ID: 1057070914

View in Genome Browser
Species Human (GRCh38)
Location 9:92099246-92099268
Sequence CAGGCTGCTGCACTTGCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057070910_1057070914 -9 Left 1057070910 9:92099232-92099254 CCCAAGGTCTGCACCAGGCTGCT 0: 2
1: 0
2: 2
3: 13
4: 172
Right 1057070914 9:92099246-92099268 CAGGCTGCTGCACTTGCTGGAGG No data
1057070911_1057070914 -10 Left 1057070911 9:92099233-92099255 CCAAGGTCTGCACCAGGCTGCTG 0: 2
1: 0
2: 1
3: 29
4: 360
Right 1057070914 9:92099246-92099268 CAGGCTGCTGCACTTGCTGGAGG No data
1057070906_1057070914 10 Left 1057070906 9:92099213-92099235 CCAGGGATCGGCACCACAGCCCA 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1057070914 9:92099246-92099268 CAGGCTGCTGCACTTGCTGGAGG No data
1057070903_1057070914 24 Left 1057070903 9:92099199-92099221 CCTGTTAGGGGCACCCAGGGATC 0: 1
1: 1
2: 0
3: 3
4: 97
Right 1057070914 9:92099246-92099268 CAGGCTGCTGCACTTGCTGGAGG No data
1057070908_1057070914 -3 Left 1057070908 9:92099226-92099248 CCACAGCCCAAGGTCTGCACCAG 0: 2
1: 0
2: 2
3: 31
4: 331
Right 1057070914 9:92099246-92099268 CAGGCTGCTGCACTTGCTGGAGG No data
1057070905_1057070914 11 Left 1057070905 9:92099212-92099234 CCCAGGGATCGGCACCACAGCCC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1057070914 9:92099246-92099268 CAGGCTGCTGCACTTGCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057070914 Original CRISPR CAGGCTGCTGCACTTGCTGG AGG Intronic
No off target data available for this crispr