ID: 1057067998

View in Genome Browser
Species Human (GRCh38)
Location 9:92073105-92073127
Sequence CTCTCAAAGGGGAAATTGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 582
Summary {0: 1, 1: 1, 2: 7, 3: 86, 4: 487}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057067998_1057068006 -6 Left 1057067998 9:92073105-92073127 CCCAGCAATTTCCCCTTTGAGAG 0: 1
1: 1
2: 7
3: 86
4: 487
Right 1057068006 9:92073122-92073144 TGAGAGGTGGCAGGAGCCGAAGG No data
1057067998_1057068007 5 Left 1057067998 9:92073105-92073127 CCCAGCAATTTCCCCTTTGAGAG 0: 1
1: 1
2: 7
3: 86
4: 487
Right 1057068007 9:92073133-92073155 AGGAGCCGAAGGAAAAGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057067998 Original CRISPR CTCTCAAAGGGGAAATTGCT GGG (reversed) Intronic
900722600 1:4187160-4187182 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
900847409 1:5114935-5114957 CTTTTTAAGGGTAAATTGCTGGG - Intergenic
901146971 1:7071765-7071787 CTCTAAAAGTGGAAATGCCTGGG + Intronic
902050805 1:13562341-13562363 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
902156186 1:14488418-14488440 GGCTCTAAGGTGAAATTGCTTGG + Intergenic
902970480 1:20044641-20044663 CTCTTTAAGAGGAAATTGTTGGG + Intronic
903396087 1:23002878-23002900 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
904315575 1:29658154-29658176 CTCTCAAATGGGGAGTTTCTGGG - Intergenic
904711579 1:32434128-32434150 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
905429220 1:37909460-37909482 CTCTCTGAGAGGAAATTGTTGGG - Intronic
905499725 1:38426897-38426919 CTTTTTAAGGGTAAATTGCTGGG - Intergenic
906049454 1:42858329-42858351 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
906080863 1:43087290-43087312 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
906378664 1:45317415-45317437 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
906814852 1:48868169-48868191 CTCTCAAAATGGAATTTGTTTGG - Intronic
907293538 1:53434031-53434053 TTCTCTAAGAGGAAATTGTTGGG - Intergenic
909014656 1:70369178-70369200 CTCTTTAAGAGGAAATTGCTGGG - Intronic
909551079 1:76898701-76898723 CTTTTTAAGAGGAAATTGCTGGG + Intronic
909707092 1:78598466-78598488 CCCTCTGAGGTGAAATTGCTAGG + Intergenic
909729327 1:78873721-78873743 CTCTCTAAGAGAAAATTGTTGGG - Intergenic
910002802 1:82358786-82358808 CTCTTTAAGAGGAAATTGTTGGG + Intergenic
910049324 1:82957122-82957144 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
910335378 1:86122875-86122897 TTCTCAAAGGGGAATTTTGTAGG - Intronic
910746417 1:90579840-90579862 CTCTCAAAGTTGAAACTCCTAGG + Intergenic
911071013 1:93831840-93831862 CTCTTTAAGAGGAAATTGTTGGG - Intronic
911148100 1:94571102-94571124 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
911510674 1:98805173-98805195 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
911966821 1:104381634-104381656 CTCTCAAAGAGGAAATTGTTGGG - Intergenic
912815371 1:112824418-112824440 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
912984587 1:114414627-114414649 TACTCAAAGGGGAAATTGTAAGG - Intronic
913245070 1:116863916-116863938 CTCTTTAAGAGGAAATTGTTGGG - Intergenic
913366213 1:118042229-118042251 ATCTCAAAGGGGGAATTGACAGG - Intronic
916229422 1:162525285-162525307 CTCTCAAAAAGAAAATTTCTAGG - Exonic
916570460 1:166021452-166021474 CTCCCAAAGTGGAGATTGCTGGG + Intergenic
916929447 1:169560300-169560322 CTCTCAAACAGGAATTTGCCTGG + Intronic
916941732 1:169684647-169684669 CTCTTTAAGAGGAAATTGTTGGG - Intronic
917749584 1:178041768-178041790 CTCTTTAAGAGGAAATTGTTGGG - Intergenic
917878519 1:179309390-179309412 TTCTTAAAAGTGAAATTGCTAGG + Intronic
918567730 1:185952194-185952216 CTTTTTAAGGGTAAATTGCTGGG + Intronic
919090986 1:192979031-192979053 CTCTTTAAGAGGAAATTGTTGGG + Intergenic
919956720 1:202424616-202424638 CTCTTAAAAGAGAAACTGCTGGG - Intronic
920907952 1:210189089-210189111 CTCTTTAAGAGGAAATTGTTGGG - Intergenic
921655182 1:217726403-217726425 CAATAAAAAGGGAAATTGCTTGG + Intronic
922046321 1:221949373-221949395 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
922363609 1:224844391-224844413 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
922368382 1:224886884-224886906 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
922598921 1:226835047-226835069 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
922845516 1:228681215-228681237 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
922934767 1:229414200-229414222 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
923214253 1:231834132-231834154 CTTTTTAAGAGGAAATTGCTGGG + Intronic
924953208 1:248904843-248904865 ATGTCAAAGTGGAAAGTGCTAGG - Intergenic
1062930692 10:1350528-1350550 CTTTTTAAGAGGAAATTGCTGGG - Intronic
1063363055 10:5472579-5472601 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1064123596 10:12640128-12640150 TTCTAAGAGGAGAAATTGCTGGG - Intronic
1064312706 10:14225906-14225928 ATCTCAAAGGGGTCATTTCTTGG + Intronic
1065437575 10:25718221-25718243 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1065443242 10:25773102-25773124 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
1065610480 10:27466900-27466922 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1065721834 10:28635168-28635190 GTCACAAAGAGGAAACTGCTTGG + Intergenic
1066437417 10:35407157-35407179 CTCTTTAAGAGGAAATTGTTGGG + Intronic
1067360340 10:45572991-45573013 CTTTTTAAGAGGAAATTGCTGGG - Intronic
1067755642 10:49002280-49002302 CTCTCAAATGTCAAAGTGCTCGG - Intergenic
1067940814 10:50654103-50654125 CTCTCATGGGGGAAAATGTTGGG + Intergenic
1070252850 10:74788052-74788074 CTCCCAAAGTGCAAAGTGCTAGG - Intergenic
1070269582 10:74939846-74939868 CTCTTACAAGTGAAATTGCTGGG - Intronic
1070280956 10:75048104-75048126 TTTTTAAAGGTGAAATTGCTGGG + Intronic
1071187173 10:83058929-83058951 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1071342142 10:84659043-84659065 CTCTCAAAGGCCAAATTCATGGG - Intergenic
1071550850 10:86565168-86565190 CTCTTTAAGAGGAAATTGTTGGG + Intergenic
1071821682 10:89286475-89286497 CTTTTTAAGAGGAAATTGCTGGG - Intronic
1072827071 10:98618090-98618112 AACTCAAAGGGCACATTGCTGGG + Intronic
1072946222 10:99812275-99812297 CTCTGGAAAGGGAAACTGCTGGG - Intronic
1073143246 10:101262484-101262506 CTCTCCCAGGGGGAAATGCTGGG + Intergenic
1073306638 10:102508086-102508108 CTCTCAAATAGCAAATAGCTGGG + Intronic
1073394520 10:103207004-103207026 CTCTCTAAGAGGAAATCGTTGGG - Intergenic
1073639740 10:105239711-105239733 CTCTGAAAGGCCAATTTGCTGGG + Intronic
1073683477 10:105729152-105729174 CTCTTTAAGAGGAAATTGTTGGG - Intergenic
1073933157 10:108599613-108599635 CTCTTCAAGAGGAAATTGTTAGG - Intergenic
1073974153 10:109081272-109081294 CTCTCAAAGCGCAAAGTGCTGGG + Intergenic
1074018970 10:109564138-109564160 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1074197895 10:111205463-111205485 CTCTCCAAGGAGAATTTACTTGG - Intergenic
1077612127 11:3649718-3649740 CTTTTTAAGAGGAAATTGCTGGG - Intronic
1077679178 11:4223516-4223538 TTCTCTAAGAGGAAATTGTTGGG + Intergenic
1077688614 11:4320158-4320180 TTCTCTAAGAGGAAATTGTTGGG + Intergenic
1079727128 11:23891084-23891106 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1080227302 11:29975198-29975220 CTCTTTAAGTGGAAATTGCTGGG - Intergenic
1083534355 11:63454699-63454721 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1084353996 11:68624670-68624692 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1085570130 11:77551712-77551734 CTCTGTAAGAGGAAATTGTTGGG - Intronic
1085934210 11:81123631-81123653 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1086004961 11:82027003-82027025 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1086125365 11:83344018-83344040 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1086134899 11:83435519-83435541 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1086136329 11:83446826-83446848 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1086371278 11:86157957-86157979 CTGTCAAATGGGAGATTTCTAGG - Intergenic
1086550150 11:88044965-88044987 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1087099044 11:94347502-94347524 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1087873747 11:103331036-103331058 CTCTCAGAGATGAAATTGCAGGG + Intronic
1089114612 11:116084550-116084572 TTCTTAAAGGGGAAATTAATTGG - Intergenic
1089953196 11:122548377-122548399 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1089987380 11:122826436-122826458 CTTTTTAAGAGGAAATTGCTAGG - Intergenic
1090588879 11:128243720-128243742 TTCTCAAATGGAACATTGCTTGG - Intergenic
1090768507 11:129897434-129897456 CTCTCAAAGGGGAAGATCCTGGG - Intergenic
1090872015 11:130757402-130757424 CTTTTTAAGGGTAAATTGCTGGG + Intergenic
1091183615 11:133628601-133628623 CTGTTTAAGAGGAAATTGCTGGG - Intergenic
1092416233 12:8292462-8292484 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1093024267 12:14232359-14232381 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1093812897 12:23509933-23509955 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1093951014 12:25164940-25164962 CTTTTTAAGAGGAAATTGCTGGG - Intronic
1094316114 12:29138932-29138954 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1094400607 12:30057765-30057787 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1094825702 12:34267443-34267465 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1095637598 12:44451586-44451608 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1095999139 12:48114386-48114408 CTCTCTAAGAGGAAATTTTTGGG + Intronic
1097592327 12:61588676-61588698 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1098629009 12:72705166-72705188 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1098653883 12:73005890-73005912 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1098919847 12:76293245-76293267 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1099872684 12:88369120-88369142 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1100486595 12:95034562-95034584 TTCTTAGAGGTGAAATTGCTGGG - Intronic
1102604363 12:114057283-114057305 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1103105542 12:118221482-118221504 CTCCCAAAGTGCAAAGTGCTGGG + Intronic
1103159529 12:118717005-118717027 TTCACAAAGGGGAAATTGTGAGG + Intergenic
1105032111 12:132891132-132891154 CTCTCTAAGAGGAAATTGTTGGG - Intronic
1105962456 13:25354553-25354575 CTCCCAAAGTGCAAAGTGCTGGG - Intergenic
1106280003 13:28258595-28258617 CTGTGAAAGGGGAAATTCTTTGG + Intronic
1106533793 13:30619530-30619552 CTCTCAAATGGGAAACTAGTAGG - Intronic
1108202642 13:48058181-48058203 CTTTTTAAGAGGAAATTGCTGGG - Intronic
1108282128 13:48871055-48871077 CTCTTTAAGCGGAAATTGTTGGG + Intergenic
1108803933 13:54131612-54131634 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1109022344 13:57114437-57114459 CTCCCAAAGTGCAAAGTGCTGGG - Intergenic
1109451389 13:62519199-62519221 CTCTGACAGGGGAAATTACTAGG - Intergenic
1110395749 13:75027996-75028018 CTCTGAAAGGGGAATTATCTTGG + Intergenic
1110650583 13:77937604-77937626 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
1110978431 13:81867955-81867977 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1111362172 13:87190357-87190379 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1112603057 13:100875902-100875924 CACTAAAAAGGGAAATTCCTGGG + Intergenic
1112889375 13:104211982-104212004 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1113421292 13:110173524-110173546 CCCTCAAATGGGGAAATGCTGGG + Intronic
1113846632 13:113395444-113395466 TTCTCAAAGCTGGAATTGCTGGG + Intergenic
1114771108 14:25429612-25429634 CTCTGTAAGAGGAAATTGTTGGG + Intergenic
1116045357 14:39736161-39736183 TTTTCAAAGGGGATGTTGCTAGG + Intergenic
1116490647 14:45499315-45499337 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1116703345 14:48266267-48266289 CTTTTTAAGGGTAAATTGCTGGG + Intergenic
1117578874 14:57130485-57130507 GTCTCACAGGAGAAATTGGTTGG - Intergenic
1117628292 14:57663136-57663158 CACTCAAAGGGGCAATTGAATGG - Intronic
1117957975 14:61137355-61137377 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1118296486 14:64574739-64574761 CTCTCAAAGGAGACATTACAAGG - Intronic
1118937356 14:70300088-70300110 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
1119022373 14:71126110-71126132 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1119560396 14:75584933-75584955 CTCTTTAAGAGGAAATTGTTGGG + Intronic
1120618199 14:86733125-86733147 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1120660016 14:87238934-87238956 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1121289304 14:92761303-92761325 CTCTTGAAGAGGAAATCGCTGGG - Intergenic
1121980642 14:98451056-98451078 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1122022868 14:98853899-98853921 CTCTCAGAGGGGTTATTGCTTGG + Intergenic
1122381381 14:101309575-101309597 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1124018907 15:25902412-25902434 CTCCCAATGAGGAAATTGTTGGG + Intergenic
1125629114 15:41132953-41132975 CTCTCTTAGAGGAAATTGTTGGG - Intergenic
1125849031 15:42886333-42886355 CTCTTTAAGAGGAAATTGTTGGG - Intronic
1126530213 15:49703042-49703064 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1127050872 15:55082405-55082427 GTCTTAGAGGTGAAATTGCTAGG - Intergenic
1128617701 15:69122867-69122889 TTCTCAAAAGTGGAATTGCTGGG - Intergenic
1129950492 15:79584717-79584739 GTGTCAAAGAGGAAATTGCAAGG - Intergenic
1130304495 15:82704032-82704054 CTCTTTAAGAGGAAATTGTTGGG - Intronic
1130860709 15:87886289-87886311 CTCCTAGAGGTGAAATTGCTGGG - Intronic
1131053655 15:89363281-89363303 CTCTGAAATGGGAAGTTGTTGGG + Intergenic
1131160200 15:90100794-90100816 TTATGAATGGGGAAATTGCTTGG - Intronic
1131164805 15:90134603-90134625 CTCTTTAAGAGGAAATTGTTGGG - Intergenic
1131447683 15:92513301-92513323 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1131621125 15:94069274-94069296 CTCTCAAAGGGAAAACTGTCCGG - Intergenic
1131684122 15:94752557-94752579 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1132956520 16:2597199-2597221 TTCTGAAAGGTGAAATTCCTTGG + Exonic
1133869655 16:9675387-9675409 CTCTCTAAGAGGAAATTGTTGGG + Intronic
1134072276 16:11267938-11267960 CACCCAAAGGAGAAAATGCTAGG - Exonic
1136230523 16:28882985-28883007 CTCTCAAAGGGGAAGGAGCGAGG + Intronic
1136529898 16:30860995-30861017 CTCTCTAAGAGGAAATTGTTGGG - Intronic
1137363376 16:47840320-47840342 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1138496765 16:57413620-57413642 CTTTCAAAGGGGACATTTCTTGG - Intronic
1138759159 16:59521534-59521556 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1138804893 16:60080650-60080672 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1140148285 16:72333572-72333594 CTCCCAAAGTCGAAAGTGCTTGG + Intergenic
1141197531 16:81871854-81871876 GTCTCAATGGAGGAATTGCTGGG + Intronic
1141404901 16:83784149-83784171 TTCTCAAAAGGTAAATTGCAAGG - Intronic
1142649954 17:1342428-1342450 CACTGAAAGGGGAAACTGGTGGG - Intergenic
1143414448 17:6735864-6735886 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
1144122318 17:12167111-12167133 ATCACAAAGGGGATAGTGCTAGG + Intergenic
1145080730 17:19892362-19892384 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
1145773786 17:27512222-27512244 CTCTGAAGGAGGAAATGGCTTGG - Intronic
1146429166 17:32774148-32774170 CTCTTTAAGAGGAAATTGTTGGG - Intronic
1146492950 17:33295155-33295177 ATTTCAAGGGGGAAATAGCTAGG - Intronic
1147912983 17:43868621-43868643 CTCTCTACGGGAAACTTGCTTGG + Intergenic
1149178726 17:53907258-53907280 GTGTCAAAGTGAAAATTGCTTGG - Intergenic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1150860548 17:68796516-68796538 CTCTTTAAGAGGAAATTGTTGGG + Intergenic
1152453841 17:80401352-80401374 CTCTCTATGAGGAAATTGTTGGG - Intergenic
1153698214 18:7665240-7665262 CCCTCATAAGGAAAATTGCTTGG - Intronic
1155148695 18:23105318-23105340 CACTTTAAGGGGAAATTGATGGG - Intergenic
1155173762 18:23285836-23285858 CTTTTTAAGAGGAAATTGCTGGG - Intronic
1155961889 18:32002049-32002071 CTCTCCAAGAGGAAATTGTTGGG - Intergenic
1156251990 18:35360242-35360264 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1156259617 18:35432803-35432825 CTCTCATGGGGCAACTTGCTTGG - Intergenic
1156294552 18:35777599-35777621 CTCTCACAGGGCAACTTGGTTGG - Intergenic
1156302188 18:35845672-35845694 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1156590500 18:38482680-38482702 CCCCCAAAGGGGAATTTGCAGGG + Intergenic
1156612043 18:38736308-38736330 TTCTCAAAGAGGTCATTGCTGGG + Intergenic
1156958122 18:42992676-42992698 CTTTTTAAGAGGAAATTGCTGGG - Intronic
1157927898 18:51786150-51786172 ATCTCAAAGCTGAAAATGCTGGG - Intergenic
1158576758 18:58644883-58644905 CTCTTTAAGAGGAAATTGTTGGG + Intergenic
1158819393 18:61141917-61141939 GCCTCAAAGGGGAAACTGCTGGG + Intergenic
1159929156 18:74294251-74294273 CTCTTTAAGAGGAAATTGTTGGG - Intergenic
1159963411 18:74573564-74573586 CTCTTTAAGGGAAAATGGCTGGG - Intronic
1161711980 19:5853891-5853913 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1162286556 19:9743270-9743292 CTCTCTAAGAGAAAATTGTTGGG - Intergenic
1162331491 19:10032611-10032633 CTCTCGAAGGGGAAATTGCTGGG + Intergenic
1163169022 19:15517900-15517922 CTCTGAGACGGGAAGTTGCTTGG + Intronic
1163209531 19:15830248-15830270 CTCTCTATGAGGAAATTGTTGGG - Intergenic
1163487226 19:17595212-17595234 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1163900333 19:20094894-20094916 CTCTCTAAGAGGAAATTGTTGGG + Intronic
1164004145 19:21133703-21133725 CTCTCTATGAGGAAATTGTTGGG + Intergenic
1164202554 19:23030722-23030744 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1166651729 19:44580311-44580333 GTCTTAAAGGGGAAGTTGCAGGG - Intergenic
1166916940 19:46201890-46201912 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
1166927201 19:46277244-46277266 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1167099356 19:47394490-47394512 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1167901003 19:52622195-52622217 TTCTCAAAGAGGAAATTGTTGGG - Intronic
1168051534 19:53833081-53833103 CTCTCTAAGAGGAAATTCTTGGG - Intergenic
1168212174 19:54898821-54898843 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1168228042 19:55010670-55010692 CTTTCTAAGAGTAAATTGCTGGG + Intergenic
1168248080 19:55124342-55124364 CTCTTTCAGAGGAAATTGCTGGG - Intergenic
925433908 2:3819805-3819827 CTCTTTAAGAGGAAATTGTTGGG + Intronic
927134105 2:20084124-20084146 CTCTTTAAGAGGAAATTGTTGGG - Intergenic
928779735 2:34804785-34804807 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
929004892 2:37384900-37384922 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
930099183 2:47589936-47589958 CTCTCTAAGAGGAAATTTTTGGG + Intergenic
931608987 2:64079095-64079117 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
931845985 2:66204289-66204311 CTCACAAATGGGAAGTTGATAGG - Intergenic
932159522 2:69447581-69447603 CTTTCTAAGAGGAAATTTCTGGG + Intergenic
933137873 2:78759682-78759704 CTCTTTAAGAGGAAATTGTTGGG - Intergenic
933179823 2:79215737-79215759 CTTTTTAAGAGGAAATTGCTGGG + Intronic
933326553 2:80844999-80845021 CTCTCAATGGGGAAAATGACAGG + Intergenic
933392193 2:81685302-81685324 ATATCAGAGGGGAAATTGCAGGG - Intergenic
933552450 2:83792810-83792832 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
936794351 2:116188157-116188179 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
937809562 2:126184499-126184521 ATTTTCAAGGGGAAATTGCTGGG + Intergenic
938364761 2:130726256-130726278 CTCCCAAAGTGCAAAGTGCTGGG + Intergenic
939083197 2:137686863-137686885 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
939307352 2:140427935-140427957 CTTTTTAAGAGGAAATTGCTGGG - Intronic
939326215 2:140692371-140692393 CTCTAAAAGTGTGAATTGCTAGG + Intronic
939460789 2:142493761-142493783 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
940107288 2:150114393-150114415 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
940118524 2:150237065-150237087 CTCCCAAAGTGCAAAGTGCTGGG + Intergenic
940216751 2:151310614-151310636 CTCTCTCAGAGGAAATTGCTGGG - Intergenic
940508853 2:154587155-154587177 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
940726499 2:157342035-157342057 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
941598609 2:167510158-167510180 CTTTCAAAGGGAAGAATGCTTGG - Intergenic
942097028 2:172543530-172543552 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
943461252 2:188173123-188173145 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
943475045 2:188343923-188343945 CTCTCAAATAGCAAATAGCTGGG + Intronic
943835344 2:192509267-192509289 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
943951354 2:194134816-194134838 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
944250969 2:197579920-197579942 CTCTTTAAGAGGAAATTGTTGGG - Intronic
945173396 2:207019025-207019047 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
945301542 2:208220163-208220185 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
945376048 2:209079879-209079901 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
945858059 2:215091370-215091392 CTCTCTAAGAGGAAATTATTGGG - Intronic
946722481 2:222625017-222625039 ATCTGAAAGGGAAAATTGTTTGG - Intronic
946871821 2:224091777-224091799 CTCTTTAAGAGGAAATTGTTGGG + Intergenic
948957141 2:241302301-241302323 CTCCCAAAGTGCAAAGTGCTGGG - Intronic
1168739284 20:174300-174322 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1168943381 20:1731995-1732017 CGCTCTAAGAGGAAATTGTTGGG + Intergenic
1170680502 20:18521535-18521557 CTCTTTAAGAGGAAATTGTTGGG + Intronic
1172651291 20:36503743-36503765 CTCCCAAAGTGCAAAGTGCTGGG + Intronic
1173651914 20:44671804-44671826 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1173781617 20:45761234-45761256 CTCTCTAAGAGGAAATTGCTGGG - Intronic
1177063079 21:16397263-16397285 CTCTTTAAGAGGAAATTGTTGGG + Intergenic
1177119505 21:17123270-17123292 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1177840804 21:26231959-26231981 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1177948871 21:27508704-27508726 CAATCAAAGGAGAAATGGCTTGG + Intergenic
1179015347 21:37590939-37590961 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1179650429 21:42804953-42804975 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1179936493 21:44608846-44608868 CTCCCAAAAGTGGAATTGCTTGG - Intronic
1180560847 22:16613078-16613100 TTCTCTAAGAGGAAATTGTTGGG - Intergenic
1180990742 22:19934232-19934254 CTCTAAAAGGAGAAACTGCAGGG + Intronic
1181002380 22:19993952-19993974 CTCTCACAGGACAAACTGCTGGG + Intronic
1181901902 22:26163057-26163079 ATCTCTATGGGGAAATTCCTTGG + Intergenic
1182321081 22:29479042-29479064 CCCTCAAAGTGGAACTTCCTGGG + Intergenic
1182998548 22:34836122-34836144 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1183635736 22:39061416-39061438 CTCTCTAAGAGGAAACTGTTGGG + Intronic
1183749810 22:39713411-39713433 CTCCTAAAGGTGGAATTGCTGGG - Intergenic
1184053688 22:42029200-42029222 CTATCAAAGTGCAAAGTGCTGGG - Intronic
1185077926 22:48693288-48693310 CTCTCTTAGGGCAAATTTCTGGG - Intronic
949190451 3:1243704-1243726 CTTTTAAAGAGTAAATTGCTCGG + Intronic
949671095 3:6399472-6399494 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
951762857 3:26164288-26164310 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
952073527 3:29668953-29668975 CTGGCAAAGGGGAAAATGATGGG - Intronic
952194486 3:31059716-31059738 CTCACAACAGGAAAATTGCTAGG - Intergenic
952296765 3:32069041-32069063 CTCTCTAAGAGGAAATTGTTGGG - Intronic
952663514 3:35878247-35878269 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
952895315 3:38074935-38074957 CTCTCTAAGAGGAAATTGTTGGG + Intronic
953177140 3:40562801-40562823 CTTTTTAAGAGGAAATTGCTGGG - Intronic
953561004 3:43993800-43993822 CGCTCAAGAGGGCAATTGCTGGG - Intergenic
953599499 3:44348923-44348945 CTCTTTAAGAGGAAATTGTTGGG + Intronic
953834525 3:46331316-46331338 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
953841224 3:46391665-46391687 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
954004686 3:47581337-47581359 CTCTCATATGTGAAAATGCTTGG + Intergenic
954161863 3:48728613-48728635 CTCTCTAAGAGGAAATTGTTGGG + Intronic
954818087 3:53300121-53300143 CTCCCAAAGTGCAAAGTGCTGGG + Intronic
956061412 3:65351877-65351899 GCCTCAAAGGAGAAATCGCTTGG + Intergenic
956233559 3:67042608-67042630 CTCTTTAAGAGGAAATTGTTGGG + Intergenic
956424916 3:69124198-69124220 TTCTAAAAAGTGAAATTGCTAGG + Intergenic
957155233 3:76536922-76536944 CTCTCTAAGAGGAAATTGTTGGG + Intronic
957394302 3:79619596-79619618 CTCTCTAAGAGGAAGTTGTTGGG - Intronic
957675305 3:83357009-83357031 CTCTTTAAGAGGAAATTGTTGGG + Intergenic
957734919 3:84191735-84191757 CTCTTTAAGAGGAAATTGTTGGG + Intergenic
957904909 3:86542350-86542372 CTTTTAAAGAGGAAATTGTTGGG + Intergenic
957985638 3:87571159-87571181 CTCTTTAAGAGGAAATTGCTGGG - Intergenic
958181884 3:90071608-90071630 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
958421895 3:93939582-93939604 CTCTTTAAGAGGAAATTGTTGGG - Intronic
958750946 3:98192776-98192798 CTCTTTAAGAGGAAATTGTTGGG - Intronic
958755417 3:98245427-98245449 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
959288409 3:104443810-104443832 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
959359215 3:105367918-105367940 CTCACCAAGGGGAAGTTACTAGG - Intronic
959485829 3:106926622-106926644 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
960638402 3:119806236-119806258 CTCTCAAGGTGGAAGTTGCCTGG + Intronic
961712836 3:128840458-128840480 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
962415176 3:135175235-135175257 CTCTCAAAAGTGAAAAGGCTGGG - Intronic
962524071 3:136222152-136222174 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
963058559 3:141206757-141206779 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
963111903 3:141695188-141695210 CTCTTTAAGAGGAAATTGTTGGG + Intergenic
963319675 3:143799065-143799087 CTTTTTAAGAGGAAATTGCTGGG - Intronic
963425159 3:145114763-145114785 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
963468556 3:145712181-145712203 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
963521565 3:146363845-146363867 CTTTTTAAGGGTAAATTGCTGGG - Intergenic
964067765 3:152598808-152598830 CTCTCTAAGAGGAAATTGCTGGG - Intergenic
964125511 3:153230617-153230639 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
964176159 3:153827544-153827566 CTCTCTAAGAGGAAATTGCTGGG + Intergenic
964300313 3:155279116-155279138 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
964906568 3:161725763-161725785 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
964941017 3:162158073-162158095 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
964983579 3:162714183-162714205 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
965070270 3:163909359-163909381 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
965105283 3:164346047-164346069 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
965374912 3:167911090-167911112 TTCTCAAAGGGAAAACTGCTAGG + Intergenic
965626371 3:170687245-170687267 CTTTTTAAGAGGAAATTGCTGGG + Intronic
965640100 3:170821880-170821902 CTTTTTAAGAGGAAATTGCTGGG + Intronic
965862036 3:173159838-173159860 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
966066784 3:175829526-175829548 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
966397594 3:179518647-179518669 CTTTTTAAGAGGAAATTGCTTGG - Intergenic
966858089 3:184210009-184210031 CTCTCAAAGTGTAAAGTGTTGGG + Intronic
967005427 3:185378448-185378470 CCTTTAAAGAGGAAATTGCTGGG + Intronic
967094080 3:186162397-186162419 CTCTGAAAGGGGAATTGGCCTGG + Intronic
967152031 3:186659441-186659463 CTCTCTAAGAGGAAACTGTTGGG - Intergenic
967643896 3:191899300-191899322 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
967658165 3:192074976-192074998 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
967740428 3:192997470-192997492 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
968241632 3:197093843-197093865 CTGTCGATGGGGAAATTGCAAGG - Intronic
968413378 4:407772-407794 CTCTTTAAGAGGAAATTGTTGGG + Intergenic
969701550 4:8770481-8770503 CTTTCAAAGGCGAAATTGTCTGG - Intergenic
969748997 4:9096049-9096071 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
970082708 4:12306057-12306079 CTCTCAAAGAGGAAATTCCGTGG - Intergenic
970256478 4:14174423-14174445 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
970532669 4:16999472-16999494 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
970854108 4:20634202-20634224 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
972071197 4:35020703-35020725 CTCTTTAAGAGGAAATTGTTGGG + Intergenic
973561110 4:52136830-52136852 CTATCAGAGGGGAAAGTGATGGG - Intergenic
973833887 4:54789922-54789944 TTCTCAGAGGGGAAGCTGCTGGG - Intergenic
974142257 4:57902288-57902310 CTCTCATAGTGGAACTTGATGGG - Intergenic
974173483 4:58295227-58295249 CTCTTTAAGAGGAAATTGTTGGG + Intergenic
974639964 4:64616015-64616037 CTCTTATAGGGGAAATTGTGTGG + Intergenic
974673849 4:65065096-65065118 CTCTCAAAGTGGAAGTTCATGGG - Intergenic
975152010 4:71033004-71033026 CTCTTCAAGAGGAAATTGTTGGG - Intergenic
975152065 4:71033318-71033340 CTCTTCAAGAGGAAATTGTTGGG - Intergenic
976558510 4:86476362-86476384 CTTTTTAAGAGGAAATTGCTGGG - Intronic
977041964 4:92027659-92027681 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
977198489 4:94088521-94088543 CTTTTTAAGGGTAAATTGCTGGG + Intergenic
977225400 4:94387365-94387387 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
977282513 4:95059495-95059517 CTTTCAATGGGGGAATTTCTGGG + Intronic
977446496 4:97138522-97138544 CTCTTTAAGAGGAAATTGTTGGG + Intergenic
978031419 4:103942928-103942950 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
978303288 4:107294348-107294370 CTCTTCAAGAGGAAATTGTTGGG + Intergenic
978329770 4:107599862-107599884 CTCTTAAAGGGTCACTTGCTTGG + Intronic
978386643 4:108182394-108182416 ATCCCATAGGGGAAATTTCTGGG - Intergenic
978438559 4:108710841-108710863 CTTTTAAAGAGTAAATTGCTGGG - Intergenic
978787168 4:112622761-112622783 CTCTCAAAGAGGAAAAAGCATGG - Intronic
980003412 4:127515382-127515404 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
980472496 4:133267615-133267637 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
980714308 4:136611730-136611752 CTCTCTAAGAGGAGATTGTTGGG - Intergenic
981040187 4:140215308-140215330 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
981482786 4:145255451-145255473 CTCTTTAAGAGGAAATTGTTGGG + Intergenic
982318743 4:154058060-154058082 CTCTCCAAGAGGAGATTGTTGGG - Intergenic
983251899 4:165354907-165354929 CTTTAAAAGGGCAAATTGCATGG + Intergenic
983883822 4:172960308-172960330 CTGTTTAAGAGGAAATTGCTGGG + Intronic
984165414 4:176298763-176298785 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
984322129 4:178208935-178208957 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
984411661 4:179404997-179405019 CTCTTTAAGAGGAAATTGTTGGG - Intergenic
984437201 4:179722233-179722255 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
985057456 4:186048129-186048151 CTCTTTAAGAGGAAATTGCTGGG + Intergenic
985079064 4:186246064-186246086 CTCTTTAAGAGGAAATTGTTGGG + Intronic
985389930 4:189483359-189483381 CTTTTTAAGGGTAAATTGCTGGG + Intergenic
985981554 5:3471382-3471404 CACTTAAAAGTGAAATTGCTTGG - Intergenic
987072295 5:14350082-14350104 CTCTGAAAGGGGAGAGTGTTGGG + Intronic
987281984 5:16421820-16421842 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
987755769 5:22096622-22096644 CTTTTAAAGAGGAAATTGCTGGG - Intronic
989615210 5:43331874-43331896 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
989688964 5:44118630-44118652 CTCTTTAAGAGGAAATTGTTGGG + Intergenic
990565185 5:57020913-57020935 CTCTCTAAGGGGAAATTGTTGGG + Intergenic
992960771 5:81955062-81955084 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
993042659 5:82833119-82833141 CTCTTAAAGTGTAAAATGCTGGG - Intergenic
994126172 5:96170806-96170828 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
994295086 5:98080852-98080874 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
994324761 5:98436023-98436045 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
994375851 5:99015235-99015257 CTCTTTAAGGGGAAATTGTTGGG + Intergenic
994556870 5:101316720-101316742 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
994775628 5:104033421-104033443 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
994779057 5:104068432-104068454 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
995125266 5:108572716-108572738 TTCTCTAAGAGGAAATTGTTGGG + Intergenic
996052736 5:118951141-118951163 CTCTTTAAGAGGAAATTGTTGGG + Intronic
996290058 5:121842290-121842312 CACTCAGAGGGGAGCTTGCTTGG - Intergenic
996358688 5:122622803-122622825 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
996388983 5:122939690-122939712 TTATCTAAGGGCAAATTGCTGGG + Intronic
996509845 5:124305574-124305596 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
996527996 5:124498838-124498860 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
996575063 5:124970528-124970550 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
997157170 5:131573281-131573303 CTCTGTAAGAGGAAATTGTTGGG - Intronic
997678963 5:135735908-135735930 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
997721596 5:136082313-136082335 CTCTCAGAAGTGGAATTGCTGGG + Intergenic
997770736 5:136550594-136550616 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
997788880 5:136738689-136738711 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
998483137 5:142479613-142479635 CTCTCAAGGCAGAAATAGCTGGG - Intergenic
998693764 5:144615276-144615298 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
999159247 5:149481748-149481770 CTCTCCAGGGGGACATAGCTGGG - Intergenic
1000025877 5:157358742-157358764 CTGTAAAAGGGGTATTTGCTTGG + Intronic
1000439663 5:161250280-161250302 CTTTTTAAGCGGAAATTGCTGGG - Intergenic
1000606868 5:163335825-163335847 CTCTTTAAGAGGAAATTGTTGGG - Intergenic
1000885386 5:166743019-166743041 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1001354583 5:171007288-171007310 CTCTCTAAGAGGAAATTGTCGGG + Intronic
1002409074 5:179060246-179060268 CTCTCAAAGGCGACAGTGCGCGG - Intergenic
1004106205 6:12669183-12669205 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1005276965 6:24229896-24229918 CTCTCAAAGGGGAAGTGGTGGGG - Intronic
1007084653 6:39134933-39134955 CTCTTTAAGAGGAAATTGTTGGG + Intergenic
1007574818 6:42918296-42918318 CTCCCAAAGTGCAAAGTGCTAGG - Intronic
1008338298 6:50333432-50333454 CCTTCAAAGAGGGAATTGCTTGG - Intergenic
1008476463 6:51939960-51939982 CTTTTTAAGAGGAAATTGCTGGG - Intronic
1008524903 6:52398084-52398106 CTCTCAAAGGGAGAATTTCATGG + Intronic
1008850275 6:56014720-56014742 CTATTTAAGAGGAAATTGCTGGG + Intergenic
1009359294 6:62793291-62793313 CTCTTTAAGAGGAAATTGCTGGG - Intergenic
1009752220 6:67888058-67888080 CTCTCCGAGGGGAAATTGCTAGG + Intergenic
1010071781 6:71752475-71752497 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1010792623 6:80082081-80082103 CACTCAAATAAGAAATTGCTGGG - Intergenic
1010829752 6:80514229-80514251 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1010841375 6:80651733-80651755 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1011367958 6:86602267-86602289 CTTTCTAAGAGGAAATTGCTGGG + Intergenic
1011721056 6:90157054-90157076 CTCACAAACAGGAAATTGCTGGG + Intronic
1012150038 6:95737798-95737820 TACTCAAAAGTGAAATTGCTGGG - Intergenic
1012675040 6:102103763-102103785 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1013808194 6:114016585-114016607 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
1014115409 6:117663616-117663638 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1014395953 6:120926654-120926676 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1014612026 6:123558428-123558450 CTTTTTAAGAGGAAATTGCTGGG - Intronic
1015165164 6:130194147-130194169 CTTTTTAAGAGGAAATTGCTGGG - Intronic
1015269599 6:131325216-131325238 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1015801438 6:137065252-137065274 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1017389437 6:153923299-153923321 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1017779391 6:157704580-157704602 CTTTTTAAGAGGAAATTGCTGGG + Intronic
1017922958 6:158887298-158887320 GTCTCTAAGAGGAAATTGTTGGG + Intronic
1018077529 6:160230272-160230294 CTTTTTAAGAGGAAATTGCTGGG - Intronic
1018084556 6:160290467-160290489 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1018495462 6:164342635-164342657 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1018521531 6:164656048-164656070 CTGTTTAAGAGGAAATTGCTGGG + Intergenic
1019634405 7:2067765-2067787 TTCGCAAAGGGGAAATTCTTGGG + Intronic
1020481239 7:8664232-8664254 CTCACAAAGGGGAAAAAGCTAGG - Intronic
1021637257 7:22705058-22705080 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1022661632 7:32373089-32373111 CACTTAGAGGTGAAATTGCTGGG - Intergenic
1022709009 7:32834183-32834205 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1024644262 7:51357961-51357983 CTCAAAAAGAGGGAATTGCTGGG - Intergenic
1025789976 7:64680160-64680182 CTCTCAAAGGGGAAATAGTGGGG - Intronic
1027157818 7:75780931-75780953 CTTTTTAAGAGGAAATTGCTGGG - Intronic
1027354355 7:77341477-77341499 CTCTTTAAGAGGAAATTGTTGGG - Intronic
1027404493 7:77845849-77845871 ATCTTAAAGGGGAAATTTATTGG + Intronic
1028589973 7:92483717-92483739 CTCTTTAAGAGGAAATTGTTGGG + Intergenic
1029500154 7:100923951-100923973 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1029585309 7:101467054-101467076 CCCTCCAAGGGGAATTTGGTTGG - Intronic
1030163673 7:106532333-106532355 CTCTTTAAGAGGAAATTGTTGGG + Intergenic
1031269360 7:119626811-119626833 ATCCTAAAGGTGAAATTGCTAGG + Intergenic
1031355258 7:120781048-120781070 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1031364805 7:120889543-120889565 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1031422514 7:121567911-121567933 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1031707907 7:125005381-125005403 TTCTCAAAGTGGGAATTGTTGGG + Intergenic
1031777283 7:125919392-125919414 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1032321043 7:130887107-130887129 CCCTCACAGGGGAAAGTGGTGGG - Intergenic
1032870415 7:135978672-135978694 ATCTCAAGGGGGAATTTGTTAGG + Intergenic
1033465098 7:141582719-141582741 CTTTTTAAGAGGAAATTGCTGGG + Intronic
1033625522 7:143106629-143106651 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1034084894 7:148313971-148313993 CTTTTTAAGAGGAAATTGCTGGG + Intronic
1034334016 7:150308796-150308818 CTCTCTAAGAGGAAACTGTTGGG - Intronic
1035680832 8:1486537-1486559 CAATCAAAGGGGGAATTTCTCGG + Intergenic
1036223423 8:6939613-6939635 CCTCCAAAGGTGAAATTGCTGGG - Intergenic
1036472394 8:9063369-9063391 CTTTTTAAGAGGAAATTGCTGGG + Intronic
1036479563 8:9126886-9126908 CTCCCAAAAAGGAAATTTCTAGG + Intergenic
1039225891 8:35387915-35387937 TTCTGAAAGGGAAAATTGATCGG + Intronic
1039499066 8:38002608-38002630 CTCTCTAAGAGGACATTGTTGGG + Intergenic
1039814861 8:41084374-41084396 CTCCCAAAGTGCAAAGTGCTGGG - Intergenic
1040004433 8:42607557-42607579 CTCCCAAAGTGCAAAGTGCTGGG + Intergenic
1040647964 8:49421278-49421300 CTCTTCAAGAGGAAATTGTTGGG - Intergenic
1041651905 8:60310433-60310455 CTCTTTAAGAGGAAATTGTTGGG + Intergenic
1041917603 8:63152234-63152256 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1043022047 8:75014803-75014825 CTCTTAAAGGGGAAACTGGTGGG + Exonic
1043598783 8:81915224-81915246 CTCTTTAAGAGGAAATTGTTGGG - Intergenic
1043720784 8:83545197-83545219 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1043837670 8:85064743-85064765 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1044232493 8:89795320-89795342 CTCCCAAAGTGCAAAGTGCTGGG + Intergenic
1044375231 8:91462523-91462545 TTCTCAAAGGGGGAATAACTGGG - Intergenic
1046294061 8:112197635-112197657 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1046571541 8:115972340-115972362 TTCTCAAAGTGAAATTTGCTTGG + Intergenic
1046678858 8:117144445-117144467 ATCTTAAAGGGGAAATTACTTGG - Intronic
1047699292 8:127433541-127433563 CTTTCTAAGAGTAAATTGCTGGG - Intergenic
1047856313 8:128916205-128916227 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1048097555 8:131311986-131312008 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1048143713 8:131820969-131820991 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1049868877 8:144958190-144958212 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1050474105 9:6021763-6021785 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1050848420 9:10253662-10253684 CTCTCAGAGTGGCATTTGCTTGG + Intronic
1051878787 9:21818573-21818595 CTCCCAAAGCGCAAAGTGCTGGG + Intronic
1052191772 9:25670714-25670736 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1052653273 9:31328193-31328215 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1053057963 9:35005259-35005281 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1053060035 9:35023548-35023570 TTCTCTAAGAGGAAATTGTTGGG + Intergenic
1053078525 9:35155137-35155159 CCCTCTAAGAGGAAATTGTTGGG + Intergenic
1053134096 9:35638473-35638495 TTCTCTAAGAGGAAATTGTTGGG - Intronic
1055339843 9:75269531-75269553 ATCTGAAGGGGGAAAGTGCTGGG + Intergenic
1055347779 9:75355704-75355726 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1055870388 9:80870734-80870756 CTCCCAAAGTGGAAAGTGCTGGG - Intergenic
1056273264 9:84967845-84967867 CACTCAAAGGAGAAATTGCAGGG + Intronic
1057024987 9:91727955-91727977 CTTTCAGAGGGGAAGCTGCTAGG - Intronic
1057067998 9:92073105-92073127 CTCTCAAAGGGGAAATTGCTGGG - Intronic
1057093276 9:92280151-92280173 CACTCAGAAGTGAAATTGCTGGG + Intronic
1057812641 9:98269742-98269764 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1057940474 9:99278416-99278438 CTGTCAAAGGGAAATTTGCTTGG + Intergenic
1058161094 9:101571441-101571463 CTGTAAAAGAGGAAAGTGCTTGG + Exonic
1059546221 9:115178551-115178573 CTTTTTAAGAGGAAATTGCTGGG + Intronic
1060050505 9:120375207-120375229 CTCACAGAGAAGAAATTGCTAGG + Intergenic
1060226090 9:121791762-121791784 CTCTCTAAGAGGAAATTGCTGGG - Intergenic
1061582999 9:131548866-131548888 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1062691457 9:137844179-137844201 CTCTCTAAGAGGAAATTGTTGGG - Intronic
1186112928 X:6276079-6276101 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1186784008 X:12941607-12941629 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1187100020 X:16183082-16183104 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1188309293 X:28597433-28597455 CTTTCAAAGAAGAAACTGCTGGG + Intronic
1188333085 X:28896520-28896542 CTTTTTAAGAGGAAATTGCTGGG + Intronic
1188463434 X:30452997-30453019 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1188552592 X:31379302-31379324 CTTTTTAAGAGGAAATTGCTGGG - Intronic
1188890987 X:35610892-35610914 CTCTGTAAGAGGAAATTGTTGGG - Intergenic
1189031873 X:37459716-37459738 CTCTTTAAGAGGAAATTGTTGGG + Intronic
1190898626 X:54646578-54646600 TAATCAAAGGGGAAATTGGTGGG - Intergenic
1191014261 X:55792210-55792232 CTCTTTAAGAGGAAATTGTTGGG + Intergenic
1192706082 X:73529443-73529465 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1192764712 X:74129083-74129105 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
1192914197 X:75636192-75636214 CTCTGTAAGAGGAAATTGTTGGG + Intergenic
1193536990 X:82728333-82728355 CTCTCTAAGAGGAAATTGTTGGG - Intergenic
1194660624 X:96625819-96625841 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1194873859 X:99163343-99163365 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1194958056 X:100204124-100204146 CTCTAAGAGGGGACATTGTTTGG - Intergenic
1195017017 X:100790351-100790373 CTCTTTAAGAGGAAATTGTTGGG + Intergenic
1196221047 X:113112629-113112651 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1196469801 X:116012120-116012142 CTCTCAAAGAGGAAATTTTGGGG - Intergenic
1196496804 X:116332601-116332623 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1196525539 X:116724889-116724911 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1196992745 X:121346911-121346933 CTTTTTAAGAGGAAATTGCTGGG + Intergenic
1197119928 X:122879008-122879030 CTCCCAAAGGAGGGATTGCTGGG - Intergenic
1197470899 X:126864893-126864915 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1197499663 X:127228373-127228395 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1197793582 X:130278842-130278864 CTCTTTAAGAGGAAATTGTTGGG - Intergenic
1198266410 X:135013244-135013266 CTCTCAGAGGGGAAATTACATGG - Intergenic
1198311370 X:135427565-135427587 CACTCCCAAGGGAAATTGCTGGG + Intergenic
1198598390 X:138260600-138260622 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1198965857 X:142228326-142228348 CTTTTTAAGAGGAAATTGCTGGG - Intergenic
1200007896 X:153099942-153099964 CTCTCTAGGAGGAAATTGTTGGG + Intergenic
1201884958 Y:18871939-18871961 CTCTTAAATGATAAATTGCTAGG + Intergenic
1201937027 Y:19420390-19420412 CTCTCCAAGAGGAAATTGTTGGG - Intergenic
1202076619 Y:21043351-21043373 CTCTCTAAGAGGAAATTGTTGGG + Intergenic
1202577823 Y:26346246-26346268 CTCTTAAAAGAGAAACTGCTGGG + Intergenic