ID: 1057062211

View in Genome Browser
Species Human (GRCh38)
Location 9:92015937-92015959
Sequence CTTGCTTAAGAAAGCAGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057062209_1057062211 -8 Left 1057062209 9:92015922-92015944 CCATGAAAATGAGATCTTGCTTA No data
Right 1057062211 9:92015937-92015959 CTTGCTTAAGAAAGCAGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057062211 Original CRISPR CTTGCTTAAGAAAGCAGTGT GGG Intergenic