ID: 1057075280

View in Genome Browser
Species Human (GRCh38)
Location 9:92135272-92135294
Sequence CTCAGGAAGCATCCTGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057075272_1057075280 4 Left 1057075272 9:92135245-92135267 CCAGGAGGCTAGAGAAGGACCTG No data
Right 1057075280 9:92135272-92135294 CTCAGGAAGCATCCTGATGGGGG No data
1057075266_1057075280 25 Left 1057075266 9:92135224-92135246 CCCTCTATATGCAGAGGTTACCC No data
Right 1057075280 9:92135272-92135294 CTCAGGAAGCATCCTGATGGGGG No data
1057075267_1057075280 24 Left 1057075267 9:92135225-92135247 CCTCTATATGCAGAGGTTACCCA No data
Right 1057075280 9:92135272-92135294 CTCAGGAAGCATCCTGATGGGGG No data
1057075271_1057075280 5 Left 1057075271 9:92135244-92135266 CCCAGGAGGCTAGAGAAGGACCT No data
Right 1057075280 9:92135272-92135294 CTCAGGAAGCATCCTGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057075280 Original CRISPR CTCAGGAAGCATCCTGATGG GGG Intergenic
No off target data available for this crispr