ID: 1057082283

View in Genome Browser
Species Human (GRCh38)
Location 9:92181815-92181837
Sequence GCACACTGATTTCAGTTTTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057082283_1057082289 11 Left 1057082283 9:92181815-92181837 CCACAAAACTGAAATCAGTGTGC No data
Right 1057082289 9:92181849-92181871 CACTACCTCCAAAGGCTCTAGGG No data
1057082283_1057082288 10 Left 1057082283 9:92181815-92181837 CCACAAAACTGAAATCAGTGTGC No data
Right 1057082288 9:92181848-92181870 ACACTACCTCCAAAGGCTCTAGG No data
1057082283_1057082290 12 Left 1057082283 9:92181815-92181837 CCACAAAACTGAAATCAGTGTGC No data
Right 1057082290 9:92181850-92181872 ACTACCTCCAAAGGCTCTAGGGG No data
1057082283_1057082293 27 Left 1057082283 9:92181815-92181837 CCACAAAACTGAAATCAGTGTGC No data
Right 1057082293 9:92181865-92181887 TCTAGGGGAAGACCCTCCCTTGG No data
1057082283_1057082287 3 Left 1057082283 9:92181815-92181837 CCACAAAACTGAAATCAGTGTGC No data
Right 1057082287 9:92181841-92181863 CAGGGACACACTACCTCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057082283 Original CRISPR GCACACTGATTTCAGTTTTG TGG (reversed) Intergenic
No off target data available for this crispr