ID: 1057070490

View in Genome Browser
Species Human (GRCh38)
Location 9:92095110-92095132
Sequence TGGGAATCCAGTAAAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057070487_1057070490 0 Left 1057070487 9:92095087-92095109 CCTTCGCTAATCAAAAGAAAGAC 0: 1
1: 0
2: 0
3: 11
4: 257
Right 1057070490 9:92095110-92095132 TGGGAATCCAGTAAAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057070490 Original CRISPR TGGGAATCCAGTAAAAAAAC AGG Intronic
No off target data available for this crispr