ID: 1057071815

View in Genome Browser
Species Human (GRCh38)
Location 9:92105681-92105703
Sequence GTCACTTCCCAGAGAGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 5, 2: 5, 3: 43, 4: 272}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057071815_1057071820 -7 Left 1057071815 9:92105681-92105703 CCCCACCCTCTCTGGGAAGTGAC 0: 1
1: 5
2: 5
3: 43
4: 272
Right 1057071820 9:92105697-92105719 AAGTGACGAGTGCCTCTGCCTGG No data
1057071815_1057071826 18 Left 1057071815 9:92105681-92105703 CCCCACCCTCTCTGGGAAGTGAC 0: 1
1: 5
2: 5
3: 43
4: 272
Right 1057071826 9:92105722-92105744 GCCTCACAGCCCGGGAAGTGAGG No data
1057071815_1057071823 10 Left 1057071815 9:92105681-92105703 CCCCACCCTCTCTGGGAAGTGAC 0: 1
1: 5
2: 5
3: 43
4: 272
Right 1057071823 9:92105714-92105736 GCCTGGCCGCCTCACAGCCCGGG No data
1057071815_1057071822 9 Left 1057071815 9:92105681-92105703 CCCCACCCTCTCTGGGAAGTGAC 0: 1
1: 5
2: 5
3: 43
4: 272
Right 1057071822 9:92105713-92105735 TGCCTGGCCGCCTCACAGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057071815 Original CRISPR GTCACTTCCCAGAGAGGGTG GGG (reversed) Intronic
900523930 1:3119381-3119403 GTCATTTCCTTGAGAGGATGCGG + Intronic
900824886 1:4918562-4918584 GTCACTTCCTAGATAGAATGGGG + Intergenic
901037593 1:6345643-6345665 GTGAGGGCCCAGAGAGGGTGCGG + Intronic
901100609 1:6715853-6715875 CTCACTTCCCAGACGGGGTGGGG + Intergenic
902738579 1:18418161-18418183 CTCACCTCCCTGAGAGGCTGAGG - Intergenic
904784814 1:32975190-32975212 CTCACCTCCCAGACGGGGTGCGG + Intergenic
905025668 1:34847711-34847733 GCCACATGCCTGAGAGGGTGGGG - Intronic
905446538 1:38031348-38031370 GTAAAGTCCCAGAGAGGGTTGGG + Intergenic
906656165 1:47549767-47549789 CTCCCTTCCCAGAGAGACTGAGG + Intergenic
907610454 1:55864818-55864840 GTCACTTCCAAGATACAGTGGGG - Intergenic
908442549 1:64169757-64169779 GTTACTTCCCAGATACAGTGGGG + Intronic
909136106 1:71802518-71802540 TTTACTTCTCAGAGAGGGTGGGG + Intronic
909622968 1:77687033-77687055 CTCACTTCCCAGACGGGATGGGG - Intergenic
909623070 1:77687422-77687444 CTCACTTCCTAGAGGGGGTGGGG - Intergenic
909623093 1:77687502-77687524 CTCACTTCCTAGACGGGGTGGGG - Intergenic
909623105 1:77687542-77687564 CTCACTTCCCAGATGGGGTGGGG - Intergenic
909623117 1:77687582-77687604 CTCACTTCCTAGACGGGGTGGGG - Intergenic
909623128 1:77687622-77687644 CTCACTTCGCAGACGGGGTGGGG - Intergenic
910372125 1:86527279-86527301 GTCAATTACCAGAGTGGGAGGGG - Intergenic
910891746 1:92026465-92026487 CTCACTTCCCAGATGGGGTGGGG + Intergenic
912179645 1:107204465-107204487 GAGACTTCACAGAGAGGGAGTGG + Intronic
912186511 1:107282947-107282969 CTCACTTGACAGAGGGGGTGAGG + Intronic
913319711 1:117579601-117579623 GTCATTGCCCAGAGCTGGTGTGG - Intergenic
913572238 1:120132069-120132091 TTCACTTCCCTGAAAGGGCGGGG - Intergenic
914293158 1:146293713-146293735 TTCACTTCCCTGAAAGGGCGGGG - Intergenic
914554202 1:148744496-148744518 TTCACTTCCCTGAAAGGGCGGGG - Intergenic
914947395 1:152079345-152079367 GTCACTTCCCAGACAGGGCGGGG + Intergenic
915310825 1:155005096-155005118 GTGCCTGCCCAGGGAGGGTGCGG + Intronic
916550445 1:165844828-165844850 GTGACTGCCTCGAGAGGGTGTGG + Intronic
916870306 1:168906909-168906931 GCCACTTCACTGAGAGGCTGTGG - Intergenic
916986404 1:170196818-170196840 CTCACATTCCAGAGAGGGTTAGG - Intergenic
918126475 1:181588432-181588454 GTTTCTTCCCAGGGAGGGAGCGG - Intronic
918197587 1:182236497-182236519 CTCATGTCCCAGAGAGCGTGTGG - Intergenic
919569021 1:199222434-199222456 GTCACTTCTCAGACATAGTGAGG + Intergenic
919903759 1:202063227-202063249 GTCACTTTCCAGAGGGGAGGGGG + Intergenic
920908127 1:210190201-210190223 ATCAGTTGCCAGAGAGGGAGTGG - Intergenic
921007729 1:211111549-211111571 CTCACTTCCCAGACGGGGCGGGG - Intronic
921007751 1:211111628-211111650 CTCACTTCCCAGACGGGGCGGGG - Intronic
923091439 1:230744155-230744177 GGCATTTCCCAGTGTGGGTGAGG + Intergenic
924619882 1:245651332-245651354 TTCTCATCCAAGAGAGGGTGGGG + Intronic
924725647 1:246668030-246668052 GCCACTTCCCAGGGAGGGTGAGG + Exonic
1063304902 10:4888290-4888312 GTCACTTCTCTAAGAGGGTTTGG - Intergenic
1063885956 10:10578781-10578803 GTGAATGCCTAGAGAGGGTGTGG - Intergenic
1064416828 10:15157108-15157130 GTACCTTCCCAGAGAAGGTTGGG - Intronic
1066026239 10:31362587-31362609 GTCGCTTCCCAGACAGGGCGGGG + Intronic
1066432172 10:35362764-35362786 ATCACATCCCAGAGGGTGTGGGG + Intronic
1066453657 10:35553780-35553802 GACACTGCCCAGAGAGTGAGGGG - Intronic
1067089865 10:43261110-43261132 ACCACTTCCCAGAGGGGGCGGGG - Intronic
1069862440 10:71480104-71480126 GTCACCTCCCAGCTAAGGTGTGG - Intronic
1071221656 10:83474218-83474240 GTCTGTTCGCTGAGAGGGTGTGG + Intergenic
1071341770 10:84655633-84655655 CTCACTTCCCAGACAGGGCAGGG + Intergenic
1071484313 10:86088499-86088521 GTCACGTCCCAGAGAGCATGGGG + Intronic
1072481926 10:95817411-95817433 GTCACTGGAGAGAGAGGGTGTGG - Intronic
1075167292 10:120080075-120080097 GTCCCTTCCCTGACATGGTGGGG + Intergenic
1075791013 10:125084510-125084532 CTCCCTTCCCAGAGAGGATGGGG - Intronic
1076070341 10:127483620-127483642 GTGACTTCCCAGACACGATGTGG + Intergenic
1076530925 10:131143597-131143619 GTCACTACCAAGAGAGGGTTTGG + Intronic
1077677752 11:4212148-4212170 GTCACTTTCCGGAGAGCGAGCGG + Intergenic
1078157119 11:8808634-8808656 GTGACTTTCCAGAGAGAGTTGGG + Intronic
1079063923 11:17273479-17273501 GTCAATTCCCAGAGTGTGAGAGG - Intronic
1081598813 11:44477605-44477627 GTCACTTCCTAGATACAGTGGGG - Intergenic
1083235106 11:61346124-61346146 GTCACATCCCAGGCAGTGTGCGG - Intronic
1083711872 11:64554602-64554624 GTCACCTCCCAGAGTGCGAGAGG - Intergenic
1083740425 11:64707801-64707823 GTCAACTCCCAGACTGGGTGTGG + Intronic
1083902405 11:65650035-65650057 GTCGCTGTCCCGAGAGGGTGAGG + Exonic
1083918304 11:65764724-65764746 GGCACATCCCAGAGAGGGCAGGG + Intergenic
1084358390 11:68653999-68654021 GGCACTTCACAGAGGGGGTCTGG - Intergenic
1084962127 11:72722409-72722431 GTCTCTTCCCAGCTTGGGTGGGG - Intronic
1085083491 11:73651895-73651917 GTCACTCCCAGGAGAGGATGGGG + Intronic
1085475339 11:76785359-76785381 GACACTTCCTAAAGAGGGTTGGG + Intronic
1085547535 11:77333833-77333855 TTCACTTCACAGATAGGGTCCGG + Intronic
1085695973 11:78705042-78705064 GACACTGCCCAGAGAGCGAGGGG - Intronic
1086047622 11:82551213-82551235 TTCTCTTCCCACAGAGAGTGTGG - Intergenic
1087796388 11:102458828-102458850 GTGACTTCTCAGAAAGGGAGTGG + Intronic
1088677206 11:112206143-112206165 CTCACTTCCCAGACAGGGCGGGG + Intronic
1088693022 11:112344009-112344031 CCCACTGCCCAGAGAGGCTGAGG + Intergenic
1090179752 11:124685880-124685902 GTCACTTCCCAGATACAATGGGG - Intronic
1090863556 11:130675508-130675530 GCCACTTCCCCACGAGGGTGAGG + Intronic
1091160631 11:133416466-133416488 GTGGCTTCCCAGAGGAGGTGAGG - Intronic
1091540504 12:1456797-1456819 GGCAGCTCTCAGAGAGGGTGGGG + Intronic
1091583518 12:1802779-1802801 AAGACTTCCCAGCGAGGGTGAGG - Intronic
1096552533 12:52382620-52382642 GCCACTTCCCACAGATGGTAAGG + Intronic
1096817043 12:54208389-54208411 GCCACCTCCCAGAGAGGAAGGGG + Intergenic
1101195412 12:102377045-102377067 TACACTTCCCAGAGAGGGTCTGG + Intergenic
1102611569 12:114116872-114116894 GTCACTTCCCAGGAAGCTTGAGG - Intergenic
1103562552 12:121800168-121800190 GGCCCTTCCCGGGGAGGGTGCGG - Intronic
1103845745 12:123901008-123901030 GACACGTCCCACAGAGGGTAGGG + Intronic
1104957292 12:132473054-132473076 GTCCCTTCCTGGAGAGGGCGTGG + Intergenic
1104957364 12:132473296-132473318 GTCCCTTCCTGGAGAGGGCGTGG + Intergenic
1105771870 13:23619794-23619816 GGCAGTGCCCAGGGAGGGTGGGG + Intronic
1106545363 13:30726286-30726308 GCCACTTCACAATGAGGGTGAGG + Intronic
1107723437 13:43273601-43273623 GTCTCTACCTAGAGAGGATGGGG - Intronic
1108965797 13:56299777-56299799 CTAAATTCCCAGAGAGAGTGTGG - Intergenic
1110626592 13:77661164-77661186 GTCACTTCCCAGATAGGGTGGGG + Intergenic
1111102928 13:83611237-83611259 GTTACTTCCTAGATAGAGTGAGG + Intergenic
1112464303 13:99630016-99630038 GGCACTTCTCAGATATGGTGGGG - Intronic
1113204423 13:107898633-107898655 GTGGCTTCTCAGAGAGGGTGAGG + Intergenic
1114245516 14:20909821-20909843 TTCCCTTTCCAGAGAGGGAGAGG + Intergenic
1118365063 14:65087639-65087661 GTTACTTCCTAGATAGAGTGGGG - Intronic
1119595081 14:75925630-75925652 CTCACTTCCCAGACGGGCTGGGG + Intronic
1119804766 14:77475495-77475517 GCCCCTGCCCAGACAGGGTGAGG - Exonic
1119982636 14:79099300-79099322 CTCACTGCACAGAGAGGGAGAGG + Intronic
1120416667 14:84227876-84227898 CTCACATGCCAGAGAGGGAGAGG + Intergenic
1121574201 14:94969950-94969972 GTCCCCTGCCAGAGAGGGTCAGG + Intergenic
1122401444 14:101469741-101469763 GACACTTGCCAGAGAGGGGGTGG + Intergenic
1124100344 15:26687068-26687090 CTCACTTCCCAGAGTGGCAGGGG - Intronic
1124621180 15:31274968-31274990 GTCACTTCTCAGAGACCATGAGG + Intergenic
1125180614 15:36878400-36878422 GCCACCTCTCACAGAGGGTGTGG - Intergenic
1127009071 15:54602741-54602763 GTCACTTTGGAGGGAGGGTGGGG - Intronic
1127974904 15:63990072-63990094 GTGGCTTACCACAGAGGGTGAGG - Intronic
1128567895 15:68713363-68713385 GCCATTTCCCAGAGAATGTGGGG - Intronic
1129692039 15:77719205-77719227 GTCACTGCCCAGAGGGGCTCAGG - Intronic
1132038521 15:98505676-98505698 GGCACAGCCCAGAGAGGGTCTGG + Intronic
1132410158 15:101571389-101571411 GTGGCTTCCCAGCCAGGGTGGGG - Intergenic
1132495545 16:261591-261613 GCCACTTCCCAGACAGGATTCGG + Intronic
1134156942 16:11851626-11851648 GTCATTTCCGGGAGAGCGTGGGG + Intergenic
1134750089 16:16618949-16618971 CTCACTTCCCAGACGGGGCGGGG + Intergenic
1135488131 16:22883920-22883942 GTGAGGCCCCAGAGAGGGTGAGG - Intronic
1137339476 16:47586089-47586111 GGCACTTCATAGAGAAGGTGAGG - Intronic
1137434187 16:48442162-48442184 GTGAATTCCCAGAGAGAGTGTGG + Intronic
1138192922 16:55031249-55031271 GTCACTTGACAGTGCGGGTGGGG + Intergenic
1142068487 16:88076264-88076286 GTTACTTCCCAGTGAGGCAGCGG + Intronic
1142187057 16:88699527-88699549 GCCCCATCCCAGAGAGGCTGGGG - Intronic
1142281094 16:89147947-89147969 GTTACTTCCCAGATACAGTGGGG + Intronic
1142698423 17:1645817-1645839 GGCACCTCCCTGAGAGGGAGGGG + Intergenic
1143632272 17:8146167-8146189 CTGACTTCCCAGTGGGGGTGGGG - Intronic
1147877623 17:43632644-43632666 GTTTCTTCTAAGAGAGGGTGGGG - Intergenic
1149550470 17:57535685-57535707 GTCCTTTCCCAGAGTGGCTGTGG + Intronic
1149986934 17:61354489-61354511 GTCACTTACTAGAGTGGCTGTGG - Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150712469 17:67543698-67543720 CTCATTTCCCAGAGATTGTGGGG + Intronic
1151096941 17:71509340-71509362 GTCACTCCCCAAGGAGGGTGAGG - Intergenic
1151403981 17:73875017-73875039 GTGACTTCCCAGAGAGAGACAGG + Intergenic
1151499985 17:74482315-74482337 GTCACTTGGCAGAGAGGATCGGG + Intronic
1152164356 17:78692569-78692591 CTCTCTTCTCAGAGAGGGTTGGG + Intronic
1155670338 18:28363309-28363331 ATCACTTCCTACAGAAGGTGGGG - Intergenic
1159279404 18:66266383-66266405 GACACCTACCAGAGGGGGTGGGG - Intergenic
1159340469 18:67126984-67127006 CTCACCTCCCAGACAGGGTCGGG + Intergenic
1160196257 18:76758136-76758158 GTCACGTCCCAGAGAGGACCTGG - Intergenic
1160925078 19:1540412-1540434 GTCACTTCCCAGAAACAGAGGGG - Intergenic
1162086912 19:8254786-8254808 GTCGTTTCCCAGGGAGGCTGGGG - Intronic
1164017470 19:21265285-21265307 CTCCCTTCCCAGACAGGGCGGGG - Intronic
1164547825 19:29183832-29183854 GTAGCTTCCCAGGGAGGATGAGG - Intergenic
1164828646 19:31303224-31303246 GTCTCTTCCCAGAGAGATGGGGG - Intronic
1165065087 19:33224215-33224237 GACAGTTCCTGGAGAGGGTGTGG + Intronic
1165968260 19:39603235-39603257 GTCTCTTCCCAGTAAGAGTGGGG + Intronic
1165973756 19:39656660-39656682 GTCTCTTCCCAGTAAGAGTGGGG + Intronic
1167971146 19:53188162-53188184 CTCACTTCCCAGACGGGGTGGGG + Intronic
1168030301 19:53674194-53674216 TTCACTTCCCAAGGAGGGTTTGG - Intergenic
1168188320 19:54716478-54716500 CTCACTTCTCAGAGTGGTTGTGG - Intergenic
1168300646 19:55402877-55402899 GGCACATGGCAGAGAGGGTGGGG - Intronic
927642724 2:24855619-24855641 TTCTTTTCCCAGAGAGGGTCAGG - Intronic
928095669 2:28403579-28403601 GTCACTTTCCAAAGAGGTTCAGG - Intronic
928215773 2:29360252-29360274 GACTCTTCCCAGAGAGGGAAGGG - Intronic
928899489 2:36302025-36302047 GTCACTTCCTAGTGAGGAAGTGG - Intergenic
929573626 2:43039009-43039031 ATCAGGTCCCAGAGAGGGCGAGG - Intergenic
930938680 2:56986809-56986831 ATCACTTCACAGAAAGTGTGGGG - Intergenic
932063094 2:68527762-68527784 GTCACTTCCCAGAGAGGGCGGGG + Intronic
932063152 2:68528002-68528024 GTCACTTCCCAGAGAGGGCGGGG + Intronic
933350299 2:81145334-81145356 GTTACTTCCTAGAGATGATGAGG + Intergenic
935255089 2:101303030-101303052 GACACTTCCCAGAAAGGTTGAGG - Intronic
936786888 2:116104190-116104212 GCCGCCTCCCAGAGAGAGTGGGG + Intergenic
937315716 2:120930901-120930923 TTCCCTTGCCAGTGAGGGTGGGG + Intronic
937493036 2:122389561-122389583 GTTACTTCCAAGATAGAGTGGGG + Intergenic
937716944 2:125042990-125043012 AGCACTTCCCAGAGAAGCTGAGG - Intergenic
939249646 2:139667391-139667413 ATATCTTCCCAGAGAGGTTGAGG - Intergenic
940278275 2:151962257-151962279 GTGCATTCCCAGAAAGGGTGTGG - Intronic
942276787 2:174328846-174328868 GTCTGTCCCCAGAGAGGGGGAGG - Intergenic
948254489 2:236556159-236556181 ATCAGGTCCCAGACAGGGTGAGG + Intergenic
948849995 2:240701198-240701220 GCCAGTTCCCGGAGCGGGTGTGG - Intergenic
1171077415 20:22142635-22142657 GCCTCTTCCCAGAGAGGAAGAGG + Intergenic
1172293010 20:33789575-33789597 GCCACTTACCAGAGTGGGAGAGG - Exonic
1174629743 20:51945972-51945994 GTGACTTCAAAGAGAGGGTATGG + Intergenic
1175218851 20:57405600-57405622 CACACTTCCCAGATGGGGTGGGG + Intronic
1175407246 20:58743250-58743272 GTCAGTACCCAAAGAGGATGAGG + Intergenic
1175473824 20:59254520-59254542 GTCACTTCCTAAAGAGGGGCAGG - Exonic
1177207739 21:18029899-18029921 GTCATGTCCCAGAGATGATGTGG - Intronic
1177788296 21:25695653-25695675 CTCACTTCCCAGACGGGGCGGGG + Intronic
1178681901 21:34679628-34679650 GTTACTTCCCAGATACGATGGGG + Intronic
1178683159 21:34690181-34690203 CTCACAGCTCAGAGAGGGTGAGG + Intronic
1178705005 21:34865760-34865782 GCCACTTCCCAGATGTGGTGAGG - Intronic
1179528027 21:41996507-41996529 GTTACTTCCCAGATACAGTGGGG - Intronic
1179615973 21:42583712-42583734 GTCACTTCCCAGGGTGGGGGGGG + Intergenic
1180045303 21:45302429-45302451 GCCACAGCCCAGCGAGGGTGAGG - Intergenic
1180183576 21:46128763-46128785 CTCACATCCCAGAGAGGCTGAGG + Intronic
1181658109 22:24318101-24318123 CTCACTTCCCAGACGGGGTGGGG + Intronic
1183302550 22:37065472-37065494 CTCACCTCCCAGTGAGGGTCTGG + Exonic
1183497146 22:38153340-38153362 CTCACTTCCCAGACAGGGCGGGG - Intronic
1183951882 22:41357013-41357035 GGCAGATCCCAGAGAGGGTCAGG + Intronic
1185043560 22:48517829-48517851 GTGCCTGCCCAGAGAGGGCGGGG - Intronic
949665408 3:6332519-6332541 GTTACTTCCTAGATAGAGTGGGG - Intergenic
950097353 3:10337885-10337907 GGGATTTCCCTGAGAGGGTGGGG - Intronic
950110774 3:10417253-10417275 CTCACTTCCCAGAGAGTGTGGGG + Intronic
950681268 3:14586553-14586575 GGCACTTCCCAGAGGAAGTGGGG + Intergenic
952762084 3:36923803-36923825 GCCACTGCCCAGATTGGGTGAGG + Intronic
953514548 3:43577368-43577390 CTCACTTCCCAAACAGCGTGTGG + Intronic
954329580 3:49882491-49882513 GGCTGTTCCCAGGGAGGGTGAGG - Intergenic
954684952 3:52365310-52365332 GTCACATCCCAGTGAGGGCCAGG - Intronic
954751401 3:52816158-52816180 GTCACTGCCCACAGAGGACGAGG + Intronic
954996693 3:54888300-54888322 GACACTTCCGAGAGAGAGGGAGG + Intronic
955344559 3:58151478-58151500 GTCACCTCCCAGAGAGAGCTTGG + Intronic
956178625 3:66498426-66498448 GTAACTTCCCAGAGAGGGCAGGG - Intronic
956792099 3:72687943-72687965 ATCACTACCCTGAGAGGGCGGGG - Intergenic
956977593 3:74599687-74599709 GTCATTTCCCACAGAGGCTTTGG - Intergenic
962422759 3:135242477-135242499 GCAACTTCCCAGAGAGACTGTGG + Intronic
963292936 3:143511712-143511734 GCCACTTCACAGAGAGGCTGAGG - Intronic
964060675 3:152518432-152518454 GCCACTACCCAGAGAGGTGGAGG - Intergenic
964478967 3:157123208-157123230 GAAACTGCCCAGAGAGAGTGAGG + Intergenic
966844475 3:184117321-184117343 GTCAGTTGCCAAAGAGGGTTTGG + Intergenic
966918762 3:184599027-184599049 GTGACCTCCCAGAGAGGCTCGGG + Intronic
969683543 4:8656506-8656528 GTCCCTTCCGAAAGAGGCTGGGG + Intergenic
970580679 4:17471570-17471592 TTCACTCCCCAGAGAGGGGCAGG - Intronic
972106571 4:35495127-35495149 GTCAGTTCCCTGTGAGGCTGTGG - Intergenic
975071079 4:70139041-70139063 TTCCCTTCCCAGAGAGGATCTGG - Intronic
975516583 4:75254636-75254658 GACACCTCCCAAAGGGGGTGTGG + Intergenic
978653332 4:111035292-111035314 GAAAATTCCCAGAAAGGGTGAGG - Intergenic
979702479 4:123684889-123684911 CTCACTTCCTAGACAGGATGAGG - Intergenic
979846929 4:125525283-125525305 TTCACTTCCCAGAGAGGTAGGGG - Intergenic
982143100 4:152348840-152348862 GGCACTTCCACCAGAGGGTGTGG - Intronic
983000470 4:162408537-162408559 GCCACCTCCCTGAGAGGCTGTGG + Intergenic
983906082 4:173184062-173184084 CTCACTTCCTAGACAGGATGAGG + Intronic
985587155 5:746392-746414 GTCACTGCCCAGGGAGGCTCTGG + Intronic
985601722 5:838575-838597 GTCACTGCCCAGGGAGGCTCTGG + Intronic
985660642 5:1155341-1155363 GTCACTTCGCGGGGAGGGCGGGG - Intergenic
986102468 5:4626718-4626740 GTGAGTTTCCAGAGAGGATGTGG + Intergenic
986109179 5:4693967-4693989 GTCCCTTCCCAGAGAGGAGCAGG + Intergenic
987565249 5:19575785-19575807 TAGAGTTCCCAGAGAGGGTGTGG - Intronic
990187483 5:53223763-53223785 GTCCCTCCCCAGTAAGGGTGTGG + Intergenic
991972830 5:72157542-72157564 GTCAGTCCCCAGGGAGGGTGGGG - Intronic
992685438 5:79194957-79194979 TATACTTCCCAGTGAGGGTGGGG + Intronic
993119054 5:83753401-83753423 GGTACAGCCCAGAGAGGGTGAGG + Intergenic
995421078 5:111967632-111967654 CTCACTTCCCAGACAGGGCGGGG - Intronic
995828539 5:116328955-116328977 GTTACTTCCCAGATACAGTGGGG + Intronic
997651944 5:135528658-135528680 GTCACTTCCCAGAGAGGCTCAGG - Intergenic
998511450 5:142717812-142717834 GTCACCTGCTAGAGAGGGAGGGG + Intergenic
998530199 5:142877275-142877297 AACGCTTCCCAGAGAAGGTGCGG - Intronic
999448386 5:151659562-151659584 GTCCCTTCACAGAGGGAGTGTGG + Intergenic
999730387 5:154473042-154473064 CTCTCTTCCCAAAGAGGGTTTGG + Intergenic
1000808374 5:165827083-165827105 GTCACTTCACCCAGAGGGTAGGG + Intergenic
1001608579 5:172982000-172982022 GCCAGTTCTCAGAGAGGTTGAGG - Intergenic
1001673052 5:173490562-173490584 GTCACTTACCAGAGGGGAGGGGG - Intergenic
1002453441 5:179332257-179332279 GTGAGTGCCCAGAGAGGGCGTGG - Intronic
1002453985 5:179335865-179335887 GTGAGTGCCCAGAGAGGGCGTGG - Intronic
1002592322 5:180299260-180299282 GTCAGTTCCCAGAGAAGCAGGGG + Intergenic
1003840931 6:10118601-10118623 GTCATTTCACAAAGTGGGTGAGG - Intronic
1005243389 6:23855650-23855672 GTCACTTCCCAGACAGGGCGGGG - Intergenic
1005382189 6:25246991-25247013 GACACTTCCCAGAGAAAGTGAGG + Intergenic
1005583051 6:27251452-27251474 GGCGCTCCCCAGAGAGGGCGGGG + Intronic
1006396584 6:33791255-33791277 GTTCCTTCTCAGAGGGGGTGGGG - Intergenic
1006831493 6:36970832-36970854 GTCACTGCCCAGAGAAGGCCTGG + Intronic
1007417877 6:41702636-41702658 GTCCCTCCCCAGGGAAGGTGAGG + Intronic
1008337407 6:50324159-50324181 GTTACTTCCCAGATAGAGTGGGG + Intergenic
1008574477 6:52846980-52847002 GTCACAACACACAGAGGGTGAGG + Intronic
1009398436 6:63228795-63228817 GTCACTTCCCAGACAGGGTGGGG + Intergenic
1009902206 6:69821271-69821293 GTCACTTTCCTGAGATAGTGAGG - Intergenic
1013609012 6:111776647-111776669 ATATCTTCCCAGAAAGGGTGTGG - Intronic
1013759486 6:113500145-113500167 GACATTTCCCAGCAAGGGTGTGG - Intergenic
1016515708 6:144891407-144891429 CTCACTTGGCAGAGAGGTTGAGG - Intergenic
1017524716 6:155232449-155232471 GTCAAGCCCCAGAAAGGGTGTGG - Intronic
1017856023 6:158350190-158350212 CTCACTTCCTAGACAGGGTGGGG + Intronic
1019492544 7:1322032-1322054 GTCACTTCCCTGTGGGGGTGAGG + Intergenic
1019613095 7:1946817-1946839 GACAAGGCCCAGAGAGGGTGCGG + Intronic
1020055451 7:5114753-5114775 CTCCATTCCCAGAAAGGGTGGGG + Intergenic
1020214752 7:6181367-6181389 GTCACTCACAAGAGAAGGTGAGG - Intronic
1020546698 7:9541514-9541536 GTCACTTCCCAGATACAATGAGG - Intergenic
1020590264 7:10126877-10126899 GTCTATTCCCAGAGAGGCTCAGG - Intergenic
1020677594 7:11199550-11199572 GTCTCTTCCTAAAGAAGGTGGGG - Intergenic
1021493505 7:21246609-21246631 CTCACTTCCCAGATGGGGTGGGG + Intergenic
1021493517 7:21246649-21246671 CTCACTTCCCAGACAGTGGGGGG + Intergenic
1021560410 7:21963746-21963768 GTTACTTCCCAAAGAGGCAGCGG - Intergenic
1022694655 7:32692480-32692502 CTCACTACACAGAGATGGTGTGG - Intergenic
1022927836 7:35073980-35074002 CTCACTACACAGAGATGGTGTGG - Intergenic
1024513459 7:50221283-50221305 GCTTCTTCCCAGAGAGGGAGGGG - Intergenic
1025019003 7:55466063-55466085 GTCACTTGGCAGAAAGGGTGAGG - Intronic
1027958952 7:84919357-84919379 GTTACTTCCAAGATAGAGTGGGG + Intergenic
1028624437 7:92862561-92862583 GTCACTTCCTAGATACAGTGGGG + Intergenic
1028868331 7:95738132-95738154 ATCTCTTCACAGAAAGGGTGGGG - Intergenic
1029167179 7:98600658-98600680 GACACTTCTCACAGTGGGTGTGG - Intergenic
1029361469 7:100091359-100091381 GTCACTTCCCCAGGAGGGAGAGG - Intronic
1029446401 7:100615208-100615230 GACCCTGCCCAGGGAGGGTGGGG - Exonic
1031022081 7:116638954-116638976 CTCACTTCCCAGACAGGGCCTGG - Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1032461206 7:132112965-132112987 GACAGGTCCCAGAGAGGGTCTGG + Intergenic
1034157423 7:148967067-148967089 GGCAAGTCCCAGAGAAGGTGAGG + Intergenic
1034954904 7:155328078-155328100 GTCCCTTCCCAGAGACGGGGTGG + Intergenic
1035225802 7:157431508-157431530 GACACTTCCTGGAGTGGGTGCGG + Intergenic
1036603127 8:10281751-10281773 GCTACTTCACAGACAGGGTGGGG - Intronic
1037862304 8:22414168-22414190 GTCACTTATCAAAGAGGGAGGGG - Intronic
1038461376 8:27720186-27720208 CTTACTTGCCAGAGAGGGTGAGG - Intergenic
1041674269 8:60522194-60522216 GGCAGATCCCAGAGAGGGAGTGG + Intronic
1042772045 8:72391409-72391431 GTCACTCCCCAATAAGGGTGTGG - Intergenic
1044572907 8:93740001-93740023 GTCATTTTCCAGATATGGTGAGG + Intronic
1045358629 8:101411863-101411885 GCCTATTCCCAGGGAGGGTGTGG - Intergenic
1046649313 8:116819327-116819349 GTCACTTCTCCCTGAGGGTGTGG - Intronic
1046689499 8:117267164-117267186 GTTACTTCCAAGATAGAGTGAGG + Intergenic
1046816760 8:118592973-118592995 TTCTCTTCTCAGGGAGGGTGGGG + Intronic
1046846127 8:118918558-118918580 GTAACTTCACAGAAGGGGTGAGG + Intergenic
1048454475 8:134565613-134565635 GGCACTCCCCAGGGAGGGAGAGG + Intronic
1048839447 8:138551970-138551992 GTCACTTCCAAGATACAGTGGGG - Intergenic
1051396445 9:16626969-16626991 GTAACTTCCCAGTGACAGTGAGG + Intronic
1052413522 9:28149466-28149488 GTCACTTCCCAGAGAGGGCGGGG - Intronic
1053365736 9:37521299-37521321 CTCACTTCCCAGACAGCGTGGGG - Intronic
1053365747 9:37521339-37521361 CTCACTTCCCAGACAGTGTGGGG - Intronic
1053553436 9:39108273-39108295 CTCACTCCCCAGAGAGGGGGGGG - Intronic
1053817540 9:41928430-41928452 CTCACTCCCCAGAGAGGGCGGGG - Intronic
1054107796 9:61072102-61072124 CTCACTCCCCAGAGAGGGCGGGG - Intergenic
1054613061 9:67259023-67259045 CTCACTCCCCAGAGAGGGCGGGG + Intergenic
1056576099 9:87857253-87857275 CTCACTTCCCAGATGGTGTGGGG + Intergenic
1057071815 9:92105681-92105703 GTCACTTCCCAGAGAGGGTGGGG - Intronic
1057335480 9:94151710-94151732 GTCATCTCGGAGAGAGGGTGCGG + Intergenic
1057705884 9:97394716-97394738 ATTACTTTCCAGAGAGGCTGTGG - Intergenic
1059328972 9:113523260-113523282 GAGACTTTCCAGAGAGGCTGTGG + Intronic
1059778171 9:117497852-117497874 GTCACTTCAGACAGAGGGTGAGG + Intergenic
1060422450 9:123479041-123479063 CTCTCCTCTCAGAGAGGGTGGGG + Intronic
1062424473 9:136499661-136499683 GGCTCTGCCCAGAGAGGGGGTGG + Intronic
1186846177 X:13533281-13533303 GCCAGATCCAAGAGAGGGTGCGG + Intergenic
1188194495 X:27215811-27215833 GAAACTGCCCAGAGAGAGTGTGG + Intergenic
1190971679 X:55356290-55356312 GGCACAACCCAGAGAGAGTGAGG + Intergenic
1192279040 X:69663982-69664004 GTTACTTCCCAGATACAGTGGGG - Intronic
1194929494 X:99868473-99868495 GTCACTTCCTAGATACAGTGTGG - Intergenic
1195796722 X:108656657-108656679 GACACTGCCCAGTGATGGTGAGG - Intronic
1195979060 X:110558809-110558831 CTCACTTCCCAGACAGTGTGGGG + Intergenic
1198189069 X:134285856-134285878 TACACCTCCCAGACAGGGTGGGG + Intergenic
1198236287 X:134738569-134738591 TGTACTTCCCAGAGAGGGTGGGG - Intronic
1201335715 Y:12878549-12878571 CTCACTTCCTAGACGGGGTGGGG - Intergenic
1202086464 Y:21141763-21141785 GCCACTTCCCAGAAAGGGAAAGG - Intergenic