ID: 1057076629

View in Genome Browser
Species Human (GRCh38)
Location 9:92141515-92141537
Sequence CGGTAGGCCCCGGGCCGGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 1, 2: 2, 3: 27, 4: 257}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057076629_1057076645 11 Left 1057076629 9:92141515-92141537 CCAGCCCGGCCCGGGGCCTACCG 0: 1
1: 1
2: 2
3: 27
4: 257
Right 1057076645 9:92141549-92141571 CCCTGCCACTGCCAGGAGGACGG No data
1057076629_1057076641 7 Left 1057076629 9:92141515-92141537 CCAGCCCGGCCCGGGGCCTACCG 0: 1
1: 1
2: 2
3: 27
4: 257
Right 1057076641 9:92141545-92141567 GGCCCCCTGCCACTGCCAGGAGG No data
1057076629_1057076639 4 Left 1057076629 9:92141515-92141537 CCAGCCCGGCCCGGGGCCTACCG 0: 1
1: 1
2: 2
3: 27
4: 257
Right 1057076639 9:92141542-92141564 CCCGGCCCCCTGCCACTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057076629 Original CRISPR CGGTAGGCCCCGGGCCGGGC TGG (reversed) Intergenic
900122331 1:1054178-1054200 CGGCAGGCTCCGGGCAGGGCCGG - Intronic
900227596 1:1540347-1540369 CGGGCGGGGCCGGGCCGGGCCGG + Exonic
900402201 1:2477170-2477192 TGGAGGGCCCCGGTCCGGGCTGG + Intronic
901069895 1:6511859-6511881 CAGGAAGCCCAGGGCCGGGCAGG + Intronic
901808054 1:11750210-11750232 AGGAAGGCCCGGGGCAGGGCCGG - Exonic
901870820 1:12138356-12138378 CGAGGGGCCCCCGGCCGGGCTGG - Exonic
902896952 1:19485596-19485618 GGGGCGGGCCCGGGCCGGGCCGG - Intergenic
902940956 1:19799915-19799937 GGGGAGGGGCCGGGCCGGGCCGG - Exonic
903603028 1:24556055-24556077 CGGGACGCCCCGGGCGGGGGCGG + Intergenic
903931639 1:26865459-26865481 CGGCTGGGCCTGGGCCGGGCCGG + Intergenic
904255891 1:29254732-29254754 CAGTGGGCCCTGGGCCTGGCAGG - Intronic
904493000 1:30871774-30871796 CGGAAGGCCCAGGGCAGGGAGGG - Intronic
904720045 1:32500786-32500808 CGGCTTTCCCCGGGCCGGGCCGG - Intronic
904769018 1:32870762-32870784 CGGCAGGCCCGGGGCGGCGCAGG + Exonic
905043212 1:34976986-34977008 CCGTAGGCACCGGGCCAGGCGGG + Intergenic
905269902 1:36781033-36781055 TGGCAGGCCCCAGCCCGGGCTGG + Intergenic
905304407 1:37007550-37007572 CGGGAGCCACCGGGCCTGGCTGG + Intronic
905463086 1:38134039-38134061 CGGAGGGCCCAGGGCCGGGGTGG + Intergenic
905569252 1:38991146-38991168 GGGGGCGCCCCGGGCCGGGCCGG + Intergenic
906034003 1:42739820-42739842 CGGTAGGCCCCAGGCCGGCGGGG - Exonic
907243325 1:53092533-53092555 AGGTAGCCCCGGGGACGGGCAGG - Exonic
911078853 1:93908982-93909004 GGGCAGGCCTCGGGCGGGGCCGG - Intronic
915616972 1:157046169-157046191 GGGTCGCCCGCGGGCCGGGCCGG - Intergenic
917974279 1:180229475-180229497 CGGGCGGCGCCGGCCCGGGCTGG - Intergenic
919661506 1:200252151-200252173 CATTAGGCCCAGGGCCAGGCAGG - Intergenic
919926422 1:202194067-202194089 CGGTGGGCCCCGGGCCGGGCTGG - Exonic
920007307 1:202842839-202842861 AGGAAGGCCCCCGGCCGTGCCGG + Intergenic
920805610 1:209231554-209231576 AGGCAGGGGCCGGGCCGGGCCGG - Intergenic
922234520 1:223712890-223712912 CGGCAGGACGCGGGCAGGGCGGG + Intronic
924527092 1:244863112-244863134 CGGGAGGAGCCGGGCGGGGCGGG - Intronic
1063593331 10:7411836-7411858 CCGTGAGCCCCGGGCAGGGCTGG + Intergenic
1064011996 10:11742745-11742767 AGGTCAGCCCCGGGCCGCGCGGG + Exonic
1065916749 10:30359528-30359550 TGGCAGGCCACGGGCCGGGCAGG - Intronic
1067841012 10:49679593-49679615 CGCTACGCGCCGGGCGGGGCCGG - Intergenic
1067937598 10:50624587-50624609 AGGTGGGCCCCAGGCGGGGCGGG - Intronic
1069881562 10:71596859-71596881 AGGCAGGCCCTGGGGCGGGCTGG - Intronic
1069992196 10:72322702-72322724 CAGTGGGCCCCGGGCAGGCCTGG + Intergenic
1070112072 10:73495906-73495928 GGCTAGGCTCTGGGCCGGGCGGG + Exonic
1072241176 10:93496737-93496759 CCGCAGCCCCGGGGCCGGGCCGG + Exonic
1072784009 10:98268274-98268296 CCGCAGGCCCCGCCCCGGGCGGG + Intergenic
1075040696 10:119104552-119104574 CGGGCGGGGCCGGGCCGGGCGGG + Intronic
1076372291 10:129963574-129963596 CGGAGGGGGCCGGGCCGGGCCGG + Intronic
1076706467 10:132304786-132304808 CCCTGGGCGCCGGGCCGGGCAGG - Intronic
1076710550 10:132331692-132331714 CCGGAGGGCCCGGGGCGGGCGGG - Intronic
1076752069 10:132548269-132548291 CGGTAGTCCCCGGACCGTGGTGG + Intronic
1076850545 10:133090312-133090334 CGGGTGGCCCCGGGCCGAGGAGG - Intronic
1076875547 10:133213901-133213923 CAGCAGCCCCAGGGCCGGGCAGG + Intronic
1077500866 11:2909287-2909309 AGGTAGACCCCGGGCAGGGCCGG - Exonic
1077962470 11:7089654-7089676 CGGGAGGGCCCTGGCCGTGCGGG + Exonic
1078660057 11:13278591-13278613 GGGTCGGCCCCGTGCCGGCCGGG - Intronic
1079004728 11:16783617-16783639 ATGTGGGCCCTGGGCCGGGCTGG - Intronic
1080387316 11:31817765-31817787 CCGCGGGCCCCGAGCCGGGCCGG + Intronic
1081807154 11:45896850-45896872 CCGCAGCCCCCCGGCCGGGCAGG + Intronic
1083259653 11:61516205-61516227 CGGTGGGCCGAGGGCCGGGTAGG - Intronic
1083660925 11:64251486-64251508 CGGCGGGGCCCGGGCGGGGCGGG - Intergenic
1083856777 11:65396871-65396893 CCGTGGGGCCAGGGCCGGGCCGG + Exonic
1084611154 11:70203744-70203766 AGGTGGGCGCGGGGCCGGGCCGG + Exonic
1084973044 11:72781728-72781750 CGGGAGACCCGGGGCCGCGCGGG + Intronic
1085301585 11:75462063-75462085 AGCTAGGCCCTGGGCAGGGCTGG - Intronic
1085666274 11:78417808-78417830 CGGGAGGCCAGGGGCGGGGCGGG + Intronic
1090003647 11:122981937-122981959 CGGGAGGCTCGGGGCGGGGCGGG + Intergenic
1090635794 11:128689851-128689873 CGGGAGGGCCGGGGGCGGGCGGG - Intronic
1091915360 12:4269294-4269316 CGGTGGGCGCAGCGCCGGGCAGG - Intergenic
1092294898 12:7189880-7189902 CGGGAGGGACCGGGCCGAGCCGG + Intronic
1092542812 12:9430551-9430573 CGGCAGGCCCTGGCCCGGGGAGG + Intergenic
1093925228 12:24902872-24902894 CGGTAGCTCGCGGGCCTGGCCGG - Intronic
1094536086 12:31324173-31324195 CGGGAGGCGCCGGGCCGGGCTGG - Intronic
1096647646 12:53047348-53047370 CGGGGGGCGCCCGGCCGGGCGGG - Intronic
1097088643 12:56488075-56488097 CAGAAGGCCCTGAGCCGGGCTGG - Exonic
1097184601 12:57189839-57189861 AGCTAGGCCCAGGGCGGGGCAGG - Intronic
1097185784 12:57195604-57195626 CGGTCGGCCGCTGGCCAGGCAGG + Intronic
1100565446 12:95790323-95790345 CGGGAGCAGCCGGGCCGGGCGGG + Exonic
1101750840 12:107581303-107581325 AGGTAGGCGCGGGGGCGGGCGGG + Exonic
1102058503 12:109914647-109914669 CGGGAGGCACCGGGCCTGCCAGG + Intronic
1103896803 12:124278473-124278495 GGGGAGGCCCCGGGCTGGGCTGG - Intronic
1104568307 12:129903970-129903992 CGCCCGGCCCCGGGCCCGGCTGG + Intergenic
1104775730 12:131389207-131389229 CTGGAGTCCCCGGGCTGGGCTGG + Intergenic
1104892657 12:132147930-132147952 CGGTGGGCTCCCGGCGGGGCAGG - Exonic
1104961519 12:132490420-132490442 CGGCGGGCGGCGGGCCGGGCCGG - Exonic
1105975422 13:25468664-25468686 CTGCAGGGACCGGGCCGGGCTGG - Intronic
1106226274 13:27789628-27789650 CGGGAGCCCCTGGGCCTGGCGGG - Intergenic
1107141069 13:36999193-36999215 CGGTAAGCCCCGGCCTGCGCGGG + Intronic
1110707078 13:78608569-78608591 CGGCAGGGCCCAGGCGGGGCGGG - Intergenic
1111672586 13:91348434-91348456 GGGCAGGCCGCGGGCCGGGAGGG + Intergenic
1111979704 13:95003148-95003170 CGTCGGGCCCCGGGCCGGGCGGG - Intergenic
1113781927 13:112981975-112981997 GGGCAGGCCCCGGTCAGGGCTGG + Intronic
1116886934 14:50231312-50231334 GGGCAGCCCGCGGGCCGGGCCGG + Exonic
1116895621 14:50312401-50312423 AGCTAGGCCCCGAGCCGGGCGGG + Exonic
1118324957 14:64774417-64774439 CAGCAGGCCCTGGGCCCGGCTGG + Exonic
1119602486 14:75985933-75985955 CGGCAGGCCTCGCGCCGCGCCGG + Intronic
1122275243 14:100587519-100587541 TGGTGGGCGCAGGGCCGGGCAGG + Intergenic
1123036900 14:105475232-105475254 CGGACGGCGCCGGGCGGGGCGGG + Intronic
1123443635 15:20306602-20306624 CGGTAGGGCCAAGGCAGGGCAGG - Intergenic
1124426981 15:29570754-29570776 CGGCGCGCGCCGGGCCGGGCGGG - Intergenic
1125541295 15:40471294-40471316 GGGCAGGGCCCGGGCGGGGCTGG + Exonic
1129423909 15:75451391-75451413 CGCTGGGCCGGGGGCCGGGCGGG - Intronic
1129466235 15:75725731-75725753 AGGTAAGCCCCTGGCCTGGCTGG + Intronic
1129675947 15:77632539-77632561 CGGGAGGCCGCGGCCCCGGCGGG + Intronic
1130656495 15:85795035-85795057 GGGTGGGCCCCAGGCCGCGCCGG + Intergenic
1131085969 15:89575853-89575875 CCCTGGGCGCCGGGCCGGGCAGG - Exonic
1131838096 15:96409900-96409922 GGGTCGGCTCCGGGCCGCGCGGG - Intergenic
1132794205 16:1711031-1711053 CGGGAGCCCCCGGGCCACGCTGG + Intronic
1132897741 16:2236959-2236981 AGGTGGGGCCCGGGCCGGGGCGG + Exonic
1132978322 16:2721301-2721323 CGGGCGGCTCCGGGCGGGGCTGG + Intergenic
1135582610 16:23641221-23641243 CAGTTGGCCCTGGGCCGGGGAGG + Exonic
1136400057 16:30011994-30012016 TGGCAGGCGCAGGGCCGGGCAGG - Intronic
1136572630 16:31105826-31105848 CGCTAGGCCCCGGCTCGGCCTGG - Intergenic
1137777902 16:51071748-51071770 TGGCTGGCCCCGGGCTGGGCAGG + Intergenic
1138472051 16:57245491-57245513 CCTTAGGGGCCGGGCCGGGCCGG + Intronic
1138516086 16:57536221-57536243 CGGAATGCCGCGGCCCGGGCCGG - Intronic
1138556535 16:57774126-57774148 CGCTGGGCCACGGGCCAGGCAGG + Intronic
1139409958 16:66751368-66751390 TGGTCAGCCCCGGGCCGGGCTGG + Intronic
1141538445 16:84699861-84699883 CGGCAGGCTCCAGGCGGGGCAGG + Intergenic
1141638618 16:85328810-85328832 CGGGAGGCCCCGGGGCGGGGAGG - Intergenic
1142760577 17:2039822-2039844 CGGTATGGGCTGGGCCGGGCTGG + Exonic
1144500942 17:15786455-15786477 CCGCAGGCGCCGGGCCGGGTGGG - Intergenic
1144816692 17:18039901-18039923 AGGTGAGCGCCGGGCCGGGCCGG + Exonic
1144840557 17:18183425-18183447 CCGTGGGCCACGCGCCGGGCAGG - Intronic
1144905518 17:18637676-18637698 CTCTAAGCCCTGGGCCGGGCTGG - Intronic
1145163103 17:20589117-20589139 CGGCAGGCGCCGGGCCGGGTGGG - Intergenic
1146492496 17:33292613-33292635 CGCTGGGCTACGGGCCGGGCTGG - Exonic
1146716289 17:35089309-35089331 CGGGAGCGGCCGGGCCGGGCCGG - Exonic
1147613179 17:41813135-41813157 CAGGGGGCCCCCGGCCGGGCTGG - Exonic
1148878564 17:50707693-50707715 TGACAGGCCCCGGGCGGGGCGGG - Exonic
1150830122 17:68511884-68511906 GGGAGGGCCCCGGGCCGGGGCGG - Intronic
1151426357 17:74033326-74033348 CGGGAGGCCGAGGGCAGGGCTGG - Intergenic
1151557093 17:74852058-74852080 CGGCAGTCCCCGGCCGGGGCTGG + Exonic
1151703097 17:75753709-75753731 CGGGGGGCGCCGGGCCGAGCAGG - Intronic
1151779993 17:76239762-76239784 AGGTAGGCTTTGGGCCGGGCCGG + Intronic
1151960095 17:77401231-77401253 CGGTAGGCCCGGCGCCTCGCCGG + Intronic
1152049281 17:77959389-77959411 CGCCAGGCCCCGGGCCGGCCGGG + Intergenic
1152313070 17:79562699-79562721 GGGTGGGCCCCGGCCCCGGCTGG + Intergenic
1152362471 17:79839097-79839119 GGGGAGGCTGCGGGCCGGGCCGG - Intronic
1152362609 17:79839563-79839585 CCGGAGGCCCCGGGCCTGGGCGG + Intergenic
1152396693 17:80037124-80037146 AGGGAGGCGCGGGGCCGGGCTGG - Intronic
1152618028 17:81346604-81346626 CGGTCAGCCCCGGGCCGGAGAGG + Intergenic
1152628131 17:81397590-81397612 CGGGAGGCGCCGGCCGGGGCTGG + Intronic
1152630427 17:81408464-81408486 GGGTAGGCCCCAGGAGGGGCAGG - Intronic
1152781580 17:82229348-82229370 GGGTGGGCGCCGGGCCGGACCGG - Intronic
1157752958 18:50194788-50194810 CGACATGGCCCGGGCCGGGCGGG + Exonic
1158505554 18:58044055-58044077 CTGGAGGCCCCGGGCCGGGGTGG + Intergenic
1160204486 18:76822237-76822259 CGGGGGTCACCGGGCCGGGCCGG - Exonic
1160736089 19:663026-663048 CGGTGAGGCCCGGGCCGGGGCGG - Exonic
1160754671 19:751180-751202 GGGGGCGCCCCGGGCCGGGCCGG + Intronic
1161065614 19:2236028-2236050 CGGGAGGCCGGGGTCCGGGCGGG - Intronic
1161400664 19:4065379-4065401 CGGGGGACCGCGGGCCGGGCGGG - Intronic
1161613276 19:5255841-5255863 CGGCCGGCCCTAGGCCGGGCTGG + Intronic
1161699178 19:5785582-5785604 CGGTGGGCACCGGGGCTGGCTGG - Exonic
1162029836 19:7912580-7912602 TGGTAGGCCCGGGGCGGGGGGGG - Exonic
1162733795 19:12734599-12734621 CGGGAGGCTCCGGGCCCCGCGGG - Exonic
1162778679 19:12995698-12995720 CGCGGGGCCGCGGGCCGGGCGGG + Exonic
1162914313 19:13865830-13865852 GGGGAGGCCACGGGCCGGGGCGG + Intronic
1163158066 19:15449719-15449741 GGGGAGGCCCCGGGCCGGGCCGG - Intronic
1163651904 19:18522578-18522600 GGGTAGGCCCCGCCGCGGGCCGG + Intergenic
1164995749 19:32719798-32719820 CGGGAGGCCCGAGGCCAGGCAGG + Intronic
1165365556 19:35362872-35362894 GGGCAGGCCCCGGGCCTTGCTGG - Intergenic
1165419976 19:35717871-35717893 CGGGAGACCGGGGGCCGGGCCGG - Intergenic
1165928652 19:39342575-39342597 CGGTGAGTCTCGGGCCGGGCCGG + Exonic
1166367173 19:42283828-42283850 CGGTTGGCCCCGAGCCGGCCGGG - Intronic
1166751280 19:45165058-45165080 GGGCAGGCCCCGGGCGGGGAGGG - Intronic
1167103805 19:47419235-47419257 CGGCAGGCGCCGGGCCGGGTGGG + Exonic
1167134875 19:47610042-47610064 CGGGAGGCACCAGGCCCGGCCGG + Intronic
1167454543 19:49591480-49591502 GGGAAGGCCCCGGGCGGGGGAGG - Intergenic
1167492869 19:49802100-49802122 GGGTGGGCCCCAGGCTGGGCTGG - Exonic
1167643623 19:50694843-50694865 CGGCAGGCCCCGGCCCGCGGTGG - Intronic
1168247047 19:55117609-55117631 CGGCGGCCCCCGGGGCGGGCGGG - Intergenic
1168641475 19:58034307-58034329 CGGGAGGGGGCGGGCCGGGCCGG + Intronic
925025605 2:604580-604602 CTGTAGGCTCCGGGCAGGGCAGG - Intergenic
925972232 2:9113651-9113673 AGGTGGGGCCCGGGCCAGGCTGG - Intergenic
926087394 2:10028887-10028909 CTGAGGGCCCCGGGCCGAGCTGG - Intergenic
927472382 2:23385779-23385801 AGGTAAGAGCCGGGCCGGGCTGG + Exonic
927920821 2:26970846-26970868 CGGGAGGCCAGGGCCCGGGCTGG + Intronic
936550775 2:113437762-113437784 CGTCAGGCCCCGGGCAGGCCGGG + Exonic
946311190 2:218883513-218883535 CGGGAGGCCTGGGGCTGGGCTGG - Intronic
947669038 2:231925354-231925376 CGGGCGGTCCCGGGCCGGGCTGG + Intronic
947846820 2:233251482-233251504 CGCAAGGCCCAGCGCCGGGCGGG - Intronic
948460759 2:238128903-238128925 AGGTAGGCCCCCGGCAGGGGCGG + Exonic
948933720 2:241149275-241149297 CGGGAGACCCGGGGTCGGGCTGG + Intronic
948991739 2:241559090-241559112 TGGGCGGCCCCGGGCCGGGGCGG + Intronic
949059303 2:241947554-241947576 CGGTAAGCCCAGGTCTGGGCAGG - Intergenic
1168765773 20:381033-381055 TGCTAGGACCCGGGCAGGGCTGG + Exonic
1169118576 20:3082631-3082653 CAGTAGGCGTCGGGCTGGGCGGG + Exonic
1172479341 20:35261704-35261726 CAGGAGACCCCGGGCAGGGCAGG - Intronic
1172650873 20:36500479-36500501 CGGCAGGCCCCTGGCTGTGCCGG - Exonic
1172661807 20:36573691-36573713 CGGGACGCCCCGCGCCGAGCCGG + Intronic
1173251554 20:41366522-41366544 CGGGAGGCACCGGGCGGCGCAGG + Exonic
1173741552 20:45405984-45406006 GGGTGGGCGCCGGGCCGGCCGGG - Intronic
1176096456 20:63346658-63346680 CGGCCGGCCTGGGGCCGGGCTGG - Exonic
1178523899 21:33308781-33308803 CAGTAGGCCCGAGGCGGGGCTGG - Intergenic
1179892633 21:44344660-44344682 AGGGAGGCCCAGGGCTGGGCAGG - Intergenic
1180767278 22:18352438-18352460 CGCTGGGACCCTGGCCGGGCTGG + Intergenic
1180779031 22:18509941-18509963 CGCTGGGACCCTGGCCGGGCTGG - Intergenic
1180811752 22:18767261-18767283 CGCTGGGACCCTGGCCGGGCTGG - Intergenic
1180960581 22:19760681-19760703 GGGGGGGCCCCGGGCGGGGCGGG + Intronic
1181197905 22:21201503-21201525 CGCTGGGACCCTGGCCGGGCTGG - Intergenic
1181276140 22:21688499-21688521 GGGCAGGCCCCAGGCGGGGCTGG + Intronic
1181401840 22:22654303-22654325 CGCTGGGACCCTGGCCGGGCTGG + Intergenic
1181703794 22:24635397-24635419 CGCTGGGACCCTGGCCGGGCTGG + Intergenic
1182124059 22:27803897-27803919 TCCTAGGCCCCGGGGCGGGCGGG - Intergenic
1183456500 22:37925915-37925937 CGGGTGGCCCAGGGCAGGGCTGG - Exonic
1183856085 22:40636256-40636278 GGCTGGGACCCGGGCCGGGCCGG - Intronic
1184479132 22:44736971-44736993 CGGTGGGGCCCTGGCCGGGCGGG - Exonic
1184645419 22:45892339-45892361 AGGGATGCCCCGGGCTGGGCAGG - Intergenic
1184689549 22:46111220-46111242 AGGCAGGCCCCAGGCTGGGCTGG - Intronic
1185147613 22:49147799-49147821 GGGAAGGCCCCGAGCTGGGCAGG - Intergenic
1185335708 22:50270129-50270151 GGGTGGGGGCCGGGCCGGGCCGG - Intronic
1203228900 22_KI270731v1_random:93332-93354 CGCTGGGACCCTGGCCGGGCTGG + Intergenic
950012079 3:9731270-9731292 GGGTAGGACCGGGGCGGGGCTGG - Intergenic
950032572 3:9862436-9862458 GGGTCAGCCCCGGGCAGGGCGGG + Intergenic
950415682 3:12867785-12867807 GGGTCAGCCCCGGGCAGGGCTGG + Intronic
954106786 3:48413866-48413888 GGGCAGGTCCCTGGCCGGGCTGG - Intronic
954298582 3:49687321-49687343 GGGAAGGCCCCAGGCCGGGACGG + Intronic
954615536 3:51967305-51967327 AGGTAGGGCGCGGGCCGGGCGGG - Exonic
954615604 3:51967515-51967537 GGGGAGGGGCCGGGCCGGGCGGG - Intronic
954717527 3:52533913-52533935 CGGGAGGCCCCGGACCCGGCGGG + Intronic
959539472 3:107523438-107523460 CGGGAGGCTGGGGGCCGGGCTGG + Intronic
961780087 3:129316061-129316083 GGGTGGGGGCCGGGCCGGGCCGG + Exonic
963061631 3:141231428-141231450 CACTAGGGCCCGGGCCGGCCAGG + Intronic
966886427 3:184380122-184380144 GAGTCGGCGCCGGGCCGGGCGGG - Exonic
968126443 3:196163868-196163890 CTGCAGCCCCCGGGCCGGCCTGG + Intergenic
968148247 3:196317895-196317917 CGGGAGGCCGCGAGGCGGGCGGG - Intronic
968258149 3:197297890-197297912 CCGCGGGCCCCGGGCGGGGCGGG - Intronic
968651216 4:1760992-1761014 CGGGAGGCCCCGGGAGGGCCAGG + Intergenic
968674745 4:1871449-1871471 CGGTAGGGCCCAGGCGGGGAGGG - Intronic
968729329 4:2262201-2262223 GGGCGGGCGCCGGGCCGGGCTGG + Exonic
968953380 4:3706247-3706269 AGGTGGGCCCCGTGCTGGGCTGG + Intergenic
969413314 4:7043351-7043373 CGGTGGCGGCCGGGCCGGGCCGG + Intronic
970421076 4:15906111-15906133 CGGGCGGGCCCGGGCGGGGCTGG + Intergenic
974549054 4:63348989-63349011 GGGTAGGCCCTCGGCCGGGCGGG + Intergenic
985334161 4:188873508-188873530 CGTGAGCCCCCGCGCCGGGCCGG - Intergenic
985660686 5:1155461-1155483 CTGCAGGCCCCGGACAGGGCGGG + Intergenic
987193217 5:15500303-15500325 CGGTGGGCGCTGAGCCGGGCAGG - Exonic
992529393 5:77640463-77640485 CGGGAAGCTCCGGGCCGGACTGG + Intergenic
995206667 5:109488096-109488118 CGGTGGGCCCCGGGCAGTGAGGG - Intergenic
1002281128 5:178130765-178130787 TGGGAGGCCCGGGGCCGGGCCGG + Intergenic
1002524265 5:179806711-179806733 CGGGGGGCCCGGGGCCGGGCGGG + Intronic
1002780020 6:358622-358644 CGGCAGGCCCTGGGCAAGGCAGG + Intergenic
1003173495 6:3738026-3738048 GGCCAGGCCCCGGGCTGGGCAGG - Intronic
1010244927 6:73653948-73653970 CCGAAGCCCCCGGGCCGAGCTGG + Exonic
1010372784 6:75130853-75130875 CGTTCGGCCCTGGGCAGGGCTGG + Exonic
1017877569 6:158536977-158536999 CCGTAGGCTCCGCGCCCGGCCGG - Intronic
1018669843 6:166168829-166168851 CGCTTGGCGCTGGGCCGGGCGGG - Intergenic
1019686223 7:2383723-2383745 CGGGCTGCCCCGGGCCGGGGAGG - Intergenic
1019697205 7:2452455-2452477 AGGCCGGCCCAGGGCCGGGCAGG - Intergenic
1020005680 7:4782843-4782865 TGGGAGGCCACGTGCCGGGCGGG - Intronic
1021622388 7:22561695-22561717 CAGTAAGCCCCGCGGCGGGCGGG - Intronic
1023831954 7:44044687-44044709 CTGTAGCTTCCGGGCCGGGCCGG - Intronic
1023944898 7:44795836-44795858 CGGTAGGAGCTGGGCGGGGCGGG + Intergenic
1024323148 7:48089195-48089217 CGGTAACCCCCGGGCAGGGCGGG + Exonic
1024578351 7:50782546-50782568 CGCTCGGAGCCGGGCCGGGCTGG + Intronic
1024578361 7:50782581-50782603 CCGCAGGCCCCTGGCCGGGGCGG - Intronic
1025829841 7:65038852-65038874 CGGGTGGGCCGGGGCCGGGCTGG + Intergenic
1026822147 7:73557165-73557187 GGGCGGGCCCCGGGCTGGGCCGG + Intronic
1030138948 7:106285406-106285428 CGGAAGGTCCCAGGCGGGGCGGG - Intronic
1032238103 7:130141583-130141605 AGGGAGGCCCTGGGCCGAGCTGG - Intergenic
1034499387 7:151440104-151440126 AGGGAGACCCCGGGCAGGGCGGG - Intronic
1035573337 8:688278-688300 CGGAAGGGCCGGGGCGGGGCGGG - Intronic
1036798090 8:11770087-11770109 CGGTAGCCCCCGGGCAGGGAGGG + Exonic
1045336014 8:101205291-101205313 CGGCAGGGCCCGGCCCGGGGCGG - Intronic
1047961866 8:130016768-130016790 CGGGAGGACACGGGCCAGGCGGG - Intronic
1049358384 8:142199920-142199942 CGGTGGGCTCCGGGATGGGCAGG - Intergenic
1049419646 8:142511072-142511094 CGGTGAGACCCCGGCCGGGCCGG + Exonic
1049658919 8:143811066-143811088 CTGCAGGCTGCGGGCCGGGCGGG + Exonic
1049708403 8:144053058-144053080 GGGCAGGCCCCGGGCCTGCCGGG + Exonic
1049751189 8:144285011-144285033 CAGGACGCCCCGGGCCGGTCTGG + Intronic
1049803752 8:144529868-144529890 CAGTGGGCCCGGGGCCTGGCAGG - Exonic
1049902158 9:179054-179076 CGTCAGGCCCCGGGCAGGCCGGG - Exonic
1051449409 9:17178637-17178659 CGGCAGGCCCCGGGCAGTGAGGG - Intronic
1053428248 9:38025218-38025240 AGGTGGGCTCCGGGCCAGGCTGG + Intronic
1056475172 9:86946294-86946316 CGGGCGGCCCCGGCGCGGGCGGG - Exonic
1057076629 9:92141515-92141537 CGGTAGGCCCCGGGCCGGGCTGG - Intergenic
1057354361 9:94321972-94321994 CGGTTGGCCCCAGGCCAGGCAGG + Intronic
1057653402 9:96935663-96935685 CGGTTGGCCCCAGGCCAGGCAGG - Intronic
1057665096 9:97038864-97038886 TGGGAGGGCCCGGGCGGGGCAGG - Intronic
1057699663 9:97354723-97354745 CGGTTGGCCTGGGGCCTGGCTGG - Intronic
1058102255 9:100929894-100929916 CAGTAGGCCTGGGGCAGGGCTGG + Intergenic
1059471148 9:114505502-114505524 GGGCGGGGCCCGGGCCGGGCTGG - Intergenic
1060192011 9:121599442-121599464 CGCTGGGTCCCGGGCCTGGCGGG + Intronic
1060468617 9:123929805-123929827 CTGCAGGCCGCGGGCCGCGCGGG - Intronic
1061609876 9:131739539-131739561 CGCCAGGGGCCGGGCCGGGCGGG - Intronic
1061848355 9:133400603-133400625 AGGTGGGCACCGGGCCGGGTGGG + Intronic
1061975878 9:134067875-134067897 CGGGCGGCGGCGGGCCGGGCTGG - Intronic
1062008048 9:134251444-134251466 CAGGAGGCCCCGGGGCAGGCCGG - Intergenic
1062087298 9:134655354-134655376 CGGGAGGCCCCCAGCCGGGAGGG + Intronic
1062544416 9:137055119-137055141 GGGGTGGCCCCTGGCCGGGCTGG - Intergenic
1186485594 X:9932299-9932321 CGGGAGGGCCGGGGCCGAGCGGG + Exonic
1191846573 X:65551617-65551639 CCGTGGGGCCAGGGCCGGGCCGG - Intergenic
1200249866 X:154547139-154547161 CAGTAGGGGCGGGGCCGGGCCGG - Exonic