Intronic
1109301152 13:60591403-60591425 CAGACTGCACAGGCTTTTCTTGG + Intergenic
1111194135 13:84850441-84850463 AAGGCTGCACAGACATGGCTGGG - Intergenic
1111341175 13:86888465-86888487 AAAGCTGGAAAATCTTTCCTAGG - Intergenic
1116050882 14:39801700-39801722 GAGGCTGCACTGCCTTTCCTCGG + Intergenic
1117150131 14:52878269-52878291 AAAGCTCCTCAGTTTTTCCTTGG - Intronic
1118601305 14:67472917-67472939 CTGGCTGCCCAGTCTCTCCTCGG + Exonic
1118756850 14:68851104-68851126 AAGGCTGCTCAGCCTTTCTGAGG - Intergenic
1121438938 14:93936725-93936747 GAGGCTGCACAGTCCCACCTGGG + Intronic
1122119260 14:99543140-99543162 GCGGCTGAACAGTCTTTCTTTGG + Intronic
1122153547 14:99737480-99737502 ATGCCTGTACACTCTTTCCTTGG - Intergenic
1122717945 14:103706636-103706658 AGGGCAGCACAGCCTTTCCCCGG - Intronic
1124214113 15:27792493-27792515 CAGTCTGCACAGTCCTTCCTGGG + Intronic
1124560500 15:30769661-30769683 CAGGCTGCACAGTTTTTGCAGGG - Intronic
1124611532 15:31212992-31213014 AATGATGCACAGCCTATCCTGGG - Intergenic
1124850259 15:33330075-33330097 CAGACTGGACAGTTTTTCCTTGG + Intronic
1125643494 15:41251219-41251241 GAGGCTGGATAGTCTTCCCTTGG - Intronic
1125998839 15:44190056-44190078 AAAGCAGCACTGTCCTTCCTGGG + Intronic
1129655876 15:77525545-77525567 AAGCCTGCTGATTCTTTCCTCGG - Intergenic
1131072007 15:89471836-89471858 CAGGCTCCACAGACTGTCCTGGG - Exonic
1131957126 15:97748545-97748567 AAGGTGGCCCAGTCTTTCCCAGG - Intergenic
1133450013 16:5896150-5896172 CATGCTCCACAGCCTTTCCTGGG - Intergenic
1134774325 16:16838713-16838735 AAGGCTGGACGGGCTTCCCTAGG + Intergenic
1136033847 16:27523648-27523670 AAGGCTGTACAGTGTCTGCTTGG - Intronic
1139800387 16:69518084-69518106 ATGGCTGCATAGTATTTCCATGG - Intergenic
1139968825 16:70761221-70761243 GAGGCTCCTCAGTCTTCCCTGGG - Intronic
1140646150 16:77032313-77032335 AAAGTTTCACAGTGTTTCCTAGG + Intergenic
1140947632 16:79784732-79784754 ATGGCTGCATAGTATTTCATGGG - Intergenic
1142535187 17:610437-610459 AAGGCTACAGAGACTTACCTAGG - Intronic
1144458622 17:15439476-15439498 AAGGGTGAACAGTCTGTGCTTGG - Intronic
1144783952 17:17821684-17821706 CAGGCTGCACAGTTGGTCCTTGG - Intronic
1147476291 17:40714742-40714764 CTGGCTGCACAGACTTCCCTTGG + Intergenic
1147718234 17:42522170-42522192 AGGGCTGCACAGTCCTGCCAAGG + Exonic
1147782696 17:42955095-42955117 AAGTCTGCAGAGCCTATCCTAGG + Intronic
1147812128 17:43179420-43179442 AAGGCTGAACAGACTCTCTTAGG - Intronic
1148638295 17:49165853-49165875 AAGGCTAGAAAGTCATTCCTTGG - Intronic
1149522861 17:57331272-57331294 AAGACTGGACAGTGTGTCCTGGG - Intronic
1152379840 17:79936727-79936749 CAGGCTGCACGGCCGTTCCTGGG - Exonic
1152482361 17:80563115-80563137 AAGGCTGCACAGTGGTTCTCTGG - Intronic
1153760640 18:8328220-8328242 AATGCTGCACTCACTTTCCTGGG + Intronic
1155661209 18:28250300-28250322 AAGGCTACACAGTTTCTCTTGGG + Intergenic
1155814387 18:30286943-30286965 ATGGCTGAACAGTATTTCCATGG - Intergenic
1158104062 18:53864411-53864433 TGGGCTGGACAGTGTTTCCTTGG + Intergenic
1158734476 18:60063879-60063901 AAGGCTGCACAATCCAGCCTGGG - Intergenic
1161222960 19:3126463-3126485 ACGGCTGGCCAGTCCTTCCTAGG + Intergenic
1162302298 19:9850734-9850756 AACGATGCACAGCCTTCCCTGGG - Intergenic
1163075551 19:14887678-14887700 ATGGCTGCATAGTATTTCATGGG + Intergenic
1164770195 19:30802310-30802332 AAGGATGCACAGTGCTCCCTTGG - Intergenic
1164947821 19:32311152-32311174 GAGGCAGCACTGTCTTTCCTGGG + Intergenic
1165144864 19:33724585-33724607 AAGCCTGGACAGTATTGCCTGGG + Intronic
925045943 2:773328-773350 AAGGCTGCACACAGTCTCCTCGG - Intergenic
926753938 2:16221194-16221216 AAATCTGCACCGGCTTTCCTAGG + Intergenic
927288053 2:21377583-21377605 ATGTCTGCATATTCTTTCCTGGG + Intergenic
929405274 2:41634562-41634584 AATGCTGGACAGTCTTTTTTTGG - Intergenic
930188973 2:48438854-48438876 AACACTGCACATTCTTTCCTCGG + Intergenic
931836807 2:66107875-66107897 AAGGCAGCAGAGTCTTGTCTGGG - Intergenic
933577716 2:84088703-84088725 AAAGCAGCACAGTATTTCCTTGG + Intergenic
933759325 2:85663265-85663287 CTGGCTGCAAAGCCTTTCCTGGG + Intronic
933765552 2:85706234-85706256 ACGGTTCCACAGTCTTGCCTAGG + Intergenic
936275372 2:111091695-111091717 AAGTCTGGACAGTAGTTCCTTGG - Intronic
936576891 2:113664727-113664749 AAGGCTAAACATTCCTTCCTAGG + Intergenic
937443214 2:121934298-121934320 GAGGCTGCACACTCTAGCCTGGG + Intergenic
937575588 2:123417581-123417603 ATGGCTGCATAGTATTTCATGGG + Intergenic
940083744 2:149834431-149834453 AAGGCTGCATAGTATTCCATTGG + Intergenic
941261534 2:163304622-163304644 AAGGCAGAACAGCCCTTCCTTGG + Intergenic
943798083 2:192023506-192023528 AAGGCTGCACAGTTTTTGATTGG + Intronic
946291007 2:218745590-218745612 ATGGCTGCCCATTCTTCCCTGGG - Intronic
948166885 2:235869904-235869926 AAGGCTGCGCAGGCTTCCCAGGG + Intronic
948176367 2:235946672-235946694 ATGGCTGCCCAGCCTCTCCTTGG - Intronic
948415055 2:237797069-237797091 AAGGCTGGACACTCTCCCCTGGG - Intronic
948585093 2:239014543-239014565 AAGCCAGCACAGGCTTCCCTGGG - Intergenic
1168959140 20:1856645-1856667 AAGGCTCCACATGGTTTCCTGGG - Intergenic
1171258353 20:23709349-23709371 AAGACAGCACAGTCTTTCCATGG - Intergenic
1171275582 20:23854381-23854403 AAGACAGCACAGTCTTTCCTTGG - Intergenic
1171277888 20:23874287-23874309 GAGACGGCACAGTCTTTCCTTGG - Intergenic
1171287820 20:23956582-23956604 AAGGCAGTGCAGTCTTTCTTTGG - Intergenic
1173557090 20:43973929-43973951 AAGGAAGCAGAGTCATTCCTGGG + Intronic
1174574726 20:51528547-51528569 AAGGATGCACAGGCTTTCTCTGG + Intronic
1175225405 20:57441384-57441406 CAGTCTGCAGAGTCTTTGCTGGG - Intergenic
1175344501 20:58262951-58262973 ATGGCTGCACAGTATTCCATGGG + Intergenic
1176974242 21:15300888-15300910 ATGGTTGCCCAGTGTTTCCTAGG + Intergenic
1178424523 21:32468830-32468852 AAGGATACAAAGTATTTCCTGGG - Intronic
1178992557 21:37367460-37367482 CAGCCTGCTCAGTCTCTCCTCGG - Intronic
1179169546 21:38962361-38962383 AAGACACCACAGTCTCTCCTGGG + Intergenic
1180076575 21:45466270-45466292 CTGGCTGCACTGTCTGTCCTGGG + Intronic
1180707580 22:17818728-17818750 GGGGCTGCCCAGTCTGTCCTTGG + Exonic
1182159170 22:28104627-28104649 AAGGCTGCACAGTTGGACCTTGG - Intronic
1182890382 22:33813302-33813324 AGGGCTTGACAGTCTTGCCTGGG - Intronic
1183279149 22:36922904-36922926 CAGGCTGCACAGTCGGTCCAGGG + Intronic
1183398685 22:37588308-37588330 CAGGCCACACAGTCTTTCCATGG + Intergenic
1184681820 22:46076404-46076426 AGGGCTGCCCAGTGTTCCCTGGG + Intronic
1185423349 22:50747947-50747969 AAGGCTAAACATTCCTTCCTAGG - Intergenic
949842953 3:8340012-8340034 AACACTGCACAGTCTTTACAAGG + Intergenic
951136523 3:19109410-19109432 AATGCCACACATTCTTTCCTTGG + Intergenic
951780929 3:26362247-26362269 ATGGCTGCATAGTATTTCATTGG + Intergenic
952293169 3:32037885-32037907 TAAGTTGCAGAGTCTTTCCTAGG - Intronic
952654829 3:35772799-35772821 ACAGCTGCACAGGCTTGCCTGGG + Intronic
952955572 3:38555358-38555380 AAGGCTGCACTGCTTTTCCTGGG + Intronic
952956872 3:38563062-38563084 AATGCTGCACAGTCTGGCCTTGG - Intronic
954350370 3:50038179-50038201 AAGCCTGCACAGTATTCCCCAGG - Intronic
954537976 3:51375564-51375586 CACCCTGGACAGTCTTTCCTAGG + Intronic
957209208 3:77238934-77238956 AAGGATGCACAATCATCCCTTGG + Intronic
958433792 3:94073144-94073166 ATGGCTGCATAGTATTTCATGGG + Intronic
961487696 3:127228066-127228088 AAGGATGGACAGGCTCTCCTAGG + Intergenic
961714712 3:128850339-128850361 AAGCCTGGACAGTGTTTCCTGGG - Intergenic
964145251 3:153453067-153453089 ACTGCACCACAGTCTTTCCTGGG + Intergenic
964597086 3:158445303-158445325 ATGGCTGCATAGTATTTCATGGG - Intronic
965182354 3:165420595-165420617 ATGGCTGCATAGTATTTCATGGG - Intergenic
967175146 3:186855831-186855853 ACGGAAGCACAGTCCTTCCTGGG - Exonic
970194316 4:13540695-13540717 AAGGATGCTTAGTCTCTCCTGGG - Intergenic
971348299 4:25832220-25832242 GATGATGCACAGTCTTCCCTTGG - Intronic
972123918 4:35740285-35740307 AAGGATGCAAAGTATTTTCTAGG + Intergenic
972345357 4:38188360-38188382 CAGGCTCCACAGTCTTCCCAGGG - Intergenic
975041732 4:69753017-69753039 ATAGCTCCACAGGCTTTCCTTGG + Intronic
976963964 4:91012353-91012375 AAAGCTGCACAGTGCTGCCTGGG - Intronic
978310381 4:107380280-107380302 AAGGCGACAAAGTATTTCCTTGG + Intergenic
978555910 4:109980152-109980174 GATGTTACACAGTCTTTCCTTGG + Intronic
979009533 4:115349994-115350016 ATGGCTGCATAGTATTTCCATGG + Intergenic
980422184 4:132577806-132577828 AAGGCTGAATAGTATTTCATTGG - Intergenic
981856411 4:149298783-149298805 ATGGCAGTACAGTCTTCCCTGGG + Intergenic
982539057 4:156644750-156644772 AAAGCTGAACAGAATTTCCTTGG + Intergenic
982786071 4:159538326-159538348 AAGGGAGCACTCTCTTTCCTTGG - Intergenic
983089808 4:163489942-163489964 AAGGCAGCAGTGTCATTCCTGGG - Intergenic
983606691 4:169594762-169594784 AAAGATGCTCAGTCTTTCCTAGG + Intronic
984417980 4:179485157-179485179 AATGCAGCACTGGCTTTCCTGGG - Intergenic
984462154 4:180052149-180052171 AAGGCTGAATAATGTTTCCTTGG - Intergenic
984994883 4:185420713-185420735 AAGGCTTCACAGTTTTTTTTAGG - Intronic
988698263 5:33646035-33646057 AACCCTGCACAGTGGTTCCTTGG - Intronic
989127456 5:38070714-38070736 AAGGAAGCACAGCCTTTCTTGGG + Intergenic
990343931 5:54852641-54852663 TAGGCTGCACAGTACTCCCTGGG + Intergenic
990597025 5:57322392-57322414 ATGGCTGCACAGTCCTTTGTAGG - Intergenic
992114016 5:73522389-73522411 AAGGCTGCCCAGCTTCTCCTTGG - Intergenic
992245541 5:74818658-74818680 TAGGCAGCAAAGTGTTTCCTCGG + Intronic
993142144 5:84048017-84048039 AAGGATGCTCACACTTTCCTAGG - Intronic
994692988 5:103040892-103040914 AAGGCTGCATAGTATTGCATTGG + Intergenic
996535728 5:124575430-124575452 AAATCTGCAGAGTCTTTACTAGG - Intergenic
997186527 5:131887173-131887195 ATGGCTGCACAGTATTCCATGGG + Intronic
997585662 5:135041489-135041511 AGGGCTGCACAGGCACTCCTGGG + Intronic
998206243 5:140158560-140158582 GAGGCTGCACAGCCTTTCAAAGG - Intergenic
998323650 5:141258027-141258049 ATGGCTGCATAGTCTTCCATGGG + Intergenic
1000193746 5:158938305-158938327 GAAGCTGCACAGGCTGTCCTGGG - Intronic
1001267297 5:170283153-170283175 CAGGCTTCACAGTCTTTCTAGGG + Intronic
1001779071 5:174352026-174352048 ACGGCTGCACAGTATTCACTGGG - Intergenic
1006436757 6:34029698-34029720 ATGGCTTCACAGTCTGTGCTTGG - Intronic
1007716021 6:43856659-43856681 AAGGCTGCACAACCTCTCCAGGG - Intergenic
1009506351 6:64485118-64485140 GAGGCAGCACTTTCTTTCCTTGG - Intronic
1009634070 6:66241113-66241135 AAGGCTTCACAGACCTTCATTGG - Intergenic
1013478657 6:110532859-110532881 AAGTCAGCAAAGTCTTTCCTTGG - Intergenic
1013832101 6:114285472-114285494 AAGGCTGCATAGTATTTCACTGG - Intronic
1014516581 6:122386205-122386227 AAGGCTGCACATTCATTAATGGG + Intergenic
1016538928 6:145141048-145141070 AAGGATACACTGCCTTTCCTGGG + Intergenic
1019273371 7:163142-163164 AAGGCAGCACAGTGTTGCATGGG - Intergenic
1020500214 7:8908981-8909003 TAGGCAGCCCAGTCTTTCCCAGG - Intergenic
1020998041 7:15289992-15290014 AAGACTGCACTGTCCATCCTGGG - Intronic
1021126799 7:16860119-16860141 AAGGAGGTACAGTCTTACCTAGG - Intronic
1022559647 7:31335703-31335725 AAACCCGCACAGTCTTTCCGGGG - Intergenic
1022746812 7:33180944-33180966 AAGGCGACAAAGTATTTCCTTGG + Intronic
1023621447 7:42077467-42077489 AGGGCTGCACAGTGTTTCCCTGG - Intronic
1023829534 7:44030748-44030770 CAGGCTGCACAGGCTCTCCTGGG + Intergenic
1024098439 7:46005176-46005198 AAGGCCACACTGTGTTTCCTGGG + Intergenic
1025911358 7:65831454-65831476 AAGGCTCTAAAGTGTTTCCTTGG - Intergenic
1026462241 7:70624781-70624803 AAGGCAGCACTGGCTTCCCTGGG + Intronic
1029739843 7:102485006-102485028 CAGGCTGCACAGGCTCTCCTGGG + Intronic
1029757842 7:102584185-102584207 CAGGCTGCACAGGCTCTCCTGGG + Intronic
1029775778 7:102683246-102683268 CAGGCTGCACAGGCTCTCCTGGG + Intergenic
1030583268 7:111385960-111385982 GAGGCTGCACAGTCCAGCCTGGG - Intronic
1030766072 7:113411455-113411477 AAGGCTGCACTCTCATTTCTAGG - Intergenic
1031511722 7:122658534-122658556 ACGGCTGCATAGTATTTCCATGG - Intronic
1031539627 7:122977807-122977829 ATGGCTGCATAGTATTTCCATGG - Intergenic
1032423758 7:131803698-131803720 AAGGCAGCCCAGTCATGCCTCGG - Intergenic
1032878988 7:136068389-136068411 AAGGCTGAACATGCTTTCCAAGG - Intergenic
1033220870 7:139525398-139525420 GAGTCTGCACAGCCCTTCCTCGG - Intronic
1034221886 7:149452986-149453008 AACACTGCACTGTCTTTCCAAGG + Intronic
1034869870 7:154674515-154674537 AATGCTGCACAGTCTTTCTTGGG - Intronic
1035333300 7:158110486-158110508 AACGCTGCACAGTGTTCTCTGGG + Intronic
1035438877 7:158879299-158879321 AAGACAGCACAGTCGTCCCTTGG + Intronic
1036052440 8:5215758-5215780 GATACTGCACAGTCTTCCCTGGG - Intergenic
1038976058 8:32697505-32697527 AAGTGTCTACAGTCTTTCCTGGG + Intronic
1041103103 8:54416257-54416279 AAGGCTGCGCTTCCTTTCCTCGG - Intergenic
1041628276 8:60056024-60056046 AAGCCTGCACAATCTTTGCACGG - Intergenic
1043082301 8:75782156-75782178 AAGGCCTGTCAGTCTTTCCTGGG + Intergenic
1044846769 8:96389499-96389521 CAGGCTGCCCAGGCTTTCCCAGG - Intergenic
1046684349 8:117208183-117208205 ATGGGTGCACAGTGTGTCCTTGG - Intergenic
1047171121 8:122493165-122493187 ATGGCTGCATAGTATTTCCATGG + Intergenic
1047930037 8:129718832-129718854 ATGGCTGCATAGTATTTCCATGG - Intergenic
1054884414 9:70180205-70180227 ATGGCTGCATAGTATTTCATGGG + Intronic
1056239541 9:84630643-84630665 AAGGCTACACAGACGCTCCTTGG + Intergenic
1056803978 9:89713657-89713679 AATGGTGCACAGGCTTACCTGGG + Intergenic
1057054047 9:91948570-91948592 AAGGCTGCACAGTCTTTCCTGGG - Intronic
1057442309 9:95091293-95091315 AAGGGGCCACAGTCTGTCCTGGG + Intergenic
1057628881 9:96702929-96702951 AAGCTTGGACATTCTTTCCTTGG - Intergenic
1058791243 9:108447976-108447998 ATGGCTGCATAGTATTTCCATGG - Intergenic
1060403700 9:123362477-123362499 AAGCCTTCACTTTCTTTCCTGGG + Intronic
1062039783 9:134398980-134399002 AAGTCAGCACAGTGTTTCCCTGG + Intronic
1186002375 X:5027363-5027385 AAAGCTGCACAATCTATACTTGG - Intergenic
1187700701 X:21962197-21962219 AAGGCTGCCCTGTCTTTCACAGG - Intronic
1190729649 X:53217190-53217212 AAGGCTGCACAGACTGTCGTAGG + Exonic
1192686981 X:73317537-73317559 ATGGCTGCATAGTATTTCATGGG + Intergenic
1192787084 X:74346235-74346257 CAGGCTGCACAGGCTATCGTAGG + Intergenic
1193587780 X:83347396-83347418 AAGGCTGGACAGTTTTTCCTAGG + Intergenic
1195098537 X:101530133-101530155 ATGGCTGCATAGTCTTCCATGGG - Intronic
1196641621 X:118068934-118068956 GAGGCTGCGCAGTCCCTCCTGGG + Intronic
1198379649 X:136071906-136071928 TAGGCAGCACAGTCTTTCAAGGG + Intergenic
1198402257 X:136279375-136279397 AACACTGCAAAGTCCTTCCTAGG + Intergenic
1198944606 X:141996529-141996551 AATGCTACACAGGCTTCCCTTGG + Intergenic
1199097575 X:143759987-143760009 AAAGCTGCACACTCCCTCCTGGG - Intergenic
1201510059 Y:14749294-14749316 CAGGCTGCACAGTGTGTCCAGGG - Intronic
1201966235 Y:19739575-19739597 AAGGCTGCACAGACTGTCTAAGG + Exonic
1201966394 Y:19741156-19741178 GAGGCTGCAAAGTATTTTCTAGG + Intronic