ID: 1057055813

View in Genome Browser
Species Human (GRCh38)
Location 9:91959858-91959880
Sequence AGAGAGAAGCAGGCTGGGCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057055813_1057055822 7 Left 1057055813 9:91959858-91959880 CCGTGCCCAGCCTGCTTCTCTCT No data
Right 1057055822 9:91959888-91959910 ATAGGATTTTGGGAGGGTATAGG No data
1057055813_1057055820 0 Left 1057055813 9:91959858-91959880 CCGTGCCCAGCCTGCTTCTCTCT No data
Right 1057055820 9:91959881-91959903 GTTCTTAATAGGATTTTGGGAGG No data
1057055813_1057055818 -4 Left 1057055813 9:91959858-91959880 CCGTGCCCAGCCTGCTTCTCTCT No data
Right 1057055818 9:91959877-91959899 CTCTGTTCTTAATAGGATTTTGG No data
1057055813_1057055819 -3 Left 1057055813 9:91959858-91959880 CCGTGCCCAGCCTGCTTCTCTCT No data
Right 1057055819 9:91959878-91959900 TCTGTTCTTAATAGGATTTTGGG No data
1057055813_1057055821 1 Left 1057055813 9:91959858-91959880 CCGTGCCCAGCCTGCTTCTCTCT No data
Right 1057055821 9:91959882-91959904 TTCTTAATAGGATTTTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057055813 Original CRISPR AGAGAGAAGCAGGCTGGGCA CGG (reversed) Intergenic
No off target data available for this crispr