ID: 1057060064

View in Genome Browser
Species Human (GRCh38)
Location 9:91995839-91995861
Sequence CCTGTTTGATCGTTTTGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057060064_1057060066 29 Left 1057060064 9:91995839-91995861 CCAGGGCAAAACGATCAAACAGG No data
Right 1057060066 9:91995891-91995913 CTACAGATCTAATTTGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057060064 Original CRISPR CCTGTTTGATCGTTTTGCCC TGG (reversed) Intergenic
No off target data available for this crispr