ID: 1057059892

View in Genome Browser
Species Human (GRCh38)
Location 9:91994301-91994323
Sequence CACACCCAGCTCCCAGGCGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057059886_1057059892 6 Left 1057059886 9:91994272-91994294 CCATCAAACATTAACACCCCATT No data
Right 1057059892 9:91994301-91994323 CACACCCAGCTCCCAGGCGCTGG No data
1057059887_1057059892 -10 Left 1057059887 9:91994288-91994310 CCCCATTCACTACCACACCCAGC No data
Right 1057059892 9:91994301-91994323 CACACCCAGCTCCCAGGCGCTGG No data
1057059885_1057059892 7 Left 1057059885 9:91994271-91994293 CCCATCAAACATTAACACCCCAT No data
Right 1057059892 9:91994301-91994323 CACACCCAGCTCCCAGGCGCTGG No data
1057059884_1057059892 8 Left 1057059884 9:91994270-91994292 CCCCATCAAACATTAACACCCCA No data
Right 1057059892 9:91994301-91994323 CACACCCAGCTCCCAGGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057059892 Original CRISPR CACACCCAGCTCCCAGGCGC TGG Intergenic
No off target data available for this crispr