ID: 1057055756

View in Genome Browser
Species Human (GRCh38)
Location 9:91959474-91959496
Sequence TCATCCTGCTGAACTGTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057055756_1057055761 25 Left 1057055756 9:91959474-91959496 CCCATCACAGTTCAGCAGGATGA No data
Right 1057055761 9:91959522-91959544 CCCCATGAAGAGGCGTGCTCAGG No data
1057055756_1057055759 15 Left 1057055756 9:91959474-91959496 CCCATCACAGTTCAGCAGGATGA No data
Right 1057055759 9:91959512-91959534 GCTCTCATCACCCCATGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057055756 Original CRISPR TCATCCTGCTGAACTGTGAT GGG (reversed) Intergenic