ID: 1057064721

View in Genome Browser
Species Human (GRCh38)
Location 9:92038117-92038139
Sequence GAGGGTAGAAAGGAAGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 660
Summary {0: 1, 1: 0, 2: 2, 3: 64, 4: 593}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057064721_1057064724 -10 Left 1057064721 9:92038117-92038139 CCAGCATCTTCCTTTCTACCCTC 0: 1
1: 0
2: 2
3: 64
4: 593
Right 1057064724 9:92038130-92038152 TTCTACCCTCTTCTCTCTCAGGG 0: 1
1: 0
2: 4
3: 34
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057064721 Original CRISPR GAGGGTAGAAAGGAAGATGC TGG (reversed) Intronic
900394684 1:2448397-2448419 GAGGGAAGACAGGCAGAAGCAGG - Intronic
900811994 1:4811210-4811232 GAGGGGAGAAAGGGAGAGGTAGG + Intergenic
900933492 1:5751118-5751140 GAGGTTACAGGGGAAGATGCAGG - Intergenic
900989798 1:6093100-6093122 GAAGGAAGGATGGAAGATGCTGG - Intronic
901751370 1:11412176-11412198 GAGGGTGGAAAGGATGGTGGGGG - Intergenic
902092829 1:13916883-13916905 GAGAGGAGAGAGGAAGAGGCAGG + Intergenic
902375331 1:16027640-16027662 GAGGGTAGAAGGGATGAGGCTGG + Intronic
902380294 1:16049437-16049459 GAGGGTAGAAGGGATGAGGCTGG + Intronic
902517945 1:16999969-16999991 CAGGGGAGGAAGGAAGCTGCAGG + Intronic
904323386 1:29711136-29711158 GAGGGGAGAAAGGAGGAAGAGGG + Intergenic
904445413 1:30569924-30569946 AAGGTTAGAAAGGCAGTTGCTGG - Intergenic
905037126 1:34925529-34925551 GAGGGGAGAGGGGAAGAAGCAGG + Intronic
905664929 1:39757651-39757673 GAGGGTTGGAAGGATGATGGTGG - Exonic
905835816 1:41119841-41119863 GAGGGAAAAAAGGAGGAGGCAGG - Intronic
907113916 1:51951882-51951904 GAGGGTAGAAAAGAAGTCACTGG + Intronic
907699299 1:56767586-56767608 AAGGGGAGAAAAGAAGAGGCTGG + Intronic
908255254 1:62298011-62298033 GAGGGTGGAATGGCTGATGCAGG + Intronic
908338833 1:63155348-63155370 GAGGGTAGAATGGAGGTTGGAGG + Intergenic
909909854 1:81247000-81247022 GAGGGAAAGAAGGAAGATGTGGG - Intergenic
909953986 1:81754499-81754521 GAGGGAAGAAAGAAAGAGGAAGG - Intronic
910268265 1:85364460-85364482 AAGGGTAGTAATGAATATGCAGG - Intronic
910641399 1:89466725-89466747 GAGGGGAGAAAAGGAGAAGCAGG + Intergenic
911018300 1:93358663-93358685 GAGGGAATAAAGGAAAATGCTGG - Intronic
912296369 1:108474527-108474549 GAGGGAAAAAAGGAAGATTTGGG - Intergenic
913414630 1:118591281-118591303 GAGGGGAGCAAGGAAGATAGGGG + Intergenic
913978736 1:143488639-143488661 GAAGGGTGAAAGGAAGAGGCTGG - Intergenic
914073145 1:144314287-144314309 GAAGGGTGAAAGGAAGAGGCTGG - Intergenic
914106009 1:144652073-144652095 GAAGGGTGAAAGGAAGAGGCTGG + Intergenic
914782011 1:150793896-150793918 GAGAGAAGAAAGAAAGAGGCCGG - Intergenic
915167932 1:153958862-153958884 GAGAGAAGAAAGGAAGAGGGAGG + Intergenic
915292813 1:154897693-154897715 GAGGGAGGAAAGGAGGAGGCTGG - Intergenic
915591773 1:156874937-156874959 CAGCGTAGAAAGGAAGAGGCAGG - Exonic
916899266 1:169202939-169202961 GAGAAGAGAAAGGAAGAAGCTGG + Intronic
917367089 1:174244031-174244053 TAGGGCAGAGAGGAAGATGTTGG - Intronic
917374368 1:174333174-174333196 GAGGGTAGATGGGGAGAGGCTGG + Intronic
917526335 1:175791648-175791670 GAGGGTAGTAGGGAAGAGACCGG + Intergenic
917620121 1:176786924-176786946 GAGGGTGGAGAGGAAGAGGAGGG + Intronic
917682044 1:177377264-177377286 AAGGGAAAAAAGGAAAATGCTGG + Intergenic
917977665 1:180250766-180250788 GAGGGTGGAGAGGAAGGTGATGG + Intronic
918220848 1:182435136-182435158 GAAGGCAGAAGGGAAGAGGCTGG - Intergenic
918687499 1:187436534-187436556 GAGCTAAGAAAGGAAGAGGCAGG - Intergenic
919319876 1:196022072-196022094 GAGTGAAAAAAGGAAAATGCAGG - Intergenic
919981326 1:202644191-202644213 GAGGGGAGAAAGGGCGATGGAGG + Intronic
920046114 1:203133673-203133695 GAAGGTGGAGGGGAAGATGCTGG - Intronic
920180885 1:204131156-204131178 GAGGGTAGAAAGGGAGGTGGAGG + Exonic
920267285 1:204733645-204733667 GTGGGTAGAAATGGAGGTGCAGG - Intergenic
920612907 1:207459155-207459177 GAGGTTATACAGGCAGATGCCGG + Intronic
920674534 1:208029976-208029998 GAGGGGAGAGAAGAAGAAGCTGG - Intronic
920811741 1:209292415-209292437 GAGGTTAGAAGTGCAGATGCTGG - Intergenic
921290333 1:213650996-213651018 GTGGGGAGAAAGGGAGAGGCTGG + Intergenic
921460174 1:215415784-215415806 GAGAGTAGGAAGGGAGCTGCTGG - Intergenic
921462805 1:215448861-215448883 GAGAGTAGGAAGGGAGCTGCTGG + Intergenic
921511756 1:216040002-216040024 GAGGGTAGAAAGGCAGATGTGGG - Intronic
921557141 1:216612357-216612379 GAGGGAAGGAAGGAAGGGGCGGG + Intronic
921589699 1:216989006-216989028 GAGACTTGAAAGGCAGATGCTGG + Intronic
922277782 1:224095312-224095334 GAGGGTGGGAAGGAAAATGAAGG - Intergenic
922428155 1:225519456-225519478 GAGGTTAGAAAGGGAAAGGCTGG - Exonic
922621558 1:226992411-226992433 GAGGGAAGAAAGGATCCTGCTGG - Exonic
923227716 1:231954683-231954705 TAGGGAAGAAAGGAAGAGGAGGG + Intronic
923324625 1:232870441-232870463 AAGGGTGGAAGGGAAGACGCAGG + Intergenic
923897303 1:238285803-238285825 GAGGGTAGAAAGGAGGATAAAGG - Intergenic
924059269 1:240154853-240154875 GAGGGAAGAAAGAAAGAGGGAGG - Intronic
924323975 1:242876934-242876956 GAGGTTAGACAGGCAGTTGCTGG + Intergenic
1062876449 10:946761-946783 GAGGGTGGCAAGGAAGAGGAGGG - Intergenic
1063045730 10:2390935-2390957 GGGGGTAGAGATGAAGACGCTGG + Intergenic
1063487226 10:6431020-6431042 GAGGTTAGAAAAGAAGGGGCTGG - Intronic
1064215102 10:13393729-13393751 GAGAGCAGAAATGAAGATGACGG + Intergenic
1064376236 10:14798973-14798995 GAGGGTAGAAAAGTGGTTGCTGG + Intergenic
1064526374 10:16260600-16260622 GAAGGAAGAAAGGAAGAGGGAGG + Intergenic
1064562057 10:16603326-16603348 GAGGGGAGAAATGAGGATTCTGG + Intronic
1065638348 10:27753460-27753482 AAGGGAAGAAGGGAAGAAGCGGG - Intergenic
1066433871 10:35379009-35379031 GAAGGTTGAAAGGAGTATGCAGG + Intronic
1066601366 10:37110957-37110979 AAGGGTAGAGAGGAAGAGGCAGG + Intergenic
1067167589 10:43878024-43878046 AAGGGGAGAAAGGGAGAGGCAGG - Intergenic
1068482773 10:57614948-57614970 GAGGGAAGATAGGAAGAGGTTGG + Intergenic
1069725906 10:70578398-70578420 GAGGAGAGAAAGGTAGATCCTGG + Intergenic
1070228900 10:74542645-74542667 GAGGGTAGGTAGGAAGAAACAGG - Intronic
1070358998 10:75669081-75669103 TATGGTAGAGAGGAAAATGCTGG - Intronic
1071178586 10:82956439-82956461 GATGGTAGATAGGCAGAGGCAGG + Intronic
1071178687 10:82957664-82957686 AAGGGTGGACAGGAAGTTGCTGG - Intronic
1071563935 10:86662075-86662097 GAGGACAGAAAGACAGATGCTGG - Intronic
1072267384 10:93743806-93743828 GATGGAAGAAAAGAGGATGCAGG + Intergenic
1072301550 10:94066999-94067021 GAGTGTAAAAAGGAAGTTGAAGG - Intronic
1073526694 10:104189672-104189694 GAGGGTGGGATGGAAGAAGCTGG - Intronic
1074212384 10:111348225-111348247 GAAGGAAGTAAGGAACATGCTGG + Intergenic
1074561882 10:114542516-114542538 GAAGGAAGAAAGGAAGAAGGAGG + Intronic
1074783755 10:116820929-116820951 GAGAGGAGTAAGGATGATGCTGG - Intergenic
1075532724 10:123243654-123243676 GAGACTAGAAAGCAGGATGCTGG + Intergenic
1075934632 10:126328951-126328973 GAGGGTAGGAAGGAGGAAGCTGG + Intronic
1076567367 10:131407910-131407932 GAGGGAGAAAAGGAGGATGCAGG - Intergenic
1076999503 11:315696-315718 CAGGGGAGCAGGGAAGATGCCGG - Intergenic
1078603639 11:12755889-12755911 GACGGGAGAAAGGAAGGGGCAGG + Intronic
1078805238 11:14693155-14693177 GAGAGAAGTAAGGAAGCTGCAGG + Intronic
1078975064 11:16464479-16464501 GAGGGGAGAAAGGAAAAGGAAGG + Intronic
1079045693 11:17100669-17100691 GAGGGTAGGAAGGGGGATGGTGG - Intronic
1080393439 11:31868967-31868989 GAAGGTAGAAAGGGACAGGCTGG - Intronic
1081643555 11:44774622-44774644 GAGGGAAGAAGGGAGGATGAAGG - Intronic
1081655632 11:44855696-44855718 GAGGGTAGGAAGACAGATGTGGG - Intronic
1082041920 11:47693124-47693146 GAGGGAAGAAAGAAAGAAACAGG - Intronic
1082131483 11:48495120-48495142 GAAGGAAGGAAGGAAGATGGAGG - Intergenic
1082923122 11:58517408-58517430 GATGGTAGAAGGAAGGATGCTGG - Intergenic
1083060151 11:59861420-59861442 GAGGGTAGAAAATAAAATCCAGG + Intronic
1083199269 11:61110012-61110034 GAGGCTAGGAAGGATGGTGCAGG + Intronic
1083550276 11:63583317-63583339 GAGCTTAGCAAGGAAAATGCTGG - Intronic
1083925510 11:65803768-65803790 AAGTGCAGGAAGGAAGATGCTGG + Intergenic
1083985815 11:66214554-66214576 GAAGGAAGGAAGGAAGATGGAGG - Intronic
1083999353 11:66287921-66287943 GAGGGGAGAGAGGAAGCTGTGGG + Intronic
1084597946 11:70128432-70128454 GAAGGAAGGAAGGAAGATGGAGG - Intronic
1084952859 11:72676318-72676340 GAGGGCAGAAAGGAGGCTGAGGG - Intergenic
1085208338 11:74750548-74750570 GAACATAGAAAGTAAGATGCAGG - Intronic
1085884084 11:80501579-80501601 GAGGGTAGTGAGGATGATGACGG + Intergenic
1086136381 11:83447066-83447088 GAGGGAAAGAAGGAAGATTCGGG + Intergenic
1086282766 11:85210023-85210045 GTGGGCAGAAAGGATGATGAGGG - Intronic
1087666361 11:101053624-101053646 GAGGGAAGAAAGGAGGAAGAAGG - Intronic
1088024493 11:105161455-105161477 GAGGATTGAAAGGAAAAGGCAGG + Intergenic
1088527766 11:110775111-110775133 TATAGGAGAAAGGAAGATGCTGG + Intergenic
1088683368 11:112264538-112264560 GATGGTAGAAAAGAAAATACAGG + Intronic
1089257862 11:117203481-117203503 GAAGGTAGAGAGGAAGAGGCTGG + Exonic
1089329859 11:117681664-117681686 GTGGGGAGAGAGGAGGATGCTGG - Intronic
1089684942 11:120140785-120140807 GAGGATAGAAAGATGGATGCTGG + Intronic
1091384111 12:81382-81404 GAGGGAAGAAAGGCAGAAGCAGG + Intronic
1092145792 12:6213826-6213848 GAGGGAGGGAGGGAAGATGCTGG - Intronic
1092882725 12:12900524-12900546 GAGGGAGGAAAGGAAGAGGAGGG - Intronic
1092886531 12:12929311-12929333 GAGAGAAGAAAGGGAGATGGGGG + Intergenic
1093212434 12:16324176-16324198 GATGGGAGAAAGGAACATGGAGG + Intergenic
1093350600 12:18095407-18095429 GAAGGAAGGAAGGAAGATGGGGG + Intronic
1093363201 12:18257734-18257756 GAGGGAAGGAAGGAAGAAGGAGG + Intronic
1093734917 12:22609859-22609881 GAGGCTAGAGGGGAATATGCTGG - Intergenic
1093933477 12:24977333-24977355 TAAGGAAGAAAGGAAGTTGCAGG + Intergenic
1094383717 12:29871104-29871126 GAGGGTAGAACAGAAAATGGGGG - Intergenic
1094767202 12:33610623-33610645 AAGGGTAGAAAGGAAAATCCTGG + Intergenic
1095758966 12:45805895-45805917 TAGGGGAAAAAGGGAGATGCTGG - Intronic
1097641957 12:62192388-62192410 GAGGGGAGAAAGAAAGGAGCGGG + Exonic
1097657319 12:62382869-62382891 GTAGGTAGACAGGAAGAGGCAGG - Intronic
1098402771 12:70091369-70091391 GAGAGGAGAAAGGAAGAAACTGG - Intergenic
1098786346 12:74761570-74761592 GAGGTTAGACAGGCAGTTGCTGG - Intergenic
1099169719 12:79349122-79349144 GAAGGTAGGAAGGAAGAGGAAGG + Intronic
1099234173 12:80062521-80062543 GCAGGTAGAAAGGATGTTGCAGG - Intergenic
1099945902 12:89244104-89244126 GGGGGCAGAAAGGAAGAAGGTGG - Intergenic
1100286282 12:93169610-93169632 GAGGGAAGAAAGGAAGGGGAGGG + Intergenic
1100855503 12:98753931-98753953 GATGATGGAGAGGAAGATGCAGG + Intronic
1101807023 12:108072940-108072962 AAGGGTACAAAGGAAGCTTCTGG - Intergenic
1101951663 12:109180974-109180996 GAGGCTGGAAAGGAAGAGGTAGG - Intronic
1102724716 12:115051063-115051085 GATGGTAGAAAGGAAAATTAAGG - Intergenic
1102880629 12:116482119-116482141 GACGCCAGAAAGGACGATGCCGG + Intergenic
1103232308 12:119341780-119341802 AAGGGTAGAAGGGAAGAAGCAGG + Intronic
1103367013 12:120390765-120390787 GAGGGAAGAAAGGAAGGAGGAGG + Intergenic
1103464222 12:121129006-121129028 GAGGAAAGAAAGGAAGATGGCGG - Intergenic
1104213212 12:126710543-126710565 GAGGATAGAATGGATGATGTGGG + Intergenic
1104390953 12:128390284-128390306 GCGGGCAGAAAGCAAGGTGCTGG + Intronic
1104606566 12:130193737-130193759 CAGGGTAGAAAGGATGAAGACGG - Intergenic
1105220594 13:18322757-18322779 GAAGGGTGAAAGGAAGAGGCTGG + Intergenic
1105842909 13:24270868-24270890 GAGGGGAGATAGCAAGATTCTGG + Intronic
1106945690 13:34824983-34825005 GAGAGTAGAAAGGAGAATGGTGG - Intergenic
1107832976 13:44390736-44390758 GAGGGAAAAAAGAGAGATGCCGG - Intronic
1108010941 13:46009192-46009214 GGGGGTAGATAGGAGGAAGCTGG + Intronic
1108256819 13:48619104-48619126 GAGAGGAGAAAGGAAGAAACAGG + Intergenic
1108319667 13:49276533-49276555 GAGGTTAGCAGGGAAGATACTGG - Intronic
1108480707 13:50867426-50867448 GAAGGAAGAAAGAAAGAAGCAGG - Intergenic
1109119825 13:58440700-58440722 GAGGGTGGAAGGCAAGAGGCAGG - Intergenic
1110034764 13:70669308-70669330 GAGGGAAGAAAGGAGGATGAGGG - Intergenic
1110390989 13:74973820-74973842 TAGAGTTGAGAGGAAGATGCAGG + Intergenic
1111330954 13:86761677-86761699 GAGGGAAGCAAGGAAGATATTGG + Intergenic
1112108970 13:96273858-96273880 GAAGGTAGAAAGGAAGGGCCTGG - Intronic
1113440759 13:110326360-110326382 GAGGATAGAGAGGAAAGTGCAGG - Intronic
1114429020 14:22644681-22644703 GAGGGGACAGAGGAAGAAGCAGG - Intergenic
1114756969 14:25270203-25270225 ATGGGTAGATAGGAAGATGGTGG - Intergenic
1114796086 14:25716672-25716694 GAGGGTTGAGAGGAGGAGGCAGG + Intergenic
1116053998 14:39840163-39840185 GAGGGTAGACAGGACAAAGCGGG - Intergenic
1116149161 14:41116502-41116524 GAATGAAGAAAGGAAGATGTCGG + Intergenic
1117222749 14:53621874-53621896 CATGATAGAAAAGAAGATGCTGG + Intergenic
1117327816 14:54684960-54684982 GAGGGTGGCCAGGAAGCTGCAGG + Intronic
1117987631 14:61404123-61404145 CACGGTAGAAGGGAAGAAGCAGG - Intronic
1119327976 14:73773374-73773396 GTGGGTAGGAAGGTAGAGGCTGG + Intronic
1119658758 14:76436030-76436052 GAGGGAAGCAAAGAAGATGCTGG - Intronic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1119869930 14:78008329-78008351 GAGGGCAGAAAGGCAGGGGCTGG + Intergenic
1120711415 14:87797299-87797321 GTGGGAGGAAAGGAGGATGCTGG + Intergenic
1121191425 14:92034120-92034142 GAGGCTAGAAAGGGAGCTGGAGG + Intronic
1121574219 14:94970045-94970067 GAGGCTAGAAAGGAAGGTTAAGG + Intergenic
1121584956 14:95056969-95056991 GAGGGAAGGAAGGAAGCTGGAGG - Intergenic
1121792219 14:96707246-96707268 GAGGGAAGAAAGGAAGACTCAGG + Intergenic
1121919961 14:97871685-97871707 AAGTTTAGAAAAGAAGATGCAGG + Intergenic
1122823210 14:104357358-104357380 CAGGGGAGCAAGGCAGATGCTGG + Intergenic
1123709094 15:22973513-22973535 AAGGGGAGAGAGGAAGATGTTGG - Intronic
1123986300 15:25649297-25649319 TAGGGTAGGAAGGAAGCAGCAGG - Intergenic
1124483589 15:30097951-30097973 GGGGATAGAACGGAAGATGCCGG - Intergenic
1124497025 15:30192926-30192948 GAGGGGAGAAAGAGGGATGCAGG + Intergenic
1124519989 15:30399275-30399297 GGGGATAGAACGGAAGATGCCGG + Intergenic
1124538665 15:30566949-30566971 GGGGATAGAACGGAAGATGCCGG - Intergenic
1124746551 15:32345721-32345743 GAGGGGAGAAAGAGGGATGCAGG - Intergenic
1124759985 15:32440633-32440655 GGGGATAGAACGGAAGATGCCGG + Intergenic
1125898011 15:43318767-43318789 TAGGCTAGAAAGTAGGATGCTGG + Intergenic
1126058610 15:44756606-44756628 TAGGGTGGAAAGGAATATGGTGG + Intronic
1126682228 15:51213537-51213559 GGAGGTAGAAAAGAAGATGATGG + Intronic
1127397207 15:58552446-58552468 GAGGGCAGAGAGGAGGAGGCGGG - Intronic
1128333358 15:66770721-66770743 GAGGGTGGAAAGGGAGAGCCAGG - Intronic
1128789702 15:70423913-70423935 GAGGGGCAAAAGGAAGATGAGGG - Intergenic
1129092481 15:73166120-73166142 GAGAGGAGAAAGGAAGAAACCGG - Intronic
1129142220 15:73610040-73610062 GAGGGAAGAAAGGAATAGGGAGG - Intronic
1129625336 15:77192175-77192197 GAGAGCAGTAAAGAAGATGCAGG + Intronic
1129854237 15:78812204-78812226 GAAGGGAGAAAGGAAGCTCCTGG - Intronic
1130119559 15:81035813-81035835 GAGGAAAGAATGGAGGATGCTGG - Intronic
1130155284 15:81345043-81345065 CAGGGGAGAAAGGAAAATGGCGG + Intronic
1130418555 15:83717547-83717569 GAAGGGAGAAAAGAAGGTGCGGG + Intronic
1130896529 15:88174432-88174454 GAGGCCAGGAGGGAAGATGCTGG - Intronic
1130948864 15:88570045-88570067 TAGGTTAGAAAGAAAGATGTAGG + Intergenic
1131452677 15:92558734-92558756 GAGGGTAGAATGGTAGAAGTAGG + Intergenic
1131646451 15:94350134-94350156 TAGAGTATAAAGAAAGATGCTGG + Intronic
1132858527 16:2058233-2058255 GAGGGGAGAAGGCAAGATGGAGG - Intronic
1133166355 16:3950261-3950283 GAAGGAAGAAAGGTAGGTGCAGG - Intergenic
1133435493 16:5775821-5775843 GACAGTGGAAATGAAGATGCAGG + Intergenic
1133656729 16:7872114-7872136 GAAGGAAGAAAGGAAGATAATGG - Intergenic
1134112966 16:11527296-11527318 GAGGGTAGAAGGGGAGGTGGGGG + Intergenic
1134232393 16:12438951-12438973 GAGGGTAGAGAGGAAGGCACCGG + Intronic
1134236612 16:12471221-12471243 GCGGGTGGAAAAGAAGATGTGGG - Intronic
1134342292 16:13356716-13356738 GAGGGTAAGAAGGAAGATTTGGG + Intergenic
1134904592 16:17969487-17969509 TAGGGTAGGAAGGAAGTTGTAGG - Intergenic
1135196988 16:20402907-20402929 CAGGCTAGAAAGGCAGGTGCCGG - Intronic
1135325968 16:21526112-21526134 GAGGGAAGAGGGGAAGAGGCTGG + Intergenic
1135807249 16:25554053-25554075 GAGAGGAGAAAGGAAGAAGCTGG - Intergenic
1135909770 16:26549023-26549045 GAGGGTAGAAAAGAAGGTAAGGG + Intergenic
1136051309 16:27652337-27652359 GAGGGCAGAAATAAAGATACGGG + Intronic
1136100723 16:27993633-27993655 GAGAGGAGAAAGGAAGAAGCTGG + Intronic
1137258260 16:46796432-46796454 GAGGGGAGCTAGGGAGATGCTGG + Intergenic
1137319377 16:47364008-47364030 GTAGGTGGAAAGGAAGATGGAGG + Intronic
1137589424 16:49684712-49684734 GAGGGCTTATAGGAAGATGCGGG - Intronic
1137609007 16:49806385-49806407 TCGGGTGGAAAGGAAGAAGCAGG + Intronic
1138083785 16:54115666-54115688 GAGGGGAGAAGGGGAGATGTAGG + Exonic
1138342524 16:56299517-56299539 CAGGGAAGAAAGGAAGGTGGGGG - Intronic
1138486723 16:57349915-57349937 GATGGAAGGAAGGAAGGTGCAGG - Intergenic
1139127795 16:64101165-64101187 GAGGGGAAAAAGGATGATGCTGG + Intergenic
1140266420 16:73425174-73425196 GAGGGTGGAGAGGGAGAAGCTGG + Intergenic
1140319322 16:73933114-73933136 GAAGGGAGAGAGGAAGATGAGGG + Intergenic
1140604735 16:76522139-76522161 GAGGGTTGAAAGGAACATGAAGG + Exonic
1140771228 16:78205810-78205832 GAAGGTAGGAAGGAAGGTGTGGG - Intronic
1140958886 16:79893759-79893781 CAGGGTAAAAAGGATGAGGCAGG + Intergenic
1141472590 16:84249601-84249623 GGGGAGAGAAAGGAAGGTGCTGG - Intergenic
1141477750 16:84284950-84284972 GAGGATAGGAAGGATGAGGCAGG - Intergenic
1141790853 16:86233093-86233115 GAGAGTAGAATGGCAGTTGCCGG + Intergenic
1141827555 16:86491696-86491718 GAGGCAATAACGGAAGATGCAGG - Intergenic
1142525058 17:534413-534435 TGGGGTAGAAAGGAAGCTGAGGG + Intronic
1142654974 17:1385643-1385665 GAGGGAAGGAAGGAAGACGGAGG + Intronic
1142748397 17:1972540-1972562 GAGGGTAGAGAGGGCGTTGCAGG - Intronic
1143282790 17:5767153-5767175 GAGAGTCGAAAGGCGGATGCAGG - Intergenic
1143940458 17:10535616-10535638 CAGGGTAGAAAGGATGGTGTTGG - Intronic
1144583223 17:16471884-16471906 GAGGGTAAAATGGCAGTTGCTGG + Intronic
1144755564 17:17678713-17678735 GAGAGGAGGAAGGAATATGCAGG - Intergenic
1145109078 17:20145784-20145806 GAAGGAAGGAAGGAAGATGTGGG + Intronic
1145283174 17:21483225-21483247 GGAGGTGGAAAGGAAGAGGCAGG - Intergenic
1146511081 17:33449265-33449287 GAGGGGAGGAAGGAAGCAGCTGG - Intronic
1146947381 17:36883248-36883270 GCGGGTAGTAAAGAAGATACTGG - Intergenic
1148535662 17:48436656-48436678 GAGGGGTGAAAGGAAGATCTTGG - Intergenic
1148675342 17:49441656-49441678 GAGGGAAGAGAGGAAGGTGGAGG + Intronic
1148910559 17:50940182-50940204 GAGGGGAGGTAGGAAGAGGCTGG + Intergenic
1149730721 17:58943561-58943583 GAGGGTAGAAAGGAAGGAGGAGG - Intronic
1150437795 17:65167616-65167638 GATGGTGACAAGGAAGATGCTGG - Intronic
1150541356 17:66103376-66103398 GAGGATAGAAAGAAAGAAGAGGG + Intronic
1150863786 17:68827909-68827931 GAGGGTAGAAAGGTGGTTACAGG - Intergenic
1151050961 17:70978419-70978441 GATGGGAGAAAGGAAGAAGACGG + Intergenic
1151234931 17:72713086-72713108 GAAGGTAAACAGGAAGAAGCAGG + Intronic
1151766583 17:76136226-76136248 GATGGCTGAGAGGAAGATGCGGG - Intergenic
1152116188 17:78388920-78388942 GAGGGTACAAATGAAGAACCAGG - Intronic
1152753745 17:82078318-82078340 GAGGGAAGAAAGGACGGTGGTGG + Exonic
1153138044 18:1940584-1940606 AAAGGAAGAAAGGAAGATGAGGG + Intergenic
1153658390 18:7305396-7305418 GCTGGTAGAGAGGAAGAAGCTGG + Intergenic
1153957437 18:10109957-10109979 CAGGCTAGAAAGAAAGATGTCGG - Intergenic
1154000404 18:10477728-10477750 CAGGGGAGAAAGGAAGAGGATGG + Intronic
1155022468 18:21909281-21909303 TAGGGTAGATAGAAAGAAGCTGG - Intergenic
1156579779 18:38361675-38361697 GAGGAGAGAAAGAAAGATGGGGG + Intergenic
1156697459 18:39784011-39784033 GAGGGTAGAAAGGAAAATAAAGG + Intergenic
1156865192 18:41881085-41881107 GAAGATAGAAAGGAAAATGAGGG + Intergenic
1156920355 18:42514991-42515013 GAGTGGAGAGAGGAAGATACTGG - Intergenic
1157097572 18:44700274-44700296 GAAGGTAGAGAGGAAGATCCTGG + Intronic
1157506043 18:48227406-48227428 GACGGCAGAAAGGAAGAGGGTGG - Intronic
1158305871 18:56104847-56104869 GAGTGGAGAAGGGAAGAGGCAGG - Intergenic
1158390911 18:57044230-57044252 AAAGGGGGAAAGGAAGATGCGGG + Intergenic
1158394754 18:57070776-57070798 GAGGGTAAAAAGGAAGATTTGGG + Intergenic
1158420561 18:57289250-57289272 GAGGGTAGGAAGAAGGATTCTGG + Intergenic
1158746208 18:60202535-60202557 GAGGGTAGCAAGGAGCATGCAGG - Intergenic
1159141858 18:64406304-64406326 CAGGGTAGAAAGCAAAATGCTGG - Intergenic
1162784067 19:13023314-13023336 GAGGGAGGAAAGGAAGAAGGGGG - Intronic
1163622176 19:18367627-18367649 AAGGAAAGAAAGGAAGAAGCAGG + Exonic
1164441992 19:28285437-28285459 GAGGGTGGAAGGGAAGAAGAGGG + Intergenic
1165137238 19:33677372-33677394 GATGGTAGAAAAGAGGCTGCAGG + Intronic
1165925615 19:39324370-39324392 GAGAGAAGAAAGGAAGAAGAAGG + Intergenic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1166813347 19:45527114-45527136 CAGGGTGGGAAGGAAGATGAAGG - Intergenic
1167096668 19:47378148-47378170 GAGGGGAGAGAGGAACCTGCAGG + Intronic
1168348448 19:55662059-55662081 GAAAGTAGAAAGGAAGTGGCAGG - Intronic
1168467978 19:56619335-56619357 GACGGTAGAACAGAGGATGCCGG - Intronic
925596033 2:5556199-5556221 GATGGGAGAAGGGAAAATGCAGG + Intergenic
926090327 2:10044821-10044843 GAGGGGAGGAGGGAAGAGGCTGG - Intronic
926315647 2:11707720-11707742 GAGGGGAGAAAGGGAGTGGCTGG + Intronic
927582938 2:24271020-24271042 ATGGGTAGAAAGGAAAGTGCAGG + Intronic
928188171 2:29134475-29134497 GAGGTTAGAAATGAACATTCTGG - Intronic
928498617 2:31863035-31863057 GAGGAAAGAAAGAAAGAGGCTGG + Intergenic
929874417 2:45784780-45784802 GGGGATAGAAAGGAAAATGGTGG + Intronic
930055718 2:47250637-47250659 GCCGGGAGAAAGGAAGTTGCAGG + Intergenic
930113136 2:47695986-47696008 GAGAGAAGAAAGGAAGAAACCGG - Intronic
930454624 2:51590894-51590916 GAGGGATGGAAGTAAGATGCCGG + Intergenic
930984856 2:57573084-57573106 GAGAGAGGAAAGGGAGATGCCGG - Intergenic
931097304 2:58955615-58955637 GAGGATAGAAAGGAAGGGGGAGG - Intergenic
931164471 2:59731934-59731956 CAGCGGAGAAAGGAATATGCAGG + Intergenic
932295746 2:70622197-70622219 GAGGGAAAAAAGGAAGATTTGGG - Intronic
932460694 2:71880071-71880093 GAAGGCAGAAGGGAAGAAGCTGG - Intergenic
932538935 2:72630453-72630475 GAGTGTAGAGAGGATAATGCAGG - Intronic
932778607 2:74545240-74545262 GAGGGTAAAAACAAAGATGGAGG - Intronic
932901755 2:75709562-75709584 GAGGGTAGTTGGGAAGATACTGG + Intronic
933067618 2:77818190-77818212 GAAGGAAGGAAGGAAGATGCTGG - Intergenic
933069306 2:77836955-77836977 GAGGGAAGGAAGGAAGAAGAGGG + Intergenic
933990105 2:87627875-87627897 GAGGGGAGGCAGGAAGATTCAGG + Intergenic
934056151 2:88253058-88253080 GAAGGAAGGAAGGAAGATGAGGG - Intergenic
934149114 2:89128581-89128603 GAGAGTAAAGAGGAAGATGATGG - Intergenic
934183461 2:89649718-89649740 GAAGGGTGAAAGGAAGAGGCTGG - Intergenic
934218181 2:90053461-90053483 GAGAGTAAAGAGGAAGATGATGG + Intergenic
934293744 2:91723890-91723912 GAAGGGTGAAAGGAAGAGGCTGG - Intergenic
934949877 2:98569037-98569059 GTGCTTAGAGAGGAAGATGCGGG + Intronic
935041807 2:99437458-99437480 GAGGGTAGTAAGGAAGTATCTGG - Intronic
935105992 2:100044215-100044237 GAGGGTAGAATGGAGGATGCGGG - Intronic
936303741 2:111322949-111322971 GAGGGGAGGCAGGAAGATTCAGG - Intergenic
936531642 2:113280106-113280128 GAGGGGGGCAAGGAAGGTGCAGG + Intergenic
937487076 2:122326355-122326377 GAGGGCAGAAAGTAAAATGCTGG + Intergenic
937504351 2:122519870-122519892 GAGAGGAGAAAGGAAGAAACAGG + Intergenic
938122678 2:128644872-128644894 GAGGGGAGAGAGGAAGAAACAGG - Intergenic
938242780 2:129756185-129756207 AAGGGTAGGAAGGAAGAGGTGGG + Intergenic
938461826 2:131502242-131502264 GAGGGGAGAAAGGGAGAGGCAGG + Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938939834 2:136160517-136160539 GAGAGAAGATAGGAAGAGGCTGG - Intergenic
939798242 2:146674949-146674971 GAAGGTAGAAAGGATGATGGAGG - Intergenic
940219131 2:151333240-151333262 AAAGGTATAAAGGAAGATGCTGG + Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
941591152 2:167422141-167422163 GAGGGAGGAAAGGAAGAGGAAGG + Intergenic
941965480 2:171296395-171296417 GAGGGTGGAGAGGACAATGCAGG + Intergenic
942172383 2:173300736-173300758 GAGAGTAGAAAGGAAGAAACTGG - Intergenic
942724467 2:178991534-178991556 GAGGGTAAGAAGGAAGAAGGAGG + Intronic
943137420 2:183932218-183932240 TAGGGTAGAAAGGAGGATTGAGG + Intergenic
943703134 2:191007586-191007608 GAAGGAAGAAAGGAAAATTCTGG - Exonic
944370671 2:198979374-198979396 GATAGTAGAAGGGAAGATGAGGG + Intergenic
944534597 2:200696609-200696631 GAGGCTGGAAAGGAAGGTGGAGG + Intergenic
944821961 2:203440710-203440732 GAGGGTGGAATGTAAGAAGCAGG + Exonic
945506069 2:210641608-210641630 GAGAGTAGACAGGTAGATGCTGG - Intronic
945659377 2:212666802-212666824 AAGGTTAGAATGAAAGATGCTGG + Intergenic
945749747 2:213766853-213766875 CAGTGTTGAAAGGAAGCTGCAGG - Intronic
946188039 2:217992243-217992265 GAGGGGAGAGAGGGAGCTGCTGG - Intronic
946385491 2:219381876-219381898 GAAGGGAGAAAGGAAGAGGCTGG + Intronic
946769991 2:223078996-223079018 GCAGGAGGAAAGGAAGATGCAGG + Intronic
946877134 2:224140429-224140451 TAGGGCAGAAAGGAGGATGTGGG - Intergenic
947383916 2:229571536-229571558 GAGGTTAGAATGGAAGCTGCTGG - Intronic
948742058 2:240054608-240054630 GAGGAGAGAGAGGAAGATGAGGG + Intergenic
1168874200 20:1159460-1159482 AAGGCTAGAAAGGCAGTTGCAGG - Intronic
1169442178 20:5641711-5641733 GAGGGGAGAAAAGAAGAGACAGG + Intergenic
1169532274 20:6498428-6498450 AAGGGCAAAAAGGAAGATGCTGG + Intergenic
1170554806 20:17506273-17506295 AAAGGTAGAAAGAAAGATGTTGG - Intronic
1170745775 20:19097806-19097828 GTGGGGAGAAAAGAAAATGCAGG - Intergenic
1171013033 20:21518772-21518794 CAGGCAAGAAAGGAAGATACAGG + Intergenic
1172877238 20:38172119-38172141 GAAGGGAGAAAGGAAGAGGGAGG + Intergenic
1173112831 20:40209957-40209979 AAGGGAAGAAAGGAGGAGGCAGG + Intergenic
1173344273 20:42184466-42184488 GAGGGAAGAAAGGAAGGAGTGGG - Intronic
1173764789 20:45597472-45597494 GAGGGTAGAGAGGAAGTTGATGG - Intergenic
1174050709 20:47765491-47765513 GAGGGAAGAAAGGAAATTGTGGG + Intronic
1174109134 20:48185801-48185823 AAGGGTGCAAAGGAAGAGGCTGG - Intergenic
1174633403 20:51978111-51978133 GAGAGGAGAAAGGAAGAAACCGG + Intergenic
1174983912 20:55428201-55428223 GAGGGGAGACAGGAAGAGGAAGG + Intergenic
1175017781 20:55810358-55810380 GATGGGAGAAATGAAAATGCAGG - Intergenic
1175281022 20:57804162-57804184 GAGGGCATAAATGAAGCTGCTGG - Intergenic
1175619805 20:60433924-60433946 GAGGTTGGACAGGAAGTTGCTGG + Intergenic
1175962340 20:62643289-62643311 GAGGATGGAAAGGAAGGAGCAGG + Exonic
1177145018 21:17397973-17397995 GAAGGAAGATAGGAAGATGGGGG + Intergenic
1177179863 21:17733479-17733501 GAGGGGAGAAAATAAGATGAAGG + Intergenic
1177400105 21:20592786-20592808 GAGAGGAGAAAGGAAGAAACTGG - Intergenic
1177576565 21:22964241-22964263 GAGGGTAGAAGGGAAAAAACCGG + Intergenic
1178548098 21:33510719-33510741 GAGGAAAGAAAGGCAGATACAGG + Intronic
1178682999 21:34688972-34688994 GAGATTAGAAAGGAAGATCCTGG - Intronic
1178758407 21:35376019-35376041 GAGAGTAGAAAGGTGGTTGCCGG - Intronic
1178878072 21:36427897-36427919 TAGAGTAGAAGGGAAGATGAGGG + Intergenic
1179667769 21:42924342-42924364 GACGGTTGAGAGGAAGAGGCAGG + Intergenic
1181967179 22:26665371-26665393 GAGGGTACAAAGGAAGGTATGGG - Intergenic
1182030175 22:27152900-27152922 GAGGATAGAAAGGCAAATGAGGG - Intergenic
1182178279 22:28316300-28316322 GAGAGGAGAAAGGAAGAAACGGG - Intronic
1182614433 22:31577362-31577384 GATGGTGGGAAGGTAGATGCAGG + Intronic
1183016145 22:34989266-34989288 GAGAGGAGAAAGGAAGCAGCAGG - Intergenic
1183360414 22:37380266-37380288 GAGGTCAGCAGGGAAGATGCAGG + Intronic
1183613057 22:38923698-38923720 GAGGGAAGAAAGGAGGAGGGAGG - Intergenic
1183613072 22:38923747-38923769 GAGGGAAGAAAGGAGGAGGGAGG - Intergenic
1183730470 22:39615642-39615664 GAGGATAGAAAGGAGGACACAGG - Intronic
1183815295 22:40295010-40295032 GAGGATAGAGAGGAAGCAGCTGG + Intronic
1183970507 22:41474038-41474060 GAGGGTCAAAAGGAGGAGGCAGG + Intronic
1183971643 22:41482032-41482054 AAGGGAAGAAAGGATGCTGCTGG - Intronic
1184599738 22:45536237-45536259 GAAAGTAGAATGGAAGGTGCCGG + Intronic
1185367468 22:50443479-50443501 GAGGGTAGAGAGGACCCTGCCGG - Intronic
950235711 3:11318534-11318556 GAGGGGAGACAGGAACATTCAGG - Intronic
951906684 3:27713904-27713926 GAGGGAAAAAAGGAAGAAGGGGG - Intergenic
952061415 3:29515518-29515540 GAAGGAAGAAAGCTAGATGCAGG + Intronic
952088829 3:29859410-29859432 GAGGGTAGAAAGTAAGCAGTTGG + Intronic
953036560 3:39216733-39216755 GAGGGGAGAAATGATGATTCAGG - Intergenic
953214170 3:40902218-40902240 GAGGGCAGACAGCAAGAGGCAGG + Intergenic
953330657 3:42050437-42050459 GAGGGTAGTAAGGGAGAATCAGG - Intronic
953418271 3:42735284-42735306 GAGGGGTGAAGAGAAGATGCAGG + Intronic
953752021 3:45616270-45616292 GAGGTTTGTCAGGAAGATGCTGG - Intronic
955065910 3:55533591-55533613 GAGGTGAGAAAGGAAGGTGATGG + Intronic
955366043 3:58311054-58311076 GAGGGTAGAGAGGATGAAGGAGG - Intronic
956587443 3:70879395-70879417 GAGAGGAGGAAGGAAGAAGCTGG - Intergenic
957211640 3:77266581-77266603 GAAAGAAGAAAGGAAGATGGAGG - Intronic
958029831 3:88095337-88095359 GTGGGGAGAAAGGAAGAGACAGG + Intronic
959016331 3:101138404-101138426 GATGGTAGGAGGAAAGATGCAGG + Intergenic
959579984 3:107973535-107973557 GAGGGAGGAATGGAAGAGGCAGG + Intergenic
961441675 3:126957280-126957302 GAGGGTTAAAAGGATGCTGCTGG + Intronic
961572562 3:127810479-127810501 GAAGGTAGAAAGGGACATTCTGG - Intronic
961806277 3:129491601-129491623 GAGGGTATAAAGACAGATTCTGG - Intronic
961990316 3:131182916-131182938 GAGGGTGGAAGGAAAGAAGCAGG - Intronic
961999229 3:131277702-131277724 GTGGTCAGAAGGGAAGATGCAGG + Intronic
962213790 3:133502289-133502311 GAAGGAAGAAAGAAAGAGGCCGG + Intergenic
962320788 3:134388775-134388797 AAGGGAAGAAAGGAAGAAGATGG + Intergenic
962327444 3:134447658-134447680 GAGGGTAGACAGCCAGATGGAGG + Intergenic
962932087 3:140048070-140048092 GAGGGGAGAAAGGAGGAGGAAGG + Intronic
963239978 3:142993214-142993236 GAAGGTAGAATGGAGGTTGCCGG + Intronic
963836298 3:150061328-150061350 GAGGGCAGAAAGGACACTGCTGG - Intergenic
964434286 3:156635703-156635725 GAGGGAAGAGATGAAGATGGAGG - Intergenic
964728447 3:159839684-159839706 GTGGGTAGGAAGGATGATGCCGG + Intronic
965626430 3:170687500-170687522 GAGGGAAAAAAGGAAGATTTGGG + Intronic
966234505 3:177686083-177686105 GACAGTATAAAAGAAGATGCTGG - Intergenic
966941299 3:184749340-184749362 GAGGGCAGAAAGGAAAAAGAAGG + Intergenic
967003939 3:185365762-185365784 GAATCTAGAAAGGAAAATGCCGG + Intronic
967553749 3:190831028-190831050 GAGGTTAGAAAGGGAAAAGCTGG + Intergenic
967562754 3:190935539-190935561 GAGGATGGAAAGGAAGCTACAGG - Intergenic
969180016 4:5433179-5433201 GAGGATAGAGAGGAAGTTTCTGG + Intronic
969353856 4:6613788-6613810 GAAGGAAGAAAGGAAGAGGGAGG + Intronic
969709984 4:8837190-8837212 GAGGCTGGACTGGAAGATGCTGG + Intergenic
969938021 4:10702257-10702279 AAGGGAAGAAAGGACGTTGCAGG + Intergenic
970418816 4:15885341-15885363 GAGGGCAGGAAGGAAGAAGATGG - Intergenic
971450705 4:26798882-26798904 GAGGGTAGAAGGGGGGATGAGGG + Intergenic
971581852 4:28351820-28351842 GAGTGGAGAAAGGAAGAAACCGG + Intergenic
971833534 4:31731826-31731848 GAAGGAAGGAAGGAAGATGTAGG - Intergenic
972681520 4:41310976-41310998 GAAGGGAGAAAAGAAGATGCTGG + Intergenic
973007418 4:45030020-45030042 GAAGCTATAAAGAAAGATGCAGG + Intergenic
973247859 4:48029429-48029451 GAGGGTAAAAGGGTAGAAGCAGG + Intronic
975080364 4:70271336-70271358 AGGTGTAGAAAGAAAGATGCTGG - Intergenic
976080187 4:81346433-81346455 GAGAGCACAAAGGAAGAAGCTGG - Intergenic
976952950 4:90856119-90856141 GAAGGAAGAAAGGAAGATGGGGG - Intronic
977890139 4:102300082-102300104 AGGGGTAAAAAGGAAGATGTAGG - Intronic
979508353 4:121523908-121523930 GATGAAAGAAAGGTAGATGCTGG - Intergenic
980388808 4:132119762-132119784 GAGGGAAAAAAGGAAGATTTGGG - Intergenic
981091153 4:140733942-140733964 GAAGGAAGAAAGGAAGAGGGAGG - Intronic
981776030 4:148368657-148368679 GTGGGGAGAAAGGAAGCAGCAGG + Intronic
982010631 4:151102629-151102651 GAGGGTAGAAAGGAGGAGGGAGG + Intronic
982328901 4:154159283-154159305 AGGGGAAGGAAGGAAGATGCAGG + Intergenic
983477927 4:168238480-168238502 AAGGGGAGAAAGGAAGAGGAAGG + Intronic
983639600 4:169932827-169932849 GAGGGTGGAAAGGAAAAAGACGG + Intergenic
983890037 4:173021193-173021215 GATGGTAGAAAAAGAGATGCAGG - Intronic
984103307 4:175513925-175513947 GAGGGAAAAAAGGAAGGTGGTGG - Intergenic
984261970 4:177453368-177453390 GAAGGGAGGAAGGAAGAGGCAGG - Intergenic
986294013 5:6422582-6422604 GAGGGAAGGAAGGAAGAGGGAGG + Intergenic
986346847 5:6843748-6843770 GAGGCTAAAAAGGAAGAGGACGG + Intergenic
987312067 5:16690598-16690620 AAGGGTCCAAAGGAAGTTGCAGG - Intronic
987593599 5:19965758-19965780 GCGGGTAGAAAGAGAGAGGCAGG + Intronic
987768418 5:22266965-22266987 TAGCTTAGAAAGGAAAATGCAGG - Intronic
988216278 5:28277689-28277711 GAAGGAAGAAAGGAAGAGGAAGG - Intergenic
988854797 5:35217466-35217488 GAGTTTAGAAAGGAAGCTCCAGG + Intronic
990303350 5:54471490-54471512 GAGAGGAGAAAGGAAGAAACTGG + Intergenic
991608857 5:68429897-68429919 GAGGGTAGAGTGAAAGAAGCGGG + Intergenic
991970953 5:72141187-72141209 GAGGAAAGAAAGAAAGAAGCTGG - Intronic
992123374 5:73616756-73616778 GAGGGGAGAAAGGCTGATTCTGG + Intergenic
992353166 5:75952240-75952262 GAAGGAAGGAAGGAAAATGCAGG - Intergenic
992692184 5:79251663-79251685 AAGGGTAGGAAGGAAGTTGAGGG - Intronic
993027491 5:82663553-82663575 GAGGGTAGAAAAGGAAATGAAGG + Intergenic
993987893 5:94618862-94618884 GAGGCTAGGAAGGAAGCGGCTGG + Intronic
994130790 5:96225239-96225261 GAGGGAAGAAAGGAAAAAGAAGG - Intergenic
994215405 5:97131935-97131957 GAGGGTAGAAATGTGGTTGCTGG + Intronic
994813833 5:104557745-104557767 AAGGGAACAAAGGAAGATGTGGG - Intergenic
996824612 5:127667772-127667794 GAGGGTAGAAAGAAAAAGTCAGG - Intergenic
996879746 5:128282733-128282755 AAGGGTAGAAAGTACAATGCTGG - Intronic
996930148 5:128876713-128876735 GATGGTGGGAAGGAAGAAGCAGG - Intronic
997901225 5:137766750-137766772 GAGGAAAGAAAGGAAGAAGAAGG + Intergenic
997997513 5:138598418-138598440 GGGGGTAGAAAGGAAGGAGGAGG - Intergenic
998075441 5:139232556-139232578 GAGAGGAGAAAGAAAGAAGCTGG - Intronic
998430401 5:142065340-142065362 GAGGGTGGAAAGGCAGAGGAGGG + Intergenic
998810811 5:145964126-145964148 AAGGAAAGAAAGGAAGAGGCCGG - Intronic
999182560 5:149680497-149680519 GAAGGTAGAATGGAAGAGGAAGG + Intergenic
999374400 5:151076704-151076726 GAGGTGAGAAAGGAAGAACCCGG + Intronic
999641602 5:153678556-153678578 GGGGGTAGAAAGGGAGGCGCAGG - Intronic
999692755 5:154162913-154162935 GAGTGCAGGAAGGTAGATGCAGG - Intronic
999757360 5:154674705-154674727 GGGGGAAGAAAGGAAGAAGGTGG + Intergenic
999826791 5:155281281-155281303 GAGGGTAGAAATGAGGAAACAGG + Intergenic
1000551790 5:162675266-162675288 GAGGGTATAAAGGAATATGTGGG - Intergenic
1001210239 5:169804230-169804252 AAGTGTAGAAAGGAAGAGACAGG - Intronic
1001502807 5:172251916-172251938 TAGGATGGAAAGGAAGATGAGGG + Intronic
1001542093 5:172546713-172546735 GAGGGAAGCAAAGGAGATGCTGG + Intergenic
1001635343 5:173206099-173206121 GTGGGCTGAAATGAAGATGCTGG - Intergenic
1002050011 5:176565372-176565394 GAGGGCAGGAAGGAGGAAGCAGG - Exonic
1002591791 5:180295642-180295664 TAGGGGAGAAGGGAAGATGTGGG - Intergenic
1002908382 6:1469315-1469337 GAGTGTAGAAAGGAAGGCGTGGG - Intergenic
1003016013 6:2468122-2468144 GAGGGTAGACAGGGAGAGGAAGG + Intergenic
1003518481 6:6837169-6837191 GAGGGCAGGAAGGAAGAAGGAGG + Intergenic
1003706349 6:8535578-8535600 GAGGGAAGAAGGGGAGATGCAGG - Intergenic
1004071603 6:12303304-12303326 GAGGCTAGACAGGCAGTTGCTGG - Intergenic
1004751448 6:18566056-18566078 GAGGGAAGGAAGGAAGAAGGAGG - Intergenic
1004842862 6:19606664-19606686 GAGGGGAGAAAGAGAGATGGAGG + Intergenic
1004913691 6:20311788-20311810 GAAGGAAGAAAGGAAAATGGGGG - Intergenic
1005365787 6:25075516-25075538 GAGGGAAGAGAGGAAGATGGAGG + Intergenic
1006023215 6:31130182-31130204 AAGGATAGAAAGGAAGAAGGAGG - Intronic
1006539420 6:34727384-34727406 GAGGTTAGAAAGGAATAAGTTGG + Intergenic
1006865148 6:37203382-37203404 GAGGCTGGAGAGGAAGATGCCGG + Intergenic
1007263605 6:40581194-40581216 GAGGATGGAAAGGAGGATGGAGG + Intronic
1007625619 6:43244601-43244623 GAGGGTGGAGAGGGAGAAGCAGG + Intronic
1008029727 6:46680822-46680844 GTGGGAAGAAAGGTAGATGGAGG - Intergenic
1008579909 6:52897553-52897575 TGGGGGAGGAAGGAAGATGCTGG + Intronic
1008960517 6:57261406-57261428 GAGAGCAGAAAGGGAGAAGCTGG - Intergenic
1009349263 6:62653478-62653500 GAGGTTAGAAAGAAAGATGTGGG + Intergenic
1009820697 6:68797433-68797455 GAAGGTAGAGAGAGAGATGCTGG + Intronic
1010053401 6:71535236-71535258 GAGGGCAGAAGGGAAGTTGTAGG + Intergenic
1010061442 6:71627039-71627061 GAGAGTGGAAAGGAATATACTGG - Intergenic
1010185478 6:73138870-73138892 GAGAGGAGAAAGGAACATGAAGG - Intronic
1010410264 6:75553365-75553387 GAAGGAAGAAAGGAAGAGGAAGG + Intergenic
1010851405 6:80782212-80782234 GAGTGTTGAAGGGAAGAAGCCGG - Intergenic
1011219774 6:85042038-85042060 GAGAAGAGAAAGGAAGAGGCAGG - Intergenic
1011236668 6:85226319-85226341 GAGGGTAGAATGGTGGTTGCTGG + Intergenic
1011368013 6:86602508-86602530 GAGGGAAAAAAGGAAGATTTGGG + Intergenic
1011713743 6:90082338-90082360 GAAGGTAGAAATGAAAATACTGG + Intronic
1012083650 6:94793906-94793928 TAGGATAGAAAGAAAGATACAGG - Intergenic
1012652249 6:101769933-101769955 GAGGTTAGACAGGCAGTTGCTGG + Intronic
1013459980 6:110365506-110365528 GAAGGAAGAAAGGAAGAAGGGGG - Intergenic
1013476511 6:110511974-110511996 CAGGGAAGAAAGCAAGATGTAGG - Intergenic
1014165293 6:118217733-118217755 GAGGTCAGAAAGGAAAAAGCAGG - Intronic
1014656209 6:124107718-124107740 GAGGGTAGAATGGTGGTTGCTGG - Intronic
1014834460 6:126145354-126145376 AATGGTAGAAAATAAGATGCAGG + Intergenic
1014849383 6:126322711-126322733 GAGGTTGGACAGGCAGATGCTGG - Intergenic
1014850487 6:126334747-126334769 GAGGTTGGACAGGCAGATGCTGG - Intergenic
1015015566 6:128408633-128408655 TAGGGTAGAAGTGAAAATGCTGG - Intronic
1015138885 6:129907624-129907646 GAAGGTAGAAGTGAAGCTGCAGG - Intergenic
1015389922 6:132670105-132670127 GAGGGGAGGAAGGAAGAGGAGGG + Intergenic
1016204424 6:141454382-141454404 GAGGGAAAGAAGGAAGATTCGGG - Intergenic
1016737279 6:147492872-147492894 TAGAGGAGAAAGGAAGAAGCTGG - Intergenic
1017955992 6:159178170-159178192 GAGGATGGACAGGAAGTTGCTGG - Intronic
1018203658 6:161416971-161416993 GAAAGAAGAAAGGAAGATGGAGG + Intronic
1018205841 6:161436311-161436333 GAGGGCAGAGAGGAGGAGGCGGG + Intronic
1018341885 6:162859543-162859565 CAGGGGAGAAAGGAAGATGAAGG - Intronic
1018351258 6:162961713-162961735 GCGGGTAGAAATGAAGATGGTGG - Intronic
1020879829 7:13746218-13746240 GAGGATATAAAGGATGATGATGG - Intergenic
1020952066 7:14692293-14692315 GAGAGAAGGAGGGAAGATGCAGG - Intronic
1021271467 7:18592147-18592169 GAAGGAAGAAAGGAAGATAAGGG + Intronic
1021283108 7:18745175-18745197 GAGGGAAGGAATGAAGATGAAGG + Intronic
1021869089 7:24985926-24985948 GAGGTAATAAAGGAAGAAGCAGG - Intergenic
1022149151 7:27581386-27581408 GAGGGTAGAGATAAAGAAGCAGG + Intronic
1022301067 7:29103042-29103064 GAGGGTGGAAAGGAAGACTCAGG - Intronic
1022565264 7:31393387-31393409 GAGGTTGGAAAGGCAGTTGCTGG - Intergenic
1022647402 7:32244178-32244200 GATGGTAGAAAAGAAGAGGGCGG + Intronic
1022663664 7:32388566-32388588 GATGCTAGAAAGGATGAGGCAGG + Intergenic
1022882274 7:34600509-34600531 GATGGAAGAAAGGAAGAGACTGG - Intergenic
1023744007 7:43304992-43305014 GAGGCCAGAGAGGAAGCTGCGGG + Intronic
1024677025 7:51646149-51646171 GAGGGGAGACAGGCAGGTGCAGG + Intergenic
1024973784 7:55094617-55094639 GAAGTTAGAAAGGAAGTTGCTGG - Intronic
1026379866 7:69788344-69788366 GAGGGTGCAAAGGAAGAAGGTGG + Intronic
1026848739 7:73712010-73712032 GAGGGTCCAGAGGAGGATGCGGG - Intronic
1026877982 7:73890615-73890637 GACGGGAGGAAGGAGGATGCTGG - Intergenic
1026981696 7:74530439-74530461 GAGGATTGAATGGAAAATGCAGG + Intronic
1027230438 7:76268825-76268847 GAGGGTAGCATGGCAGAGGCTGG + Intronic
1027530045 7:79319143-79319165 GAGGGTAGATAGTCAAATGCAGG - Intronic
1028280818 7:88925749-88925771 GAGAGTAGAAAGGATGGTGCAGG + Intronic
1028455606 7:91035140-91035162 GAGGGTAGACAGGGAGAAGTGGG - Intronic
1028467003 7:91163739-91163761 GAGGGAGGAAAGGAAGTTGTTGG - Intronic
1029615226 7:101652262-101652284 GAAGGGAAAAAGGAAGAGGCTGG + Intergenic
1029818537 7:103122440-103122462 GAGGGCAGATGGGGAGATGCTGG + Intronic
1030254199 7:107489333-107489355 GATGGTTGAAAAGAAAATGCAGG + Intronic
1030633539 7:111922272-111922294 GAGGGTAGAAATGAAAAAGAAGG - Intronic
1030965030 7:115981129-115981151 GAGGTTAGAAAGGAGGATTAGGG - Intronic
1030985604 7:116238280-116238302 GAGAGGTGAATGGAAGATGCCGG + Intronic
1031420031 7:121540262-121540284 GAGGGTAGAAAGGTAGCTATTGG + Intergenic
1031755682 7:125638891-125638913 GAGGGTAAGAGGGATGATGCTGG - Intergenic
1031757354 7:125661751-125661773 GAGAGGAGAAAGGAAGAAACTGG + Intergenic
1032910793 7:136427416-136427438 GAGGGTACAGAGGAACATTCAGG - Intergenic
1032982995 7:137306377-137306399 GAGGGTAGAAAGAAGGATAAAGG + Intronic
1034412721 7:150949727-150949749 CAGGGTAGAAAGGAAGTGGGGGG + Intronic
1034474911 7:151276468-151276490 GAGGGAAGGAGGGGAGATGCAGG + Intronic
1034734741 7:153418189-153418211 GATGGAAGAAATGAAGATGATGG + Intergenic
1035656182 8:1307831-1307853 GAAAGTAGAAAGGAGGCTGCCGG + Intergenic
1036150060 8:6288739-6288761 GAGGACAAGAAGGAAGATGCAGG - Intergenic
1036525022 8:9526999-9527021 AAAGGCAGAAGGGAAGATGCAGG + Intergenic
1036824375 8:11964929-11964951 GAGGCTGGACAGGAAGCTGCCGG + Intergenic
1037604465 8:20425727-20425749 CTGGGAAGAAAGGAAGTTGCTGG + Intergenic
1037775814 8:21834933-21834955 GAGGAAAGAAAGGAACATTCTGG + Intergenic
1038412523 8:27369223-27369245 GAGGGTAGAAGGTAAGCTGTAGG - Intronic
1038994530 8:32906844-32906866 GAGAGTAGGAAGGAAGAATCAGG - Intergenic
1039548414 8:38426274-38426296 GAGGGTCCAGAGGAAAATGCAGG + Intronic
1040441266 8:47445436-47445458 GAGGAGAGAAAGTAAGATGGGGG - Intronic
1041798992 8:61777655-61777677 GAGGTTAGACAGGCAGATGCTGG + Intergenic
1042031441 8:64480145-64480167 GAGGGCAGAAAAGAGGAAGCAGG - Intergenic
1042170443 8:65985814-65985836 GAGGAGAGAGAGGAAGAGGCAGG - Intergenic
1043602036 8:81952521-81952543 GAGGGAAGAAGGGAGGATGATGG - Intergenic
1044759507 8:95503142-95503164 GAGGGAAGAAAGGAGAATGGAGG - Intergenic
1045341609 8:101259975-101259997 GAGGGGAGAAAGGAAATTGAGGG - Intergenic
1045402333 8:101831700-101831722 CTGGGTAGAAGGGAAGATGCTGG - Intronic
1045492043 8:102677360-102677382 GGTGGTGGAAAGGAAGGTGCTGG - Intergenic
1045750881 8:105482934-105482956 GAGGGAAGAAAGGAAGAGAAGGG - Intronic
1045778312 8:105833212-105833234 GTGGAAAGAAAGGAAGAGGCAGG + Intergenic
1046752538 8:117940787-117940809 GTGGGTACAATGGAAGCTGCTGG + Intronic
1046932112 8:119852085-119852107 GAGGAAAGAAGGGAAAATGCTGG - Intronic
1048177544 8:132166429-132166451 GAGGGGGTACAGGAAGATGCTGG - Intronic
1048544108 8:135370081-135370103 GATGAAAGAAAGGAAGATGGAGG + Intergenic
1048970136 8:139640744-139640766 GGCGGTAGAAATGAAGATGGTGG - Intronic
1048989244 8:139751696-139751718 GATGGTAGATGGGTAGATGCTGG - Intronic
1049159076 8:141085936-141085958 AAAGGTAGACAGGTAGATGCAGG - Intergenic
1049361143 8:142213056-142213078 GAGGGGAGACAGGAAGGTGGAGG - Intronic
1049800504 8:144515473-144515495 GAGGGTAGAATGGGAGCTCCAGG + Intronic
1050789412 9:9447513-9447535 GAGGGTAGGAAGTAAGAGGGAGG + Intronic
1051222714 9:14867158-14867180 TGGGGTCGAAAGGAAAATGCAGG - Intronic
1051561138 9:18441517-18441539 GGGGATAGAAAGGAAGATCTGGG + Intergenic
1051582339 9:18690769-18690791 GAGGCCAGAAAGGAAGGTGTTGG - Intronic
1052390497 9:27873363-27873385 GAAGGTAGAAAATTAGATGCCGG - Intergenic
1052680972 9:31692110-31692132 GAGAGTTGAAAAGAAGATACGGG + Intergenic
1052764319 9:32625317-32625339 CAGAGGAGAAAGGAAGAGGCTGG - Intergenic
1054783990 9:69192890-69192912 GAAGGAAGAAAGGAAGACCCTGG - Intronic
1055749216 9:79486367-79486389 GAGGGAAGGAAGGAAGAGGGAGG - Intergenic
1056431445 9:86532378-86532400 CAGGGCAGAAAGGAACAGGCAGG - Intergenic
1056490142 9:87098247-87098269 GAAGGTAGAGAGACAGATGCCGG - Intergenic
1056808272 9:89745130-89745152 CAAGGTAGAAAGGTAGAAGCTGG - Intergenic
1056861522 9:90188871-90188893 GAGGGTAGAGAGGGACAGGCAGG - Intergenic
1057064721 9:92038117-92038139 GAGGGTAGAAAGGAAGATGCTGG - Intronic
1057802134 9:98197085-98197107 GAGGGGAGAAAGGAGGAAGAAGG + Intergenic
1057813876 9:98279729-98279751 GAGGGAAGAAAGGAGGAGGGAGG - Intergenic
1058116057 9:101085413-101085435 GAGGTCAGTAAGGAAGATGAAGG + Intronic
1058483658 9:105422093-105422115 GAGGATAAAAAGGAAGTTGGTGG - Intronic
1059571155 9:115437689-115437711 GAGGGGAGAAGGGTAGAAGCAGG - Intergenic
1060033769 9:120237376-120237398 GAGGTTAGAAATGACGATGCAGG - Intergenic
1060179156 9:121520562-121520584 GAGAGGAGAAAGGAAGAAACTGG - Intergenic
1060335606 9:122718969-122718991 GAGAGTAGAAAGGGAGAAGCTGG + Intergenic
1060683481 9:125586341-125586363 GAGGGCAGAGTGGAAGACGCAGG - Intronic
1060760468 9:126243392-126243414 GAAGGAAGAAAGGAAGATTGTGG - Intergenic
1060762247 9:126264600-126264622 GATGGAAAAAAGAAAGATGCAGG - Intergenic
1061045518 9:128162971-128162993 GAGAGAGGAAAGGAAGAGGCAGG + Intronic
1062069440 9:134547670-134547692 GAGGGGAGAAATGACGAGGCTGG - Intergenic
1062097877 9:134712163-134712185 GAGGGGGGAAAGGAAGAAGATGG - Intronic
1062097886 9:134712193-134712215 GAGGGGGGAAAGGAAGAAGGGGG - Intronic
1062226603 9:135455866-135455888 GAGGGTGGGAAGGAGGAAGCTGG + Intergenic
1062669230 9:137696868-137696890 GAGGAAAGGAAGGAAGACGCAGG - Intronic
1185834169 X:3329441-3329463 GAGGGAAGGAAGGAAGATGAAGG + Intronic
1186312780 X:8338800-8338822 GTGGGGAGAAATGCAGATGCAGG - Intergenic
1187562876 X:20418946-20418968 GAGGGAACAAAGGAAGAAGCTGG + Intergenic
1187616714 X:21002872-21002894 AAGAGCCGAAAGGAAGATGCAGG - Intergenic
1188005225 X:25012246-25012268 GAGAGTAGAAGGGGAGATTCTGG + Intronic
1188201170 X:27294037-27294059 GAGGGTAGAAACATGGATGCGGG + Intergenic
1189439137 X:41018805-41018827 CTGGGAAGAAAGGAAGAAGCAGG + Intergenic
1191021057 X:55860415-55860437 GAGGTTAAACAGGCAGATGCTGG + Intergenic
1192183634 X:68931345-68931367 GAGGAGAGGAAGAAAGATGCAGG + Intergenic
1192184884 X:68940295-68940317 GAGGGTAGAGAATTAGATGCTGG - Intergenic
1193089458 X:77478403-77478425 GAGAGTAGAAAGGAAGAATCAGG - Intergenic
1194022355 X:88707672-88707694 GAGGGTAGAAAGTGAGAGGAGGG - Intergenic
1194921454 X:99771392-99771414 GAGGGAAGGAAGGAAGAGGAAGG + Intergenic
1195455640 X:105066142-105066164 GAGGACAGAAAGGAAAATGTTGG - Intronic
1195697691 X:107678950-107678972 GAGGTTACCAAGGAAGGTGCTGG + Intergenic
1196362856 X:114887177-114887199 GAGGTTAGACAGGTAGTTGCTGG + Intronic
1197312855 X:124927584-124927606 GGGGGAAGAGAGAAAGATGCTGG + Intronic
1197330646 X:125150121-125150143 GAAGGAAGAAAGGAAGATAATGG + Intergenic
1198115138 X:133537402-133537424 GAGGGAAGGAAGGAAGAGGAAGG + Intronic
1199672056 X:150155641-150155663 GAGGGCAGGCAGGAAGAGGCAGG + Intergenic
1200037734 X:153344320-153344342 GAGGGTAGGAAGGCAGCAGCTGG - Intronic
1200204774 X:154307972-154307994 GAGGGTAGGAAGCAAGAAGCAGG + Intronic