ID: 1057063405

View in Genome Browser
Species Human (GRCh38)
Location 9:92026203-92026225
Sequence GGCCCTACCCCTTGGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057063405_1057063415 18 Left 1057063405 9:92026203-92026225 CCCTCCTCCCAAGGGGTAGGGCC No data
Right 1057063415 9:92026244-92026266 AGTCAGCCCACTACCCACGCTGG No data
1057063405_1057063418 28 Left 1057063405 9:92026203-92026225 CCCTCCTCCCAAGGGGTAGGGCC No data
Right 1057063418 9:92026254-92026276 CTACCCACGCTGGCCCATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057063405 Original CRISPR GGCCCTACCCCTTGGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr