ID: 1057055623

View in Genome Browser
Species Human (GRCh38)
Location 9:91958390-91958412
Sequence CCTTCAGAGGGAGCATGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057055610_1057055623 30 Left 1057055610 9:91958337-91958359 CCAAGGAATGTCCAAAAGCTGGA No data
Right 1057055623 9:91958390-91958412 CCTTCAGAGGGAGCATGGCCTGG No data
1057055612_1057055623 19 Left 1057055612 9:91958348-91958370 CCAAAAGCTGGAGAGAGGCCTGG No data
Right 1057055623 9:91958390-91958412 CCTTCAGAGGGAGCATGGCCTGG No data
1057055614_1057055623 1 Left 1057055614 9:91958366-91958388 CCTGGAACACATCCCTCCCTAGA No data
Right 1057055623 9:91958390-91958412 CCTTCAGAGGGAGCATGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057055623 Original CRISPR CCTTCAGAGGGAGCATGGCC TGG Intergenic