ID: 1057072025

View in Genome Browser
Species Human (GRCh38)
Location 9:92106849-92106871
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 2, 1: 5, 2: 6, 3: 48, 4: 277}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057072025 Original CRISPR CCTTCTGAAGGGAGGCTGGA AGG (reversed) Intronic
900139492 1:1133609-1133631 CCTGTGGAAGGGAGGCTGGGAGG - Intergenic
900153946 1:1196581-1196603 GCTTCTGCAGGGAGGCAGGGAGG - Exonic
900331967 1:2139731-2139753 TCTTTTGAAGAGAGGCAGGATGG - Intronic
900515351 1:3079271-3079293 CCCTCTGATGTGAGGCTGGAAGG - Intronic
900520435 1:3102773-3102795 CCTGCGGAAGGGACTCTGGAAGG + Intronic
900735214 1:4295412-4295434 CCTGCTGATCAGAGGCTGGAAGG - Intergenic
900799455 1:4728312-4728334 CCTTCCGATGGCATGCTGGAGGG + Intronic
901197579 1:7448720-7448742 CCTTATAAAAAGAGGCTGGAGGG - Intronic
901685582 1:10941789-10941811 CCTTCTGAGGGGCCTCTGGAGGG - Intergenic
902375309 1:16027568-16027590 CCTCCTTCAGGGAGGATGGAAGG + Intronic
902797319 1:18808058-18808080 CCCTGTGAATGGAGGCTGGGGGG - Intergenic
903029353 1:20451878-20451900 CCTGCTGAGGGGTTGCTGGAGGG - Intergenic
903159714 1:21477977-21477999 CCTTCTAAATGCAGGCTGGAGGG - Intronic
904577914 1:31517376-31517398 GACTCTGCAGGGAGGCTGGAGGG - Intergenic
905328899 1:37178244-37178266 CCTACTGAAGGGGGGCAGGCAGG - Intergenic
905502291 1:38449330-38449352 CCCTCTGAAGGGCTGCTGGGTGG - Intergenic
905803197 1:40858974-40858996 CCTTTTGGAGGGATGCAGGAGGG + Intergenic
906182815 1:43836567-43836589 CCTGCAGAAGGCAGCCTGGAGGG + Intronic
914189374 1:145395286-145395308 CCTTCTAAATGCAGGGTGGAGGG + Intronic
914211222 1:145580998-145581020 CCTTCTAAATGCAGGGTGGAGGG + Intergenic
914977540 1:152379978-152380000 CCATCTCAGGGGAGGCTGCAAGG - Intergenic
915204915 1:154262978-154263000 AATTCTGAAGGGAGGCAAGAAGG - Intronic
916605299 1:166336323-166336345 CCTTCTCCAGGGCGGCTGGCTGG + Intergenic
917016004 1:170532043-170532065 ACTGCTGAAGGCAGCCTGGAAGG + Intergenic
917884364 1:179368849-179368871 CATTCTGAAGGGAAGTAGGAAGG - Exonic
920265084 1:204715642-204715664 CCTTCTGAGTGGAGGCTGTTAGG + Intergenic
920327747 1:205179877-205179899 CCTTCTGAGTAGAGGATGGATGG - Intronic
920967163 1:210710949-210710971 CATTTTGAAGGGAAGCTGGTGGG - Intronic
921379627 1:214511195-214511217 GCTTCTGAAGTTAGGCTGAATGG + Intronic
921526287 1:216222570-216222592 CCTTATAAAGGAAGGCAGGAGGG + Intronic
922344102 1:224681686-224681708 GCTTCTGAATGGATGCTGGGTGG + Intronic
923029250 1:230234260-230234282 GCTTCTGAAGGGAAGTTGGAGGG + Intronic
924006054 1:239612749-239612771 CCTTCTGAAGTGAGGTGGGATGG + Intronic
924093739 1:240529064-240529086 CCTACTGAATGAAGGCTAGAAGG - Intronic
1064705299 10:18066817-18066839 CCTTCTTAGGTGAGGCTGGATGG + Intergenic
1064894381 10:20217555-20217577 CCTTCTGTAGGGAGGCTGGTGGG - Exonic
1066431091 10:35352600-35352622 CATCCAGCAGGGAGGCTGGACGG - Intronic
1066695293 10:38071958-38071980 CCTGCTGAATGGAGGAAGGATGG - Intergenic
1067947125 10:50696631-50696653 CCTTCTGAAGGGAAGCTGGAAGG - Intergenic
1070882436 10:79861621-79861643 CCTTCTGAAGGGAAGCTGGAAGG - Intergenic
1071116014 10:82221402-82221424 CATTATGGAGGGGGGCTGGAAGG - Intronic
1071162648 10:82768080-82768102 CCTTTAGAAAGGAGCCTGGAAGG - Intronic
1071649006 10:87377932-87377954 CCTTCTGAAGGGAAGCTGGAAGG - Intergenic
1072735842 10:97879128-97879150 TCTTCAGAAAAGAGGCTGGAAGG + Intronic
1073273105 10:102283540-102283562 CCTTCTGCTAGGAGGCTGGGAGG + Intronic
1073981280 10:109156571-109156593 CTTGCTGAAGGCAGGCTGGCAGG - Intergenic
1074553145 10:114463853-114463875 CCTTCCAAAGTGAAGCTGGAGGG - Intronic
1075747093 10:124735650-124735672 AGGACTGAAGGGAGGCTGGAAGG - Intronic
1075879911 10:125842198-125842220 CCTACTGCAGGGAGGCTGGCAGG - Intronic
1076264963 10:129102582-129102604 ACTTCTGACAGCAGGCTGGAGGG - Intergenic
1076895733 10:133310468-133310490 CCTGCCGAAGGGAGGCTGGAGGG + Intronic
1077118849 11:897667-897689 CTGTGTGAAGGGAGGCTGGGAGG - Intronic
1078405680 11:11068117-11068139 GCTTCTGCAGGGAGAGTGGAGGG + Intergenic
1080464903 11:32487484-32487506 GCTTCTGAACAGTGGCTGGATGG - Intergenic
1080605866 11:33864554-33864576 CCCTCGGAAGGGAGGCTGGGTGG - Intronic
1082729412 11:56776567-56776589 CCTGGTGAAGGGATGCAGGAGGG + Intergenic
1083548214 11:63564669-63564691 CCTTCTGGAGGGAGACAGTAGGG + Intergenic
1083749341 11:64752801-64752823 ACATCTGAAGTGAGCCTGGAAGG - Intronic
1085447593 11:76611000-76611022 CCTCCTGCAGGGATGCTGGTGGG + Intergenic
1088820660 11:113453924-113453946 CCTTTTGATGGGGGGCTGGGGGG + Intronic
1089376968 11:118001127-118001149 CCCTCTGGAGGCAGGCTTGAGGG + Exonic
1089573292 11:119423648-119423670 CTTTCTGAAAGGAAGCTGGTTGG + Exonic
1090381137 11:126328496-126328518 GCTGCTGAGGGGAGGCGGGAGGG + Intronic
1090424321 11:126596483-126596505 CCTTCTGAAGGGGGGAAGGTAGG + Intronic
1090438565 11:126707889-126707911 CTTTCTCAAGGGAGGCAAGAAGG - Intronic
1091272675 11:134328845-134328867 TCTCCTGAGGGGAGGGTGGATGG + Intergenic
1091491570 12:937118-937140 CCATCTAAAGGAAGGGTGGACGG - Intronic
1091654224 12:2333562-2333584 GCTACTGGAAGGAGGCTGGATGG - Intronic
1091841467 12:3624290-3624312 CCTGGAGAAGGGAGGGTGGAGGG - Intronic
1092960933 12:13596470-13596492 CCTTCTGAGATGAGGATGGAGGG + Intronic
1093764832 12:22951681-22951703 CCTTATGTAGGTAGACTGGACGG + Intergenic
1093820919 12:23616479-23616501 CCTCCTGAAGGGAGTAAGGAAGG + Intronic
1093925309 12:24903155-24903177 CCTCCCCAAGGGATGCTGGAGGG - Intronic
1096605206 12:52760201-52760223 CATTCTGCAGGGATTCTGGAGGG - Intergenic
1097008799 12:55938062-55938084 CCTTCTGAAGTGAGGTGGCAGGG + Intronic
1098683242 12:73384860-73384882 TCTTCTGTAGGTTGGCTGGATGG + Intergenic
1101332191 12:103766119-103766141 CCTTGTGTTGGGAGGCAGGATGG - Intronic
1103663245 12:122539209-122539231 GCTTGTTAAGGGAGGCAGGAAGG + Intronic
1104710603 12:130983003-130983025 CATTCTTAAGGGAGGCTGCATGG + Intronic
1105846827 13:24300697-24300719 CCTTCAGAGGGGCTGCTGGAGGG + Intronic
1112391866 13:98992403-98992425 CCAACTGAAGGGAAGCTGGGAGG - Intronic
1112568840 13:100575070-100575092 CCTTCTGAAAAGTTGCTGGAGGG - Intronic
1113458528 13:110465767-110465789 GCTGCTGAGGGGAGGCTGGTGGG - Intronic
1113639205 13:111945040-111945062 CCCGCTGAGGGCAGGCTGGAAGG - Intergenic
1114261497 14:21039997-21040019 CCTTTGGAGTGGAGGCTGGATGG - Intronic
1114701298 14:24681020-24681042 CCCTCATAAGAGAGGCTGGATGG + Intergenic
1115642189 14:35341884-35341906 CCCAGTGAAGGGAGGCTGGGAGG - Intergenic
1116166981 14:41346398-41346420 CCTTTTGAAGGGAGGAGGGTGGG + Intergenic
1118893501 14:69927768-69927790 TTTTCTGAAGGGAGGCTAGCAGG + Intronic
1119176978 14:72575559-72575581 CCTTCTGCAGGCAATCTGGACGG - Intergenic
1119235374 14:73015223-73015245 CCATCTGAAGGAAGGAAGGAAGG + Intronic
1120602086 14:86523468-86523490 CCTTGAAAAGGGAAGCTGGATGG - Intergenic
1121091983 14:91189211-91189233 CTTTGTGGACGGAGGCTGGAGGG + Intronic
1122131483 14:99606387-99606409 CATTCTGCAGGGAGCCTGCAAGG - Intergenic
1123881017 15:24677384-24677406 CCTTGTGACGGGAGGCTTGAAGG - Exonic
1126447631 15:48766509-48766531 CCTCCTTCAGGGAAGCTGGAGGG - Intronic
1127394978 15:58537347-58537369 CCCCCAGAAGAGAGGCTGGAAGG + Intronic
1128345528 15:66850379-66850401 CCTTCTGAAGATAGGCTCAAGGG - Intergenic
1128836547 15:70813429-70813451 CCATTTGAAGGTAGGATGGATGG + Intergenic
1131013416 15:89038294-89038316 TCTTCTGCGGGGAAGCTGGAAGG - Intergenic
1131559508 15:93427241-93427263 CCTTCTGAAGGGAACGAGGAGGG + Intergenic
1131896150 15:97031990-97032012 CCTTCTGGAGGGTGGATGGTAGG + Intergenic
1131983497 15:98018179-98018201 CCTTGTGAATGGTGCCTGGATGG + Intergenic
1132070945 15:98776109-98776131 ACTCCCGAAGGGAGGGTGGAAGG + Intronic
1132503055 16:293195-293217 CAGTCTGCAGGGAGGCTGCAGGG - Intronic
1135817821 16:25652060-25652082 CCATCTGAATGCAGGATGGATGG + Intergenic
1138750920 16:59420194-59420216 ACTTGGGAGGGGAGGCTGGAAGG - Intergenic
1139543817 16:67639207-67639229 CCTGCTTGAGGGAGGCTGGGGGG + Intergenic
1139682290 16:68574368-68574390 CCTTGTGCAGGCAGGCTAGAGGG + Intronic
1139955139 16:70689596-70689618 TCTTCAGCAGGGAGGCGGGAAGG - Intronic
1140942078 16:79731411-79731433 ACATCTGTAGGGAGGCTGAAAGG + Intergenic
1141100979 16:81197370-81197392 CATTCTGAAAGGAGGTAGGATGG - Intergenic
1141832394 16:86517022-86517044 CCTGCTGGTGGGTGGCTGGAAGG - Intergenic
1142018472 16:87765462-87765484 CCCTCTGAAGGGAGGCTGGGTGG - Intronic
1142122967 16:88396388-88396410 CCATCTGAAGGGAGGCCAGGAGG + Intergenic
1142122976 16:88396415-88396437 CCTCCTGAAGGGAGGCTGGGAGG + Intergenic
1142122985 16:88396442-88396464 CCTTATGAAGGGAGGCCGGGCGG + Intergenic
1142122994 16:88396469-88396491 CCTCCTGAAGGGAGGCCGGGAGG + Intergenic
1142123012 16:88396523-88396545 CCGTCTGAAGGGAGGCCGGGAGG + Intergenic
1142123019 16:88396550-88396572 CCTCCTGAAGGGAGGCCAGATGG + Intergenic
1142123029 16:88396577-88396599 CCTCCTGAAGGGAGGCCGGGCGG + Intergenic
1142123039 16:88396604-88396626 CCATCTGAAGGGAGGCCGGGAGG + Intergenic
1142123048 16:88396631-88396653 CCTCCTGAAGGGAGGCCGGGCGG + Intergenic
1142123058 16:88396658-88396680 CCTCCTGAAGGGAGGCCGGGAGG + Intergenic
1142123066 16:88396685-88396707 CCGTCTGAAGGGAGGCCAGATGG + Intergenic
1142123075 16:88396712-88396734 CCTCCTGAAGGGAGGCCGGGAGG + Intergenic
1142123093 16:88396766-88396788 CCTCGTGAAGGGAGGCCGGGAGG + Intergenic
1142123115 16:88396847-88396869 CCTCCTGAAGGGAGGCCGGGAGG + Intergenic
1142123125 16:88396874-88396896 CCTCCTGAAGGGAGGCCGGGTGG + Intergenic
1142123135 16:88396901-88396923 CCTCATGAAGGGAGGCCGGGAGG + Intergenic
1142123143 16:88396928-88396950 CCGTCTGAAGGGAGGCCAGGAGG + Intergenic
1142123160 16:88396982-88397004 CCTCCTGAAGGGAGGCCGGGAGG + Intergenic
1142123170 16:88397009-88397031 CCTCCTGAAGGGAGGCCGGGAGG + Intergenic
1142186584 16:88697722-88697744 CCTGCTGGAGGGAGGCAGGAAGG - Intronic
1142288879 16:89183634-89183656 CCTCCTGCAGGAAGGCTGGCCGG - Exonic
1142684392 17:1569401-1569423 CCCTCGGAAGGGAGCCTGAAGGG - Intronic
1142740872 17:1931295-1931317 GCTTCAGAACGGGGGCTGGAAGG + Intergenic
1142781830 17:2187100-2187122 TGTGCTGAAGGAAGGCTGGAAGG - Intronic
1143140898 17:4741177-4741199 GCTTCCGAAGGGAGGATGGCTGG - Intronic
1144473128 17:15562250-15562272 CCCTCTGTAGCCAGGCTGGATGG + Intronic
1144711497 17:17404315-17404337 CCCTCTGATGGGAGGAGGGAAGG + Intergenic
1144831847 17:18136311-18136333 CATGGAGAAGGGAGGCTGGAGGG - Intronic
1144832967 17:18141955-18141977 CCTCCTGGAGCGGGGCTGGAGGG - Intronic
1144857202 17:18275991-18276013 CAGTGTGAAGGGAGGCTGGCTGG - Intronic
1144923353 17:18782470-18782492 CCCTCTGTAGCCAGGCTGGATGG - Intronic
1145762214 17:27431641-27431663 CCTTATTAAGGGCAGCTGGATGG - Intergenic
1145870927 17:28272360-28272382 ACTTCTGAAGGCAGGCTGCCCGG + Intergenic
1146950457 17:36901730-36901752 TCTTCTGCAGCGAGGCTGGTGGG + Intergenic
1147188350 17:38724996-38725018 CCCTCAGAGGGGAGGCAGGAAGG - Intronic
1147386889 17:40088265-40088287 CCTCCTGAAGGGGTGCTGCATGG + Exonic
1148784702 17:50140407-50140429 CCTTCCCAAGGGAGGCAGGAAGG + Intronic
1150640445 17:66946189-66946211 CCCGCTGGAGGGAGGCTGGAAGG - Intergenic
1150650899 17:67009480-67009502 CCTTCTTAAAGGAAGCTGCATGG - Intronic
1151206658 17:72513030-72513052 TCTTCTGGTGGGAGGATGGAGGG - Intergenic
1151943373 17:77306298-77306320 CTCTCTGAAGGGTGGCTGTATGG + Intronic
1152114832 17:78378981-78379003 CCTTCTTGAGGGAGGGTGGGCGG + Intronic
1152147596 17:78577525-78577547 CATTTTGAGGGGAGGTTGGAGGG + Intergenic
1152670284 17:81600045-81600067 CCTCATGAAGTGTGGCTGGAAGG + Intronic
1152898056 17:82925021-82925043 CTTTCAGAAGGAAGCCTGGAAGG - Exonic
1153141828 18:1981349-1981371 CCTACTAGAGGGAGGATGGAAGG - Intergenic
1153229303 18:2921164-2921186 CCTGCAGAAGGGAGGCAGGTTGG + Intronic
1153517698 18:5919709-5919731 GCTTCTGAAGGGAGAGAGGAGGG - Intergenic
1154201324 18:12302556-12302578 CCTGCTGCAGGGAGGCTGGTGGG - Intergenic
1155547686 18:26931696-26931718 CCTCCTGAAGCAAGGCTGGAGGG + Intronic
1155558782 18:27052022-27052044 GTTTCAGAAGGGAGGCTGAAAGG + Intronic
1157478285 18:48037057-48037079 GCCTCTGAAGGGAGGCAGGCTGG + Intronic
1157500061 18:48184058-48184080 CCCTCTGAAAAGATGCTGGAGGG - Intronic
1157674744 18:49560892-49560914 CCGGCTGGAGCGAGGCTGGATGG + Intronic
1160958841 19:1708241-1708263 CCTCCTGGAAGGAGGCAGGAAGG - Intergenic
1163442117 19:17327566-17327588 CCTTCTGCAGGGCGGCAGGAGGG + Exonic
1163586756 19:18168555-18168577 CCGTCTGGAGGGAGGCAGGGAGG + Intronic
1166274730 19:41745136-41745158 CCCTCTGAAGAGAGGATTGATGG - Intronic
1167263610 19:48472536-48472558 CCCTCTGCGGGGAGGCTGCAGGG - Intronic
1167506804 19:49875245-49875267 CCTCCTAAAGGCAGGCAGGATGG - Intronic
1167935497 19:52903531-52903553 CCATCAGAAGGAAGCCTGGATGG - Intergenic
1168110782 19:54190405-54190427 CATTCTGAAGGGAGGCAAGGAGG + Exonic
925046142 2:774112-774134 CCTGCTGTGGGGAGGCAGGATGG - Intergenic
926332775 2:11838715-11838737 CCCTGTGCTGGGAGGCTGGAGGG + Intergenic
926991869 2:18688977-18688999 CCTCCTGCAGCGAGGATGGAAGG - Intergenic
927680704 2:25137242-25137264 CAATCTGAAGGGGGGCAGGATGG - Intronic
931459797 2:62440711-62440733 TCTTCATAGGGGAGGCTGGAGGG - Intergenic
932167464 2:69521150-69521172 CCTTCTGAAAGTAGGCTTGGTGG + Intronic
933648456 2:84830761-84830783 CCGCCTGAAGGGAGACTGGCAGG + Intronic
937338841 2:121078039-121078061 GCCTCGGAAGGGAGCCTGGACGG + Intergenic
938654086 2:133412941-133412963 CCTTCTGCAGGGAGGGAGGAAGG + Intronic
938872410 2:135494053-135494075 CCATCTGAAGGATGGATGGATGG + Intronic
940594260 2:155769399-155769421 CCTTCTGAGGTGAGGTAGGAAGG + Intergenic
942761034 2:179398437-179398459 CCTTTGGAAGGGCGCCTGGAAGG + Intergenic
942951668 2:181728821-181728843 CCTCATGAAGGGAGGCTGATGGG - Intergenic
945593072 2:211758262-211758284 CATTCTGAAGGCATGTTGGAAGG - Intronic
946044533 2:216810395-216810417 CTTTCTGCAGGGAAGCTGGAAGG + Intergenic
946155064 2:217801842-217801864 CCTTCCGCAGGGATGCTGGGAGG + Exonic
948732821 2:239977956-239977978 TCTGCTGAGGGGAGGCTGGAGGG - Intronic
948888591 2:240896275-240896297 TCTTCTGAAGGGAGGGAGGAGGG - Intronic
1168861629 20:1049819-1049841 CCTTCTAAGGTGAGACTGGAAGG - Intergenic
1169205716 20:3739514-3739536 GCTTGGGAAGGGAGGCAGGAAGG - Intronic
1169686171 20:8275127-8275149 TCTTGAGAAGGGAGGCTGAAGGG + Intronic
1171171296 20:23017701-23017723 CCTTCTGAGCGAAGGATGGAGGG - Intergenic
1172162135 20:32876071-32876093 GGTGCTGGAGGGAGGCTGGAGGG + Intronic
1173875974 20:46371776-46371798 CCATCTCAGGGGAGGCTGGCGGG - Intronic
1175774797 20:61646382-61646404 CCTTCAGAAGGGTGGCTGTCAGG - Intronic
1178919282 21:36728167-36728189 ACTTCTGAGAGGTGGCTGGAAGG + Intronic
1179064720 21:38014445-38014467 TCTTGGGAAGGGAGGTTGGAGGG + Intronic
1179571858 21:42283205-42283227 CCTTCTGAGGGGGGGATGGCGGG + Intronic
1180056212 21:45360392-45360414 CCTTATCCAGGGAGGCAGGAGGG + Intergenic
1181079016 22:20401503-20401525 CGTGCTGAAGGGAGGCAGGCAGG - Intronic
1182411789 22:30193454-30193476 CCTTGTGAAAGGGGTCTGGAGGG + Intergenic
1183368136 22:37417916-37417938 CCTTCTGCAGGGAGGCGAGGGGG + Exonic
1184517332 22:44970717-44970739 CCCTGAGAAGTGAGGCTGGAGGG - Intronic
1184541663 22:45129773-45129795 TCAGCTGAAGAGAGGCTGGAGGG + Intergenic
1185162262 22:49237066-49237088 CCCTGTGCAGGGAGGCTGGCTGG - Intergenic
950494326 3:13324554-13324576 CATCCAGAAGTGAGGCTGGAGGG - Intronic
950566508 3:13772643-13772665 CCTGCTGCAGGGGTGCTGGAAGG + Intergenic
954478657 3:50775741-50775763 CTTGCTGGAGGGAGGGTGGAAGG - Intronic
954637318 3:52078127-52078149 TCCTCTGAAGCTAGGCTGGAGGG - Intronic
954793471 3:53149330-53149352 CCTCCTGAGGGGAGGAGGGAAGG - Intergenic
955572372 3:60321871-60321893 CCCTCTTAAAGGAGGTTGGAGGG - Intronic
956259853 3:67327362-67327384 CCGCCTGAAGGGAGGCTGGTTGG + Intergenic
956476816 3:69631033-69631055 CCTACTTAATGGGGGCTGGAGGG - Intergenic
958732977 3:97978400-97978422 GCTTCTGAAGGTAGGCTGACAGG + Intergenic
958963237 3:100530430-100530452 ACTGGTGAATGGAGGCTGGAGGG - Intronic
961109624 3:124272958-124272980 CCTTCTGGTGGGAGGCTGGTTGG + Intronic
961127957 3:124438178-124438200 CATTTTGAAGGGAGTTTGGAGGG - Intronic
961311354 3:126004003-126004025 CCTTTGGGAGGGAGGCTGGGAGG + Intergenic
961554796 3:127690460-127690482 GCTGCTGGAGGGAGGGTGGAGGG + Exonic
962325779 3:134430966-134430988 ACTTGTTAAGGGAGGCTGGAGGG + Intergenic
963103061 3:141623811-141623833 CCTGCTGGAGGGAGGAAGGAGGG - Intergenic
964327766 3:155565549-155565571 GCTTCTCTGGGGAGGCTGGAGGG - Intronic
966203778 3:177384766-177384788 ACTTCTGAAGGGATGCCCGAGGG + Intergenic
966911927 3:184564617-184564639 CCTGCTGGAGGGAGGTTAGAGGG + Intronic
966946290 3:184779313-184779335 CCCTGTCAAGGGAGGCTGTAGGG - Intergenic
967891174 3:194365622-194365644 TCTTCTGATGTGAGGCAGGAAGG + Intronic
967967190 3:194971203-194971225 TCTGCTGAGGGGAGGCAGGAGGG + Intergenic
968521479 4:1036527-1036549 CCTTTTGCAGCGAGGATGGAGGG - Intergenic
969721848 4:8896403-8896425 CCTCCTGAGGTCAGGCTGGAGGG - Intergenic
969885240 4:10209434-10209456 ACTTGTGAAGGGAGACAGGATGG + Intergenic
970304009 4:14712158-14712180 CCATATGAAGGGTGACTGGATGG - Intergenic
971028148 4:22608417-22608439 CCTCCTGAAGCAAGGCTGGAGGG + Intergenic
972929615 4:44055578-44055600 CTTGCTGAAGGCAGGCTGGGAGG + Intergenic
973606244 4:52590127-52590149 CCATCTGAGGGGAGGTTGTATGG + Intergenic
973803171 4:54498356-54498378 CCATAGGAAGGGATGCTGGAGGG + Intergenic
979291612 4:118984636-118984658 CCATCTGAGGTGAAGCTGGAAGG - Intronic
981975379 4:150722100-150722122 TGTTCTGAGGGGAGGGTGGAAGG - Intronic
983915927 4:173290601-173290623 CCTGCTGAAGAGAGGCAGGGAGG + Intronic
985128111 4:186715122-186715144 CCTTCTGGTGGGGGGATGGAGGG - Intronic
986374296 5:7114721-7114743 CCTTCAGAGGGGAGGCAGGGAGG - Intergenic
986601367 5:9476542-9476564 CCCTCTGAAGACAGGCTGGATGG + Intronic
986614987 5:9606809-9606831 CCTTCTCAAGGGAGGGTCTAGGG - Intergenic
986737837 5:10681247-10681269 CCTTCCGCAGGGACGCTGGTGGG - Intronic
986907030 5:12507403-12507425 CCTGTTGAAGGGAGGTGGGAGGG - Intergenic
987718976 5:21610502-21610524 CCATCTGAAGAGAGGCCAGATGG - Intergenic
988604429 5:32667606-32667628 CCTTCTCAAGAGAGGCTGCAAGG - Intergenic
991630421 5:68651066-68651088 CTTTGTGCAGGCAGGCTGGAAGG - Intergenic
992226312 5:74622410-74622432 CCATCTGAAGGGTGGGTGGGGGG - Intergenic
992321712 5:75619821-75619843 CCTTCTGAAAGGAAGAAGGAAGG - Intronic
993537206 5:89101625-89101647 CCTTCTCAAGGGTGAATGGAAGG - Intergenic
995687337 5:114785028-114785050 CTATCTGAAGGGAGTGTGGATGG - Intergenic
997605520 5:135173183-135173205 CCTTTTGAAGGCAGGTTGGCTGG + Intronic
997856010 5:137373457-137373479 CCTTCTACAGGGATGCTGCAGGG - Intronic
999371716 5:151059491-151059513 CTTTGTGAAGGGAGGCAGCAGGG + Intronic
1001771869 5:174302890-174302912 CCCTCTGAAGGGAATCAGGATGG + Intergenic
1002109137 5:176896265-176896287 CCTTCTGAAGGGGACCAGGAAGG + Intronic
1004010169 6:11677462-11677484 CCTTGTACAGGGAGACTGGAAGG - Intergenic
1004078274 6:12365460-12365482 CCTTCTGGGTGGGGGCTGGAAGG + Intergenic
1004230041 6:13824440-13824462 CCTTCTGGACTGTGGCTGGAGGG + Intergenic
1006319740 6:33313443-33313465 CCGCCTGAAGGCAGCCTGGAGGG + Exonic
1006846111 6:37062697-37062719 CCTGCTGAAGGGAGATTGTAAGG - Intergenic
1007167090 6:39836308-39836330 CCTTCTTTAAGAAGGCTGGAAGG - Intronic
1007255016 6:40522424-40522446 CAATCTCAAGGGAAGCTGGAGGG + Intronic
1008092371 6:47307140-47307162 CATCCTGAAGGGTGACTGGAGGG - Intronic
1008303713 6:49874521-49874543 TATCCTGAAGGCAGGCTGGAAGG - Intronic
1011642984 6:89432958-89432980 CCTTCTGAAGAGTGGGAGGAAGG - Intergenic
1012029947 6:94046296-94046318 CTTTCTGAAGAGAAGGTGGAAGG - Intergenic
1013412557 6:109894380-109894402 GCATCTGAAGGGAGGTTGGCCGG + Intergenic
1014832118 6:126115124-126115146 CCTCCTGAAGGGTGGCTGGAAGG - Intergenic
1015838810 6:137453728-137453750 CCTTTTGGAGGGTGGCTGGTGGG - Intergenic
1017728209 6:157290803-157290825 CCTGCAGAGGGGAGGCTGGCAGG - Exonic
1018059305 6:160078270-160078292 CCTGATGAAGTGAGGATGGATGG + Exonic
1018063163 6:160106167-160106189 CATGCTGGAGGGAGGCTGGGCGG + Exonic
1018649129 6:165976813-165976835 CCTGCTGCAGGGTGGCTGGTGGG - Intronic
1019105809 6:169665829-169665851 CCTTCTGTCGGGAGGTGGGATGG - Intronic
1019117023 6:169773456-169773478 TCTTCTGCAGAGATGCTGGAAGG + Intronic
1020266748 7:6565717-6565739 CATTTTGAAGGCAGGCTTGATGG + Intergenic
1020475951 7:8594678-8594700 CCTTCTCAAGGGAGCCTTGGTGG + Intronic
1021766881 7:23958523-23958545 ACTTCTGAAGGGTGGAGGGAGGG - Intergenic
1022494393 7:30843998-30844020 CCTTCTCCAGCGAGCCTGGAAGG + Intronic
1023852454 7:44158002-44158024 TATTCTGAAGGGAGGTGGGAGGG + Intronic
1024264851 7:47598684-47598706 CCATCTCAAGGAAGGCTGCAAGG + Intergenic
1024578889 7:50785679-50785701 CCTGGTGGAGGGAGGCTGGAAGG - Intronic
1024663269 7:51520085-51520107 CCTTCTGAGAGGAGGCTGAGAGG - Intergenic
1027193627 7:76012962-76012984 CATTCAGAGGGCAGGCTGGATGG - Intronic
1028180469 7:87715824-87715846 ATTACTGAAGGGAAGCTGGAGGG + Intronic
1029683058 7:102125581-102125603 CCTTGTGAAGAGACGCGGGAAGG + Intronic
1031670226 7:124533727-124533749 CCTTCTCTAGGCAGACTGGATGG - Intergenic
1033899766 7:146122196-146122218 CTTTCTGCAGGCAGCCTGGAAGG - Intronic
1034025959 7:147704424-147704446 CCTTCTGAAGAAAGGGTGGTTGG + Intronic
1034959814 7:155358263-155358285 CCTTCTGAAGGGAAGAAGAAAGG + Exonic
1035051855 7:156003472-156003494 CCCTGGGAAGGGAGGCTGGGAGG + Intergenic
1037362063 8:18084274-18084296 CCTTCTGCAGGTAGCCTGGAAGG - Intronic
1037907355 8:22723419-22723441 CTTTCTGAAGGCAGGATGGAGGG - Intronic
1039012886 8:33114528-33114550 CCTTCTGCTGGGATGCTGGCAGG + Intergenic
1039595948 8:38789776-38789798 CCTGCTGCAGGGAGGCCGTAAGG + Intronic
1041164764 8:55080339-55080361 TCTTCTGGAGGGAGTATGGAAGG + Intergenic
1042804368 8:72755906-72755928 CATCCTGCAGGGAGGCTGGCTGG + Intronic
1043356450 8:79418284-79418306 CCTGCTGAAGGATTGCTGGAAGG - Intergenic
1044095546 8:88059672-88059694 CCTTTAGAAGGGACGATGGAAGG - Intronic
1044352473 8:91183263-91183285 CATACTGGAGGGAGGCTAGAGGG + Intronic
1044620547 8:94187303-94187325 GCTTCTCATGGGAGGCTGGTGGG - Intronic
1044729736 8:95220277-95220299 CCTTGAGGATGGAGGCTGGATGG - Intergenic
1044938995 8:97321512-97321534 CCTGCTGATGGCAGGCTGTAGGG - Intergenic
1045224578 8:100232003-100232025 CCTTCTGAAGTGCTGCGGGAAGG + Intronic
1046714780 8:117555682-117555704 CCATCTGAAGGGAACTTGGAAGG - Intergenic
1050296963 9:4215212-4215234 CTTTCAGAGGGGAGGTTGGAAGG - Intronic
1052998927 9:34566544-34566566 TTTTTGGAAGGGAGGCTGGAGGG - Intronic
1055375716 9:75646972-75646994 CCATCTCAGGGGAGGCTGCAAGG - Intergenic
1055785336 9:79864448-79864470 CCTTCTGAAGGGAGGCCGGAAGG - Intergenic
1055829024 9:80358751-80358773 TCTTCTGAAAGGAGGCTGGAAGG + Intergenic
1056019813 9:82430181-82430203 CCTTCTGAAGGGAGGCTGGAAGG + Intergenic
1056506850 9:87265722-87265744 CCTTCAGCAGGGAGCCTGGAAGG - Intergenic
1056575897 9:87856065-87856087 CCATCTGAAGGGAGGCTGGAAGG + Intergenic
1056801308 9:89694011-89694033 ACTCCTAAAGGGAGGCCGGAAGG + Intergenic
1057072025 9:92106849-92106871 CCTTCTGAAGGGAGGCTGGAAGG - Intronic
1058799784 9:108534383-108534405 TCTTCTAATGGGAGGCTGGATGG + Intergenic
1060442493 9:123654926-123654948 GCTTCTGAACTGAGGCTTGATGG - Intronic
1061057706 9:128233157-128233179 TCTTATGAAGGGAGGCTGAAGGG - Intronic
1061947335 9:133916097-133916119 CCTTCTGAAGGAAGCCTGGCAGG + Intronic
1185581161 X:1212577-1212599 CTTTCTGCTGGGAGGCTGGATGG - Exonic
1186718964 X:12282209-12282231 CCTTCAGCAGGCAGCCTGGAGGG - Intronic
1189295318 X:39913659-39913681 CCTTGGCAAGGGAGGCTGGAGGG + Intergenic
1190056163 X:47182101-47182123 CCTTGTGAAGGGAACCTGCAGGG - Intronic
1190310508 X:49113984-49114006 CCTTCTGACAGGACGCTGGTTGG - Intronic
1191902332 X:66053833-66053855 GCATCTGGAAGGAGGCTGGAGGG + Intergenic
1193739514 X:85201611-85201633 ACTTGAGAAGGGAGGGTGGAAGG - Intergenic
1194888206 X:99345936-99345958 TCTTGTAAAGGCAGGCTGGAGGG + Intergenic
1195209566 X:102640219-102640241 CCCTCTGAAGGCATGCGGGAAGG - Intergenic
1197723858 X:129762607-129762629 CCTACTGATGAGTGGCTGGAGGG - Intronic
1199781777 X:151068029-151068051 CCAGCTGATGGGATGCTGGATGG - Intergenic
1201340060 Y:12924403-12924425 CCATCTCAGGGAAGGCTGGAAGG - Intergenic