ID: 1057082289

View in Genome Browser
Species Human (GRCh38)
Location 9:92181849-92181871
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1057082283_1057082289 11 Left 1057082283 9:92181815-92181837 CCACAAAACTGAAATCAGTGTGC No data
Right 1057082289 9:92181849-92181871 CACTACCTCCAAAGGCTCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1057082289 Original CRISPR CACTACCTCCAAAGGCTCTA GGG Intergenic
No off target data available for this crispr