ID: 1057079671

View in Genome Browser
Species Human (GRCh38)
Location 9:92163488-92163510
Sequence CCCGGCATGCAGGTTTTCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057079671_1057079680 26 Left 1057079671 9:92163488-92163510 CCTCTGAAAACCTGCATGCCGGG No data
Right 1057079680 9:92163537-92163559 GCCTGCCCAACTAGCAACTGAGG No data
1057079671_1057079682 27 Left 1057079671 9:92163488-92163510 CCTCTGAAAACCTGCATGCCGGG No data
Right 1057079682 9:92163538-92163560 CCTGCCCAACTAGCAACTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057079671 Original CRISPR CCCGGCATGCAGGTTTTCAG AGG (reversed) Intergenic
No off target data available for this crispr