ID: 1057070419

View in Genome Browser
Species Human (GRCh38)
Location 9:92094120-92094142
Sequence GGTTTGTATTCTTAAAGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 288}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057070419_1057070421 -8 Left 1057070419 9:92094120-92094142 CCAAGTCTTTAAGAATACAAACC 0: 1
1: 0
2: 1
3: 20
4: 288
Right 1057070421 9:92094135-92094157 TACAAACCGTAAGGCCAAGATGG No data
1057070419_1057070425 26 Left 1057070419 9:92094120-92094142 CCAAGTCTTTAAGAATACAAACC 0: 1
1: 0
2: 1
3: 20
4: 288
Right 1057070425 9:92094169-92094191 CAAGTCAAAATTAAGAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057070419 Original CRISPR GGTTTGTATTCTTAAAGACT TGG (reversed) Intronic
900722972 1:4190089-4190111 GGTTTGTCTTCTCACTGACTTGG + Intergenic
902153943 1:14468286-14468308 GAATTGAATTCTTAGAGACTGGG + Intergenic
906064383 1:42969721-42969743 TTTTTGTATTTTTAAAGACAGGG - Intergenic
907138493 1:52162057-52162079 ATTTTTTTTTCTTAAAGACTAGG + Intronic
907929401 1:58985336-58985358 GGTTTGTGGTCTTCAACACTCGG + Intergenic
909721059 1:78770051-78770073 AGTTTTTATTCTTAAAGCCAGGG - Intergenic
910037930 1:82811021-82811043 GGTTTTTATTCTTAGGGAATTGG - Intergenic
912081866 1:105947085-105947107 AGTTTGTTTTATTAGAGACTAGG + Intergenic
915409644 1:155690060-155690082 GCTTTGTTTTATTAACGACTTGG - Intronic
915705543 1:157840108-157840130 GGTTTGTATTTTTAAATGGTAGG - Intronic
916531698 1:165662573-165662595 TGTTTTTTTTCTTCAAGACTAGG + Exonic
916566956 1:165988957-165988979 GGTTTCCATTTTTATAGACTGGG + Intergenic
917447401 1:175118304-175118326 GATTTGTTTTGCTAAAGACTTGG + Intronic
917463216 1:175250432-175250454 GGGCTGTATTCTTCAGGACTGGG + Intergenic
917637192 1:176948808-176948830 GGTTTTTATTGTTTAAAACTCGG - Intronic
918956003 1:191208522-191208544 GGATTGTATTCTTTTAGGCTGGG - Intergenic
920779709 1:208976792-208976814 TGTTTGTATTCTTAAAGTAAGGG + Intergenic
920973678 1:210765753-210765775 GGTGTATATTCTTAAAGCCTTGG - Intronic
921082847 1:211756950-211756972 AGTTTGTATGCTTAATCACTAGG - Intronic
921563594 1:216688478-216688500 GGTTTGTGTTCATAAAGGTTGGG - Intronic
922290994 1:224208710-224208732 GCTTTGTTTCCTTAAAGATTAGG - Intergenic
1063396709 10:5694545-5694567 GGTTTATATTCTTTAAGATATGG + Intronic
1066365211 10:34769754-34769776 TGTTTGTTTTTTTAAAGACATGG - Intronic
1066661639 10:37742360-37742382 TTTTTGTATTTTTAGAGACTGGG + Intergenic
1069027619 10:63560856-63560878 GGCTTGTTTTCTTTAACACTGGG - Intronic
1069493308 10:68880189-68880211 GTTTTGTTTTCTTAGAGACAGGG + Intronic
1069644327 10:69981578-69981600 GGCTGCCATTCTTAAAGACTTGG + Intergenic
1069727707 10:70591785-70591807 TGTATGTATTTTTAGAGACTGGG + Intergenic
1069954152 10:72039652-72039674 GGTTTGTATTCTCAGAGGCTTGG + Intergenic
1070222722 10:74467070-74467092 GTTTTGTATTTTTAAAGTATAGG + Intronic
1070940289 10:80338867-80338889 TGTTTGGATTTTTAAAAACTAGG - Intronic
1071182809 10:83006483-83006505 TTTTTGTATTTTTAAAGACGGGG - Intergenic
1071338991 10:84625382-84625404 GGTTTGAATTCTTACAGACATGG - Intergenic
1071698261 10:87901621-87901643 AGTTTGTTTTATTAGAGACTAGG + Intronic
1073390233 10:103169950-103169972 TTTTTGTATTTTTAGAGACTGGG - Intronic
1073660131 10:105466113-105466135 TGTTTGTATTTTTAAAGTCTTGG + Intergenic
1074840194 10:117343901-117343923 GTTTGGGATACTTAAAGACTTGG - Intronic
1076408936 10:130232224-130232246 GGTTTGCTTTCTTAATGGCTGGG + Intergenic
1077968166 11:7158217-7158239 GATTTGGATTCTTAAATAATTGG - Intergenic
1080600151 11:33814694-33814716 GGTTTGTCTTCTTACTGAGTTGG - Intergenic
1085213257 11:74802471-74802493 TTTTTGTATTTTTAAAGACGAGG - Intronic
1085888895 11:80554220-80554242 AGTTTGTCTTCTCAAAGCCTAGG + Intergenic
1091041032 11:132281577-132281599 GATATCTATTCTTACAGACTGGG - Intronic
1092873043 12:12823881-12823903 GGTTTATATTCTAAATGAATTGG + Exonic
1092998233 12:13971292-13971314 AGTTTGTCTTTTTAAAGACACGG + Intronic
1093507039 12:19879701-19879723 TGTTTGTTTTCTTAGAGACAAGG - Intergenic
1093799454 12:23355218-23355240 TGTTTGTATTTTTAAAGAAAAGG + Intergenic
1098018135 12:66128014-66128036 CATTTGAATTCTTATAGACTTGG + Intronic
1098383312 12:69892415-69892437 GTTTTGTTTTCTTTAAGACAGGG + Intronic
1098561359 12:71876703-71876725 TGTTTTTGTTTTTAAAGACTTGG + Intronic
1098680927 12:73353456-73353478 AGTATATATTCTAAAAGACTTGG - Intergenic
1099602805 12:84763113-84763135 GGTTTATATTCATGAAGAATTGG - Intergenic
1099784131 12:87238537-87238559 GGTTTTTATTATGAAAGATTTGG - Intergenic
1100628834 12:96365886-96365908 AGTTTTTATTTTTAAAAACTAGG + Intronic
1100758614 12:97780388-97780410 GGGTTATATTCATAAAGACCTGG + Intergenic
1100894249 12:99161504-99161526 GGTTTGTTTTTTTACAGACAGGG - Intronic
1101898698 12:108774975-108774997 GGCTGCCATTCTTAAAGACTCGG - Intergenic
1103296294 12:119889916-119889938 AATTTGTATTCTTATAGGCTGGG - Intergenic
1103428304 12:120858288-120858310 GTTTTGTATTTTTAAAGATAGGG - Intronic
1104005359 12:124888186-124888208 TCTTTGTATTCTTAGAGACAGGG + Intergenic
1105959712 13:25320816-25320838 GTTTTGTATTTTAAAACACTTGG + Intronic
1108115919 13:47128142-47128164 GGTTTATATTCTTAGAAATTAGG + Intergenic
1108227739 13:48306096-48306118 TTTTTGTTTTTTTAAAGACTGGG - Intronic
1109626418 13:64980893-64980915 AGTCTGTTTTATTAAAGACTAGG + Intergenic
1110317566 13:74128716-74128738 GGTTTGTTTTCTTTAAGGCAGGG + Intronic
1113898574 13:113782969-113782991 CGTTTGTGTTGTTAAAGACATGG + Intronic
1115925806 14:38432546-38432568 GGTGTGTATTTTTAAATAATGGG - Intergenic
1116210808 14:41941008-41941030 TGTTTGTTTTCTTTAAGATTAGG + Intergenic
1116308508 14:43290470-43290492 AGTCTGTATTTTTAATGACTAGG - Intergenic
1117026595 14:51626695-51626717 GGTTTGGAGTCTGAAAGACCTGG + Intronic
1117173725 14:53127627-53127649 GGTTTTTATTTTAGAAGACTTGG - Intronic
1117305010 14:54465392-54465414 TGTTTGTTTTTTTAAAGACAAGG - Intergenic
1117406961 14:55413035-55413057 GATTTGTATTTAAAAAGACTGGG - Intergenic
1117867402 14:60164375-60164397 GCTTTGGATCCTTAAGGACTTGG - Intronic
1118568153 14:67165304-67165326 GGTTTGAAATCTGAAAGACCTGG + Intronic
1119315827 14:73693702-73693724 TGTTTGTCTTTTTAAAGACAAGG - Intronic
1120656009 14:87190655-87190677 AGTCTGTGATCTTAAAGACTGGG + Intergenic
1123136294 14:106030590-106030612 AGTTTATATTCTTTAAGAGTTGG - Intergenic
1128426380 15:67545653-67545675 AGTTTGTGGTCTTAAACACTGGG - Intronic
1128587705 15:68865135-68865157 GGTTTGGAGTCTCTAAGACTTGG + Intronic
1128763201 15:70233397-70233419 GGTTTGTTTTCCTAACAACTTGG + Intergenic
1129524450 15:76204928-76204950 GGTTTTTATTATTAAAGCCAAGG - Exonic
1131018595 15:89078644-89078666 GATATGTATTCTGAAAGATTTGG - Intergenic
1131233811 15:90679511-90679533 TGTTTGTTTTCGTAAAGACAGGG + Intergenic
1131534688 15:93226241-93226263 AGTTTCTATTTTTAAAGAATTGG + Intergenic
1131587651 15:93713597-93713619 GGCTGGTATTTTTAAAGACACGG - Intergenic
1131826519 15:96325973-96325995 GGTTTTTTTTCTTAAAGGCGAGG + Intronic
1132646461 16:1001420-1001442 GGTTTGTTTTCTAAACCACTCGG - Intergenic
1133240343 16:4410418-4410440 GGTTTGTCTTTTTAGAGACAGGG - Intronic
1135126897 16:19818251-19818273 GGTTTGTAATCATAAAGATCTGG + Intronic
1136018915 16:27427400-27427422 TGTTTGTTTTTTTAAAGACAGGG + Intronic
1136123138 16:28154328-28154350 TGTTTGTATTTTTAAAAAATTGG - Intronic
1138113159 16:54340351-54340373 GGTTTGTCTTCTCATAGACAGGG - Intergenic
1138472634 16:57250281-57250303 GTTTTGTTTTTTTAGAGACTGGG - Intronic
1138803833 16:60069281-60069303 GTTTTCTCTTCTTAAATACTTGG + Intergenic
1138874987 16:60938270-60938292 GGTCTGTTTTATCAAAGACTAGG - Intergenic
1139061006 16:63251401-63251423 GCTTTGAATTCTAAAAGCCTAGG - Intergenic
1139136426 16:64210224-64210246 GATTTGTATTCTGTAATACTTGG - Intergenic
1139154342 16:64422849-64422871 GGTTTTTATTGTTAAAGGATGGG - Intergenic
1140880311 16:79192190-79192212 TGTGTGTATTTTTAAAGTCTGGG + Intronic
1140924609 16:79570340-79570362 GCTTTGGAATCTGAAAGACTGGG - Intergenic
1140942991 16:79739741-79739763 GGTTTGACTTCTTAAAAACATGG - Intergenic
1141249440 16:82341779-82341801 GGTTTCTATCCTGAAAGACAAGG + Intergenic
1144004127 17:11084743-11084765 GTTTTGTTTTCTTAAAGACAAGG + Intergenic
1144112538 17:12050086-12050108 GGTTTCCATTCTTACAGGCTGGG + Intronic
1144962658 17:19054409-19054431 GGTTTTTATTCTTTGAGACAAGG - Intergenic
1144972503 17:19120112-19120134 GGTTTTTATTCTTTGAGACAAGG + Intergenic
1146741824 17:35291968-35291990 GTTTTGTTTTCTTAGAGACAGGG - Intergenic
1146781855 17:35681404-35681426 TTTTTGTATTTTTAAAGACAGGG + Intronic
1146799411 17:35806684-35806706 GGGTTGTATTTGCAAAGACTGGG - Intronic
1148768564 17:50053808-50053830 AGTTTGTCTTCTTAAAGACACGG + Intergenic
1149550917 17:57538688-57538710 GGGTTTTATTTTTCAAGACTAGG - Intronic
1150033491 17:61767445-61767467 GTTTTGTTTTTTTAAACACTGGG + Intronic
1150535096 17:66030179-66030201 GCATTGTTTTTTTAAAGACTTGG - Intronic
1153270732 18:3318708-3318730 ACTTTTTATTCTTAGAGACTGGG + Intergenic
1154935411 18:21050934-21050956 AGTTTGAACTCTTAAAGAATAGG - Intronic
1156994960 18:43454146-43454168 GTTTTGTTTTCTTAAAAACATGG + Intergenic
1157769390 18:50332349-50332371 TGTTTGTTTTCTTAGAGACGGGG - Intergenic
1158059961 18:53328286-53328308 GTTTTGCAGTCTTAATGACTAGG + Intronic
1158652869 18:59303254-59303276 GATTTGTCTTCTTGAAGAATAGG + Intronic
1158999606 18:62960856-62960878 GTTGTGGATTCTTAATGACTTGG + Intronic
1163981172 19:20901686-20901708 CGTTTGTATTGTGAAAGACTGGG - Intergenic
1166063462 19:40342181-40342203 GGTATTTATTGTTAAAGTCTTGG - Intronic
1168588988 19:57617162-57617184 GGTTTGTATGCTGAGAGAATTGG + Intronic
925472389 2:4176107-4176129 GGCTGCCATTCTTAAAGACTTGG - Intergenic
926428447 2:12761732-12761754 GGTGTGTATAATTAATGACTAGG + Intergenic
927612417 2:24554762-24554784 GGTTGCCATTCTTAAAGACTCGG - Intronic
927814968 2:26207189-26207211 GGTTTGTTTTTTTAGAGACAGGG - Intronic
927852373 2:26507970-26507992 GCTTAGTATTCATAATGACTTGG + Intronic
930427857 2:51234282-51234304 GGTTTGTATCCTTTAAGCCATGG + Intergenic
930585336 2:53260979-53261001 GGTTTGATTTCCTAAAGCCTAGG + Intergenic
931104226 2:59036634-59036656 TTTTTGTATTTTTAAAGACAGGG + Intergenic
931251365 2:60533482-60533504 GTTTTGTTTTCTTAAATACCGGG + Intronic
931933878 2:67173472-67173494 GGTTTGGGTTCTTAGAGTCTTGG - Intergenic
933440822 2:82311317-82311339 GGTATGTATTCTTGAAGGCCTGG + Intergenic
934128623 2:88924206-88924228 GCTTTGTCTTCTTGAAGAATTGG - Intergenic
936587563 2:113771734-113771756 GGGTTGTATTCTTAAAGCCTTGG - Intergenic
937720794 2:125093202-125093224 TGTTTGGATGCTTAAAGACTAGG - Intergenic
938631648 2:133173986-133174008 GGTTTGTGTTTTTAATCACTGGG - Intronic
939479967 2:142735632-142735654 AGCCTGTATTCTTAAATACTGGG - Intergenic
940065881 2:149628530-149628552 GATTTTTATTCTTAATGACTTGG - Intergenic
940805008 2:158177262-158177284 GGTTTGAATTATAAAAGACAAGG - Intronic
941088303 2:161145089-161145111 TGTCTGTTTTGTTAAAGACTAGG + Intronic
941425553 2:165340567-165340589 GGTATGTATTTCTAGAGACTAGG + Intronic
941647203 2:168053694-168053716 GGTTTGTATTCAGAAAAAATTGG - Intronic
941683645 2:168426037-168426059 GGTTTTTCTTTTTAAAGTCTTGG + Intergenic
941684051 2:168429588-168429610 GATGTGTTATCTTAAAGACTGGG + Intergenic
943675042 2:190708342-190708364 CATATGAATTCTTAAAGACTGGG - Intergenic
944748770 2:202686064-202686086 GGTTTGTCTTCTTATTGAATTGG - Intronic
947033739 2:225826924-225826946 AGTTTGTTTTATCAAAGACTAGG - Intergenic
947431747 2:230034677-230034699 GGTTTGTTATATAAAAGACTGGG - Intergenic
947781706 2:232771989-232772011 GATTTGTATTTTTAGAGACAGGG + Intronic
1169063878 20:2681744-2681766 TTTTTGTATTTTTAAAGACAGGG + Intergenic
1172257218 20:33529662-33529684 TGTTTGTTTTTTTAAAGACAGGG - Intronic
1172821251 20:37736796-37736818 GGTTTGAGGTGTTAAAGACTGGG - Intronic
1173509264 20:43613427-43613449 GGTTTGTTAACTTAAAAACTGGG - Intronic
1174379553 20:50147884-50147906 TTTTTGTATTCTTAGAGACGGGG - Intronic
1174471171 20:50762175-50762197 GGTGTGTATTTTTAAAGTCAAGG - Intergenic
1174917164 20:54665457-54665479 AGTTTCAATTCTTAAAAACTGGG - Intergenic
1176988064 21:15461167-15461189 GGTTTTTATTTTTAAATCCTTGG + Intergenic
1177969010 21:27765225-27765247 TGTTTGTATTCTTTAAATCTTGG - Intergenic
1178923224 21:36753871-36753893 GGTTTGTTTTTTCATAGACTAGG + Exonic
1179739047 21:43407141-43407163 TTTTTGTATTCTTAGAGACGGGG - Intergenic
1182463201 22:30496608-30496630 GGTTTGGATTCACAGAGACTGGG + Intronic
1183424464 22:37731760-37731782 TTTTTGTATTTTTAGAGACTAGG + Intronic
1184306779 22:43608436-43608458 GGTTTCCATTCTTATGGACTAGG - Intronic
949640810 3:6034204-6034226 GGTCTGTTTTATTAGAGACTAGG + Intergenic
951164980 3:19474460-19474482 GCTTTGTATTTCTAATGACTTGG - Intronic
952060799 3:29507339-29507361 GCTTTGTATTCCTGAAAACTTGG + Intronic
952360971 3:32629569-32629591 GGTTTTTTTTCTTAAAGACAGGG - Intergenic
953083388 3:39642941-39642963 GGTTTGTTTTCTAAATGCCTTGG - Intergenic
955547093 3:60042593-60042615 GACTTGTATTCTTAAAGAAAGGG - Intronic
956439274 3:69263993-69264015 TTTTTGTATTTTTAGAGACTGGG + Intronic
956839421 3:73123631-73123653 GCTCTGTATACTGAAAGACTTGG + Intergenic
957584101 3:82112686-82112708 AGTTTGTTTTCTCAGAGACTAGG + Intergenic
959354452 3:105308091-105308113 AGTTTGTTTTATTAGAGACTAGG + Intergenic
959393914 3:105812020-105812042 GTTTTGTTTTTTTAAATACTTGG + Intronic
960257134 3:115522598-115522620 GGTTTGTAGACTTAGAAACTTGG + Intergenic
960370162 3:116826486-116826508 GGTTTATTTTATTAAAGAATTGG - Intronic
960626832 3:119689302-119689324 GTTTTGTATTCTTCAATATTGGG - Intergenic
960781817 3:121328438-121328460 CATTTGTGTTCTTAAAAACTAGG + Intronic
962404277 3:135086785-135086807 GTTTTGTATTCTTTGAGAATGGG + Intronic
964258580 3:154808030-154808052 GTTTTGAATTTTTAAAGACTTGG + Intergenic
966087815 3:176091083-176091105 GCTTTGTAATCTTCAAGACATGG - Intergenic
966981956 3:185145071-185145093 GATTTGTTTTCTTAAAAAATAGG - Intronic
966999145 3:185315076-185315098 TTTTTGTATTCTTAGAGACTGGG - Intronic
967381058 3:188858531-188858553 GTTTTTTATTCTTAAGCACTAGG - Intronic
968020895 3:195388146-195388168 TGTTTGTGTTCTTAACTACTAGG + Intronic
970765380 4:19542108-19542130 GTTTTATACTCTTAAAAACTAGG - Intergenic
971431020 4:26567615-26567637 TTTTTGTATTCTTAGAGACAGGG + Intergenic
971621100 4:28855294-28855316 AGTCTGTTTTATTAAAGACTAGG + Intergenic
972813790 4:42621240-42621262 TGTTTCTACTCTTAAATACTTGG + Intronic
974223037 4:59001686-59001708 GGATTGTCTTCTCAAAGACTTGG + Intergenic
974800247 4:66808006-66808028 GGTTTGTAATCTTAAAGCAATGG - Intergenic
975394562 4:73859648-73859670 TGGCTGTATTCTTAAAGAGTTGG - Intergenic
975787743 4:77910577-77910599 GGTTTGTTTTCTTTGAGACAGGG - Intronic
976716902 4:88132758-88132780 TGTTTGTTTTCTTTAAGAGTTGG - Intronic
976956733 4:90910742-90910764 GGTTTGTATGTTTAAAAAATGGG - Intronic
978539104 4:109796788-109796810 GTTTTGTTTTGTTAAAGACAGGG - Intronic
978648870 4:110975769-110975791 ATTTTGTATTTTTAGAGACTGGG - Intergenic
979881367 4:125963761-125963783 GGTTTGTACTCTCCAAGAGTGGG - Intergenic
981126535 4:141113368-141113390 GGTCTGTTTTATTGAAGACTAGG - Intronic
981599836 4:146474385-146474407 AGTTTCTATACTTAATGACTTGG - Intronic
981641772 4:146952193-146952215 GATAGGTATTCTAAAAGACTTGG + Intergenic
981743477 4:148028563-148028585 GGGTAGTATTCTTAAAGCCAGGG + Intronic
981971951 4:150674314-150674336 TTTTTGTATTCTGAAATACTTGG - Intronic
982726192 4:158909261-158909283 GTTATGTTATCTTAAAGACTGGG + Intronic
983321338 4:166199728-166199750 GGTTTGCCTTCTTAAAGATGTGG - Intergenic
983321341 4:166199749-166199771 GGTTTGCCTTCTTAAAGCCAAGG - Intergenic
983327952 4:166284216-166284238 TCTTTGTATTCCTCAAGACTTGG - Intergenic
984492199 4:180448870-180448892 GGTTTGAATTATTAAAGAAGAGG + Intergenic
987064221 5:14272266-14272288 GTTTTTTATTTTTAAAGTCTGGG + Intronic
988002583 5:25367663-25367685 GGTTTCAGGTCTTAAAGACTTGG - Intergenic
989178563 5:38554644-38554666 TGTTTGTATTCCTAAAGATGAGG - Intronic
990079407 5:51894306-51894328 GGAATACATTCTTAAAGACTTGG - Intergenic
990466687 5:56077672-56077694 TTTTTGTATTTTTAAAGACAGGG - Intergenic
992788326 5:80190968-80190990 GGTTTGGATTGTTAAAGTTTAGG + Intronic
993486465 5:88493539-88493561 TCTTTGTATACCTAAAGACTTGG - Intergenic
993772673 5:91949852-91949874 GATTTGCATTTTTAAATACTAGG - Intergenic
998088462 5:139346409-139346431 TGTTTGTATTTTTAGAGACGGGG + Intronic
998714671 5:144869191-144869213 GGTTTTTGGTCTGAAAGACTTGG - Intergenic
1000792074 5:165620335-165620357 GCTTTGTATTATTATAGCCTGGG - Intergenic
1001409050 5:171497258-171497280 TGTTTGTTTACTTAAAGACAGGG + Intergenic
1003919337 6:10818269-10818291 AGATTTTATGCTTAAAGACTTGG - Intronic
1004446086 6:15700098-15700120 GTTTTGTATTCTTAATCCCTTGG + Intergenic
1005573199 6:27166923-27166945 GATTAGTATTTTTAAAGATTAGG - Intergenic
1008042988 6:46821655-46821677 GTATTGTATTCTATAAGACTTGG - Intronic
1008167914 6:48163420-48163442 GCTTTGGATTCTTAAAGATACGG + Intergenic
1008866231 6:56213944-56213966 GTTTTTTATTTTTAAATACTTGG - Intronic
1009618573 6:66042553-66042575 GGCTCATATTCATAAAGACTGGG - Intergenic
1010398174 6:75416361-75416383 GGTTTATATTGTTAAAAGCTGGG - Intronic
1011166763 6:84456558-84456580 AGTTTCTATTCCTAAAGAGTGGG - Intergenic
1011393848 6:86884710-86884732 GGTTTGTTTTATCAGAGACTAGG + Intergenic
1011495196 6:87930530-87930552 TGTTTGTTTTCCTGAAGACTGGG - Intergenic
1012177433 6:96105943-96105965 GGTTTGTTCTCTTTAACACTGGG - Intronic
1012256332 6:97036852-97036874 GATTTGTGTTGGTAAAGACTGGG + Intronic
1013563466 6:111330369-111330391 CATTTGTATTCATCAAGACTAGG + Intronic
1015079828 6:129210207-129210229 TGTTTGTTTTTTTAAAGCCTTGG - Intronic
1015567207 6:134585931-134585953 TGTTTGTATTGTTAAAGAAGTGG - Intergenic
1015909321 6:138151915-138151937 GGTTTCTTTTTTTATAGACTTGG + Intergenic
1016493273 6:144630766-144630788 GGTTTGTAGTCCTGAAGATTAGG + Intronic
1016982465 6:149864992-149865014 TGTTTTTATTTTTAAAGACAGGG - Intergenic
1018790950 6:167147265-167147287 GGTTTTTGTTCTTAAAGCCAAGG + Intronic
1020433209 7:8134205-8134227 GGTTTTTATTTTTGAAAACTTGG - Intronic
1021104767 7:16624678-16624700 GGTTAGCATTCTTAAACATTAGG + Intronic
1022671104 7:32457150-32457172 GGTTGGTGATATTAAAGACTGGG - Intergenic
1022845259 7:34204030-34204052 AGTTTGTTTTATTAGAGACTAGG + Intergenic
1024005466 7:45222308-45222330 GGCTTTTATTCTTAATGAGTTGG - Intergenic
1025825034 7:65004046-65004068 GGTGTGTTTTTTTAATGACTTGG - Intronic
1026076230 7:67171996-67172018 GGTTTGTTTTCTTAAACAGTTGG + Intronic
1026272219 7:68846364-68846386 ATTTTATATTTTTAAAGACTGGG + Intergenic
1026700627 7:72640294-72640316 GGTTTGTTTTCTTAAACATTTGG - Intronic
1027952328 7:84832980-84833002 GGTTTGTATTCATAAAATATTGG + Intergenic
1028207285 7:88032247-88032269 GGTCTGTATTCTGCAAAACTGGG + Intronic
1029841833 7:103372695-103372717 GGTTAGTTTTCTTAAAAACATGG + Intronic
1030241394 7:107329886-107329908 TTTTTGTTTTCTTAAAGACAGGG - Intronic
1030567468 7:111177184-111177206 TGTTTTTATTTTTGAAGACTGGG + Intronic
1030611966 7:111699549-111699571 GCTTTGAATTCTGCAAGACTGGG + Intergenic
1030857319 7:114576207-114576229 GGTTTTTGTTTTTAAAGCCTTGG + Intronic
1031074499 7:117199733-117199755 GGTCTGTCTTCTCAATGACTGGG - Intronic
1031391247 7:121217587-121217609 TGTTTTTATTCTTAAAGTTTTGG + Intronic
1032199549 7:129809783-129809805 GGTTTTTTTTTTTAAAGACGGGG - Intergenic
1032281108 7:130502223-130502245 GGTTTGTTTTTTAAAAGACAGGG - Intronic
1034288277 7:149906115-149906137 GGTTTTTCTTTTTAAAGACCAGG + Intergenic
1034564810 7:151904599-151904621 TGTTTATATTTTTAAAAACTAGG - Intergenic
1034832215 7:154319284-154319306 GATTTTTATTTTTAAAGACAAGG + Intronic
1035703376 8:1654352-1654374 GCTTTGCATTCTTAAAGAATTGG + Intronic
1037168311 8:15858231-15858253 TGTTTGTTTTCTTAAGAACTGGG - Intergenic
1037181939 8:16017870-16017892 GATGTGTATTCTGAAAGATTCGG + Intergenic
1037349348 8:17933733-17933755 AGGTGGTATTCTTAAAGAGTAGG - Intronic
1038059523 8:23897018-23897040 GCTTTGTATGGTTAAATACTAGG - Intergenic
1038452689 8:27649998-27650020 GTTTTTTTTTCTTAAAGACATGG + Intronic
1038856789 8:31342392-31342414 GGAATGAATTCTAAAAGACTGGG + Intergenic
1039213586 8:35242645-35242667 TGTTTGTATTTTTACAGACAGGG + Intronic
1039838601 8:41277620-41277642 GGTTTTTATTTTTAGAGACCAGG + Intronic
1040718405 8:50287339-50287361 TGTTTTTATTCATAAAGACAAGG - Intronic
1040958198 8:53002214-53002236 GCTCTGTATTCTTAAGCACTTGG - Intergenic
1042041982 8:64601712-64601734 GGTTTGAATTTTTAAATATTTGG - Intronic
1042132485 8:65601375-65601397 GGTTTTTATTTTTAAAAAATGGG - Intergenic
1042230678 8:66551283-66551305 GGTTTTTATTTTTTAAGACAGGG - Intergenic
1042231044 8:66554999-66555021 ATTTTGTATTCTTAAAGAAAGGG - Intergenic
1042275517 8:67001008-67001030 GTTATGTTTTCTTAAAGAGTTGG + Intronic
1042421417 8:68594291-68594313 GCTTTATATTTTTAAAGACAAGG + Intronic
1042764507 8:72306012-72306034 AGTTTGTTTTCTGAAAGAATAGG - Intergenic
1045279076 8:100733674-100733696 TTTTTGTATTTTTAGAGACTAGG + Intergenic
1045319876 8:101074271-101074293 TGTTTGTTTTCTTACAGACAGGG + Intergenic
1045398367 8:101784624-101784646 TGTTTTTATTTTTATAGACTTGG - Intronic
1048085148 8:131169454-131169476 GGTTTGTATTCTAATAGAAGAGG + Intergenic
1048652935 8:136500521-136500543 AATTTCTATTCTTAAAAACTTGG - Intergenic
1048954438 8:139524157-139524179 GGTTTGTATTCTGAAATAAGGGG - Intergenic
1052120170 9:24705102-24705124 GGTTTGTTTTATCAGAGACTAGG + Intergenic
1052892417 9:33715544-33715566 GGTTTGTATTGTTTGAGACACGG - Intergenic
1053506728 9:38649631-38649653 AGTCTTTATTCTTAAAGAATGGG + Intergenic
1055101902 9:72474513-72474535 GCTTTGGAATCTGAAAGACTTGG - Intergenic
1055940361 9:81643540-81643562 GTTTTGTTTTCTTAGAGACAGGG + Intronic
1056228484 9:84520820-84520842 GTTTTGTGTTCTTAAAAACTTGG - Intergenic
1056765257 9:89441216-89441238 GGTTGGTATTCGTAAGGTCTGGG - Intronic
1057070419 9:92094120-92094142 GGTTTGTATTCTTAAAGACTTGG - Intronic
1058289462 9:103220209-103220231 TGTTTGTATTTTCAAAGACAAGG + Intergenic
1060137656 9:121172632-121172654 GTTTTGTTTTTTTAAAGACAGGG - Intronic
1186396903 X:9218518-9218540 GGTCTGTATTCTTAAACACCAGG - Intergenic
1189242930 X:39539757-39539779 AGTCTGTTTTCTCAAAGACTTGG - Intergenic
1190465530 X:50722061-50722083 GGATTGTTTTCTTAAAGATTTGG + Intronic
1191198122 X:57746476-57746498 AGTCTGTTTTCTTAGAGACTAGG - Intergenic
1192542764 X:71989176-71989198 TTTTTGTATTTTTAAAGACAAGG - Intergenic
1192782230 X:74305850-74305872 GTTTTGTGTTTTTAAAGACAAGG - Intergenic
1194563876 X:95457261-95457283 GCTTTGAAGTCTTAAAGACCTGG - Intergenic
1195531421 X:105961924-105961946 AGTCTGTTTTATTAAAGACTAGG - Intergenic
1197307506 X:124862126-124862148 AGTTTGGTTTCTGAAAGACTTGG - Intronic
1199525943 X:148792070-148792092 GGTTTGAAGTCTTACAGACATGG + Intronic