ID: 1057081774

View in Genome Browser
Species Human (GRCh38)
Location 9:92178905-92178927
Sequence GGGAAGAAATGGTCAGATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057081770_1057081774 -3 Left 1057081770 9:92178885-92178907 CCAGGGAGGAAACTACAGGAGGG No data
Right 1057081774 9:92178905-92178927 GGGAAGAAATGGTCAGATTTGGG No data
1057081764_1057081774 15 Left 1057081764 9:92178867-92178889 CCAGGTAGAGAGGAGGGACCAGG No data
Right 1057081774 9:92178905-92178927 GGGAAGAAATGGTCAGATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057081774 Original CRISPR GGGAAGAAATGGTCAGATTT GGG Intergenic
No off target data available for this crispr