ID: 1057070423

View in Genome Browser
Species Human (GRCh38)
Location 9:92094149-92094171
Sequence TTGGTCAGATGCATCCATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057070423_1057070425 -3 Left 1057070423 9:92094149-92094171 CCAAGATGGATGCATCTGACCAA 0: 1
1: 0
2: 0
3: 6
4: 132
Right 1057070425 9:92094169-92094191 CAAGTCAAAATTAAGAAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057070423 Original CRISPR TTGGTCAGATGCATCCATCT TGG (reversed) Intronic
907194480 1:52675456-52675478 TTTGTCAGAGGCAGCCCTCTAGG + Intergenic
908384389 1:63627341-63627363 TAGGTCAGATGGATCCAGCCAGG + Intronic
911074849 1:93863153-93863175 TTGACCAGAAGCAGCCATCTTGG - Intergenic
911413524 1:97541036-97541058 TCTGTCAGATGCAACCAACTTGG - Intronic
913143813 1:115969312-115969334 TTGGTCAGTTACATAAATCTTGG - Intergenic
916681889 1:167112493-167112515 TTCATCTGATGCATGCATCTAGG + Intronic
917656467 1:177131065-177131087 TTGGGCAGCTCCATCCATCTGGG - Intronic
921313085 1:213864629-213864651 TTAGTCACAGGCATCCATTTGGG + Intergenic
923569666 1:235102307-235102329 TTGGGCAGATGCTTCCCTCCTGG - Intergenic
924908599 1:248484077-248484099 TTGGGGAGATGCAGGCATCTGGG - Intergenic
924915513 1:248563985-248564007 TTGGGGAGATGCAGGCATCTGGG + Intergenic
1072652715 10:97308083-97308105 TTGGCCAGGTTCATGCATCTTGG - Intergenic
1075836658 10:125459537-125459559 TGGGTCACAGGCATCCATCGTGG + Intergenic
1082701963 11:56442997-56443019 TGAGACAGATGCATGCATCTTGG + Intergenic
1084989936 11:72913238-72913260 TTGGTAGGTTGCATGCATCTAGG + Intronic
1090515400 11:127420243-127420265 TTGGTCAGTTGTATGTATCTAGG + Intergenic
1090723896 11:129504261-129504283 TTTGTCAGATGTATGCATCCTGG + Intergenic
1093387264 12:18573328-18573350 TTCCTCAGATACAGCCATCTGGG + Intronic
1097813589 12:64046177-64046199 TTGCTCAGCTGCAGCCATCCTGG - Intronic
1098974353 12:76886983-76887005 GTGGTCACATGTATCCATCAGGG + Intergenic
1099495552 12:83341883-83341905 TTGGTAAGATGTATGTATCTAGG - Intergenic
1099569790 12:84302345-84302367 TTTTTAAGATGTATCCATCTTGG - Intergenic
1105352297 13:19626830-19626852 TTGGCAAGTGGCATCCATCTTGG + Intergenic
1108575177 13:51784283-51784305 CTGGTCAGATGCTCCCCTCTGGG - Intronic
1109207757 13:59500786-59500808 TTGCTCAGGTGCCTCCAGCTGGG - Intergenic
1109616812 13:64845514-64845536 TTGTTCAGATTCATTCATATGGG + Intergenic
1113020614 13:105882072-105882094 TTTTTAAGATTCATCCATCTTGG - Intergenic
1121167534 14:91820630-91820652 TTTGTCAAAGGCATTCATCTTGG + Intronic
1122174880 14:99909528-99909550 TTGGCTAGATGCATCTCTCTGGG + Intronic
1126695148 15:51319673-51319695 TTGGGCTTATGCATCCTTCTAGG + Intronic
1129406425 15:75322062-75322084 TTGGTCATAGCCATCCATGTAGG + Intergenic
1134670658 16:16052621-16052643 TTGGTCAGCAGCATCCACGTGGG + Intronic
1137771502 16:51019418-51019440 TTGGACAAATGCATCTCTCTGGG - Intergenic
1141490857 16:84371731-84371753 GTGAGCAGATGCATCCTTCTGGG + Intronic
1142486862 17:253127-253149 TTGGGGAGAGGCATCCATCAGGG + Intronic
1146738468 17:35260250-35260272 TTGGTGACATGCATCTATCCTGG + Intronic
1151239768 17:72748804-72748826 TTGGCTAGAGGCATGCATCTGGG - Intronic
1155781787 18:29846312-29846334 TTGGTAAGTTGTATGCATCTAGG + Intergenic
1156630492 18:38962590-38962612 TTGGGCAAATGCCTCCATTTCGG - Intergenic
1157076853 18:44476065-44476087 TTGGTCAATAGCATCCCTCTTGG + Intergenic
1157676208 18:49570486-49570508 TTGTTCAGATCTATCCTTCTAGG - Intronic
1157807265 18:50667465-50667487 GTGGTCAGATGTGTACATCTGGG + Intronic
1158561419 18:58516890-58516912 TTGGGCAGATGGACCCACCTGGG + Exonic
1158708121 18:59812426-59812448 TTGGTCAGATTTATCCAACCAGG - Intergenic
1159477829 18:68946682-68946704 GTGGTAAGATGTTTCCATCTGGG + Intronic
1164513743 19:28917307-28917329 TTGGTAAGGTACATCCACCTTGG + Intergenic
1165965514 19:39575485-39575507 TTGGTCAGGTGTATGTATCTGGG + Intergenic
1167246076 19:48373876-48373898 GTGGTCAGATGCCTCCTACTGGG - Intronic
1167531586 19:50021032-50021054 CTGCTCAGATGCCTCCCTCTGGG - Intronic
925266622 2:2570738-2570760 TTGGTCAGATGGATCTCTCGAGG + Intergenic
929522896 2:42671216-42671238 TTGGTCAGTTATGTCCATCTAGG + Intronic
931116184 2:59169247-59169269 TTGTTCAAATGGATCCATTTAGG + Intergenic
931289383 2:60858957-60858979 TTGGTCACATGGCTGCATCTTGG - Intergenic
931652874 2:64484257-64484279 TGGGTCACATGGCTCCATCTTGG - Intergenic
944211474 2:197210858-197210880 TGGGGCAGAGGCATCCATGTGGG + Intronic
948582237 2:238996407-238996429 CTGGTCAGATGTCTCCAGCTCGG - Intergenic
1169770499 20:9194744-9194766 TTTTACAGATGCATCCATTTGGG - Intronic
1169898794 20:10532673-10532695 TTGGGGATATGCACCCATCTTGG - Intronic
1170776417 20:19378646-19378668 TTGATCACGTGCATTCATCTTGG - Intronic
1171083032 20:22208023-22208045 GTGGTCACATCCATTCATCTAGG + Intergenic
1173224071 20:41151707-41151729 TTGGGCATATGCAGCCAGCTTGG + Intronic
1173325855 20:42033003-42033025 TTAGCCAGAAGCATCCAACTAGG + Intergenic
1175359970 20:58401889-58401911 TTGGTCAAATGCATGAATGTAGG - Intronic
1177849541 21:26330064-26330086 TTGGGTAGATGCTTTCATCTAGG + Intergenic
1182495090 22:30701142-30701164 TTGGTGAGCTGCACCCATTTTGG + Intronic
1183425745 22:37738577-37738599 GTGGACAGATGCATGCATCCTGG + Intronic
1185389541 22:50551467-50551489 AGGGTCAGATGCCTCCAGCTGGG + Intronic
949718807 3:6965004-6965026 TTGGTCAGAAGCATGGATCTGGG - Intronic
952142551 3:30496293-30496315 TTGGTCTGATACATCCCTTTTGG - Intergenic
954418526 3:50406120-50406142 TTTGTCAGATGCAGCCATCCAGG + Intronic
956288903 3:67641057-67641079 TTGTTCAGATGTATCAATTTTGG - Intronic
957288339 3:78245866-78245888 TTAGTCAGATGTAATCATCTTGG + Intergenic
957308899 3:78493346-78493368 TTGTTCATTTGTATCCATCTCGG - Intergenic
959213980 3:103425585-103425607 TTGGTCAGATGTATCAAAGTGGG + Intergenic
959421223 3:106131527-106131549 TAGGCCAGATGCTTCCATCCCGG + Intergenic
961078891 3:124007471-124007493 TTTGACAGATGCATACCTCTGGG + Intergenic
964967325 3:162512398-162512420 TTTGTCAGTTGTATGCATCTAGG - Intergenic
966166664 3:177027038-177027060 TTGCACAGCTGCATCCATCCTGG - Intronic
966538021 3:181055696-181055718 TTAGTCAAATGCTTTCATCTGGG - Intergenic
967004458 3:185370572-185370594 TTGTTCAGATGGAGACATCTAGG + Intronic
968293069 3:197554129-197554151 TTGGTCAGATGCAGTCAGTTTGG - Intronic
971373280 4:26035266-26035288 TTGGTCAGATGCTACCAGATGGG - Intergenic
971957462 4:33440286-33440308 CTGGTCAGATGCATGCCTCCTGG - Intergenic
981452106 4:144910571-144910593 GTGTTCAAATGCATCCATCTTGG + Intergenic
982502857 4:156179727-156179749 TTGGTGAGATTCATCAATTTGGG + Intergenic
985334917 4:188881905-188881927 TTGGTCATAAGTATCCATATGGG + Intergenic
988002796 5:25370475-25370497 TTGGTCAGCTGCATGTGTCTAGG - Intergenic
991667621 5:69014874-69014896 TTGGTCAGCTACATCCAGCCAGG + Intergenic
992527121 5:77622500-77622522 TTGCTCAAATGTATCCATTTGGG + Intergenic
992957619 5:81926297-81926319 TTAGTGAAATGCATCCATTTAGG - Intergenic
998701422 5:144704592-144704614 TTGTTCAGGTGCATAAATCTGGG + Intergenic
1003221294 6:4163231-4163253 ATGGCCACATGCTTCCATCTGGG - Intergenic
1005424158 6:25683671-25683693 GTGGTCAGATGCTTTCACCTGGG + Intronic
1005460907 6:26069424-26069446 TTGGCCACCAGCATCCATCTTGG + Intergenic
1005996410 6:30934090-30934112 TCTGTCAGCTGCAGCCATCTAGG + Intergenic
1006909917 6:37557197-37557219 TGGGCCAGATGCGACCATCTTGG + Intergenic
1008179387 6:48309513-48309535 TTTGTCAGATGAATACATCCAGG - Intergenic
1011472888 6:87725597-87725619 TAGGTCACATGCTTGCATCTTGG - Intergenic
1013687642 6:112603271-112603293 TTGGTAGGTTGCATGCATCTAGG - Intergenic
1014514587 6:122364211-122364233 CTGGGCAGCTGCCTCCATCTGGG - Intergenic
1015033132 6:128620448-128620470 ATGGTTAGATGGATCCATGTGGG - Intergenic
1018365908 6:163119549-163119571 TTGCTCAGCTACACCCATCTCGG + Intronic
1019273216 7:162125-162147 TTGTTCATTTGCATCCATCTTGG + Intergenic
1020868574 7:13597873-13597895 TTGATCAGCTGCATCCATGAAGG - Intergenic
1021643136 7:22760724-22760746 TATGTCAGATGCATCCAGATGGG - Intergenic
1022061497 7:26800764-26800786 TTGGTCAGTTGTATGTATCTAGG - Intronic
1024124963 7:46284284-46284306 TTGTTCAGATGGATCCTCCTGGG - Intergenic
1024522424 7:50317497-50317519 CTGGTCACATGCTTGCATCTGGG + Intronic
1026482220 7:70789415-70789437 TTGACCACATGCAGCCATCTTGG + Intronic
1026502305 7:70953006-70953028 TTGGGCAGGTGCATCCCTTTGGG + Intergenic
1027532278 7:79351571-79351593 TATGTCAGATGTATCAATCTAGG + Intronic
1031178216 7:118379345-118379367 TTGGTCATATGAATCCACCTGGG - Intergenic
1034580676 7:152039416-152039438 TTGGGCATATTTATCCATCTTGG - Intronic
1038383797 8:27121707-27121729 TTGGACTGATGCCTCCCTCTTGG - Intergenic
1038946206 8:32363068-32363090 TTGGTCATTTGTATCCCTCTTGG + Intronic
1045268273 8:100639975-100639997 TTGGTCAAATTGTTCCATCTTGG - Intronic
1046243011 8:111523525-111523547 TTGGTCGGTTGCATACCTCTAGG + Intergenic
1046246840 8:111574830-111574852 TGTGACAGATGCATACATCTAGG + Intergenic
1046909918 8:119614463-119614485 TTGGTCAGATGCGTCAACTTTGG + Intronic
1055161188 9:73130021-73130043 ATCGTCAAAGGCATCCATCTCGG - Intergenic
1056897586 9:90565418-90565440 TGGGCCAGAGGCATCCAGCTGGG - Intergenic
1057070423 9:92094149-92094171 TTGGTCAGATGCATCCATCTTGG - Intronic
1061252396 9:129434094-129434116 TCTGGCAGATTCATCCATCTTGG - Intergenic
1185619280 X:1443537-1443559 TTGGACAGACACCTCCATCTTGG + Intronic
1185620050 X:1448514-1448536 TTGGACACATGCCGCCATCTTGG + Intronic
1187797698 X:23022451-23022473 TTGTTCAGATGCAGATATCTGGG - Intergenic
1190067073 X:47248795-47248817 TGGGACGGATGCATCCATGTGGG + Intergenic
1190224750 X:48536602-48536624 GTGGTCAGATGCCTCTGTCTTGG - Intergenic
1190488715 X:50958724-50958746 TTTGTGGGATGCATCCAACTTGG - Intergenic
1192802597 X:74480599-74480621 TTGTTCCTATTCATCCATCTTGG + Intronic
1193149227 X:78107206-78107228 TAGGTAAGATGCATCCATTGGGG - Intronic
1193215758 X:78862288-78862310 TTGGTAAGTTGTATTCATCTAGG - Intergenic
1193314375 X:80046939-80046961 TTGGTCATATTTATCGATCTTGG + Intergenic
1193620095 X:83741965-83741987 TTGGTAAGTTGTATGCATCTAGG - Intergenic
1194958204 X:100205754-100205776 ATGGTCAGATGCCTCAATATAGG - Intergenic
1195302657 X:103546161-103546183 TTGGTAGGATGTATGCATCTAGG - Intergenic
1198430660 X:136563829-136563851 TTGTTTATATCCATCCATCTTGG + Intergenic
1200752035 Y:6954776-6954798 TTGGTCCTATTCAGCCATCTTGG + Intronic
1201865087 Y:18643239-18643261 TTTGTGAGATGCAAGCATCTAGG + Intergenic